ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal8e24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_470104.1| Oryza sativa (japonica cultivar-group), mRNA 119 1e-23
2dbj|AK104998.2| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 90 9e-15
4dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 90 9e-15
5gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genom... 90 9e-15
6gb|AC109594.2| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-04
7dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
8dbj|AK065463.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
9gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-04
10dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
11gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 54 5e-04
12emb|AL731884.4|CNS08C8O Oryza sativa chromosome 12, . BAC OSJNBa... 54 5e-04
13gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence 44 0.47
14gb|AE009642.1| Brucella melitensis 16M chromosome II, section 4 ... 44 0.47
15gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 44 0.47
16emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II... 44 0.47
17emb|AL390375.11| Human DNA sequence from clone RP11-505I19 on ch... 42 1.9
18emb|AL365437.14| Human DNA sequence from clone RP11-343K13 on ch... 42 1.9
19gb|AY973195.1| Anopheles gambiae defensin 2 mRNA, complete cds 42 1.9
20emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chro... 42 1.9
21gb|DQ370035.1| Anopheles gambiae defensin mRNA, complete cds 42 1.9
22gb|AC026234.4|F14O10 Sequence of BAC F14O10 from Arabidopsis tha... 42 1.9
23ref|XM_557449.1| Anopheles gambiae str. PEST ENSANGP00000026023 ... 42 1.9
24gb|AE016830.1| Enterococcus faecalis V583, complete genome 42 1.9
25emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on ch... 42 1.9
26ref|XM_363862.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 7.4
27ref|XM_569072.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 7.4
28emb|AL049539.21|HSJ836N17 Human DNA sequence from clone RP5-836N... 40 7.4
29emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 o... 40 7.4
30emb|AL806529.6| Mouse DNA sequence from clone RP23-234M1 on chro... 40 7.4
31emb|AL645704.9| Mouse DNA sequence from clone RP23-414F19 on chr... 40 7.4
32gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 7.4
33gb|AC151956.5| Medicago truncatula clone mth2-52p17, complete se... 40 7.4
34dbj|AB091589.1| Crassostrea gigas DNA, microsatellite locus TNFR... 40 7.4
35dbj|AK049045.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 7.4
36dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 7.4
37emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chr... 40 7.4
38emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chr... 40 7.4

>ref|XM_470104.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 6690

 Score =  119 bits (60), Expect = 1e-23
 Identities = 78/84 (92%)
 Strand = Plus / Plus

                                                                        
Query: 402  ccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctgctcatgat 461
            ||||||||| | ||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 6037 ccagtttcaattagaaatatcccaaggaatccactggttgatgctgttgctgcccatgat 6096

                                    
Query: 462  cgaagcacgatgcggaaggtttca 485
             |||||||||||||||||||||||
Sbjct: 6097 agaagcacgatgcggaaggtttca 6120



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                        
Query: 260  tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 319
            |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 5895 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 5954

                              
Query: 320  gatgcttcatcctaatta 337
            |||||||||||| |||||
Sbjct: 5955 gatgcttcatccaaatta 5972



to top

>dbj|AK104998.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-E05, full
            insert sequence
          Length = 1630

 Score =  119 bits (60), Expect = 1e-23
 Identities = 78/84 (92%)
 Strand = Plus / Plus

                                                                        
Query: 402  ccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctgctcatgat 461
            ||||||||| | ||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1002 ccagtttcaattagaaatatcccaaggaatccactggttgatgctgttgctgcccatgat 1061

                                    
Query: 462  cgaagcacgatgcggaaggtttca 485
             |||||||||||||||||||||||
Sbjct: 1062 agaagcacgatgcggaaggtttca 1085



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 260 tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 319
           |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 860 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 919

                             
Query: 320 gatgcttcatcctaatta 337
           |||||||||||| |||||
Sbjct: 920 gatgcttcatccaaatta 937



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Plus

                                                                            
Query: 402      ccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctgctcatgat 461
                ||||||||| | ||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 33962088 ccagtttcaattagaaatatcccaaggaatccactggttgatgctgttgctgcccatgat 33962147

                         
Query: 462      cgaagcacg 470
                 ||||||||
Sbjct: 33962148 agaagcacg 33962156



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                            
Query: 260      tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 319
                |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 33961946 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 33962005

                                  
Query: 320      gatgcttcatcctaatta 337
                |||||||||||| |||||
Sbjct: 33962006 gatgcttcatccaaatta 33962023



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Plus

                                                                            
Query: 402      ccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctgctcatgat 461
                ||||||||| | ||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 34052560 ccagtttcaattagaaatatcccaaggaatccactggttgatgctgttgctgcccatgat 34052619

                         
Query: 462      cgaagcacg 470
                 ||||||||
Sbjct: 34052620 agaagcacg 34052628



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                            
Query: 260      tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 319
                |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 34052418 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 34052477

                                  
Query: 320      gatgcttcatcctaatta 337
                |||||||||||| |||||
Sbjct: 34052478 gatgcttcatccaaatta 34052495



to top

>gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genomic sequence, complete
             sequence
          Length = 172337

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                         
Query: 402   ccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctgctcatgat 461
             ||||||||| | ||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 95603 ccagtttcaattagaaatatcccaaggaatccactggttgatgctgttgctgcccatgat 95544

                      
Query: 462   cgaagcacg 470
              ||||||||
Sbjct: 95543 agaagcacg 95535



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                         
Query: 260   tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 319
             |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 95745 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 95686

                               
Query: 320   gatgcttcatcctaatta 337
             |||||||||||| |||||
Sbjct: 95685 gatgcttcatccaaatta 95668



to top

>gb|AC109594.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0007P22, complete sequence
          Length = 148068

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 399   aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttg 450
             |||||| ||||| | ||||| |||||||| |||||||||||| |||||||||
Sbjct: 24931 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctgttg 24880



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                    
Query: 399      aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttg 450
                |||||| ||||| | ||||| |||||||| |||||||||||| |||||||||
Sbjct: 22427885 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctgttg 22427936



to top

>dbj|AK065463.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013004M04, full
           insert sequence
          Length = 1765

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 399 aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttg 450
           |||||| ||||| | ||||| |||||||| |||||||||||| |||||||||
Sbjct: 824 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctgttg 773



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                    
Query: 399      aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttg 450
                |||||| ||||| | ||||| |||||||| |||||||||||| |||||||||
Sbjct: 22737796 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctgttg 22737847



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                       
Query: 399      aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctg 453
                |||||| ||||| | ||||| |||||||| |||||||||||| ||||| ||||||
Sbjct: 23872709 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctattgctg 23872763



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                       
Query: 399      aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctg 453
                |||||| ||||| | ||||| |||||||| |||||||||||| ||||| ||||||
Sbjct: 23800914 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctattgctg 23800968



to top

>emb|AL731884.4|CNS08C8O Oryza sativa chromosome 12, . BAC OSJNBa0014A07 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 144767

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 399    aagccagtttcagtgagaaacatcccaagaaatccactggttgatgctgttgctg 453
              |||||| ||||| | ||||| |||||||| |||||||||||| ||||| ||||||
Sbjct: 100474 aagccaatttcaattagaaatatcccaagtaatccactggtttatgctattgctg 100420



to top

>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence
          Length = 1207381

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 248   tgatgaccttggtgaaggcggc 269
             ||||||||||||||||||||||
Sbjct: 55272 tgatgaccttggtgaaggcggc 55293



to top

>gb|AE009642.1| Brucella melitensis 16M chromosome II, section 4 of 107 of the
            complete sequence
          Length = 14439

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 248  tgatgaccttggtgaaggcggc 269
            ||||||||||||||||||||||
Sbjct: 5610 tgatgaccttggtgaaggcggc 5589



to top

>gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome II, complete sequence
          Length = 1162204

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 248   tgatgaccttggtgaaggcggc 269
             ||||||||||||||||||||||
Sbjct: 55071 tgatgaccttggtgaaggcggc 55092



to top

>emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II, complete sequence,
             strain 2308
          Length = 1156948

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 248   tgatgaccttggtgaaggcggc 269
             ||||||||||||||||||||||
Sbjct: 55120 tgatgaccttggtgaaggcggc 55141



to top

>emb|AL390375.11| Human DNA sequence from clone RP11-505I19 on chromosome 13, complete
            sequence
          Length = 71118

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 235  taagtaaatatcttgatgaccttgg 259
            |||||||||||||| ||||||||||
Sbjct: 6117 taagtaaatatctttatgaccttgg 6141



to top

>emb|AL365437.14| Human DNA sequence from clone RP11-343K13 on chromosome 6, complete
             sequence
          Length = 39186

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 228   agcaatataagtaaatatctt 248
             |||||||||||||||||||||
Sbjct: 32857 agcaatataagtaaatatctt 32877



to top

>gb|AY973195.1| Anopheles gambiae defensin 2 mRNA, complete cds
          Length = 292

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 267 ggctatgcacatgccgagcag 287
           |||||||||||||||||||||
Sbjct: 214 ggctatgcacatgccgagcag 234



to top

>emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chromosome 11 Contains the
             3' end of the Myh13 gene for skeletal muscle myosin heavy
             polypeptide 13, the 5' end of the Gas7 gene for growth
             arrest specific 7, a novel gene and a CpG island, complete
             sequence
          Length = 251096

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 401   gccagtttcagtgagaaacat 421
             |||||||||||||||||||||
Sbjct: 73439 gccagtttcagtgagaaacat 73459



to top

>gb|DQ370035.1| Anopheles gambiae defensin mRNA, complete cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 267 ggctatgcacatgccgagcag 287
           |||||||||||||||||||||
Sbjct: 218 ggctatgcacatgccgagcag 238



to top

>gb|AC026234.4|F14O10 Sequence of BAC F14O10 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 53889

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 13    cttcagacacaacagaacata 33
             |||||||||||||||||||||
Sbjct: 33388 cttcagacacaacagaacata 33368



to top

>ref|XM_557449.1| Anopheles gambiae str. PEST ENSANGP00000026023
           (ENSANGG00000022229), partial mRNA
          Length = 165

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 267 ggctatgcacatgccgagcag 287
           |||||||||||||||||||||
Sbjct: 101 ggctatgcacatgccgagcag 121



to top

>gb|AE016830.1| Enterococcus faecalis V583, complete genome
          Length = 3218031

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 367    aacctgaggtcacagattatc 387
              |||||||||||||||||||||
Sbjct: 714619 aacctgaggtcacagattatc 714639



to top

>emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on chromosome 4, complete
              sequence
          Length = 173351

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 157    ctgaagattatcctcatggtg 177
              |||||||||||||||||||||
Sbjct: 158159 ctgaagattatcctcatggtg 158139



to top

>ref|XM_363862.1| Magnaporthe grisea 70-15 hypothetical protein (MG01788.4) partial
           mRNA
          Length = 2715

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 177 gatcataacttggacacaga 196
           ||||||||||||||||||||
Sbjct: 679 gatcataacttggacacaga 698



to top

>ref|XM_569072.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNB00620) partial mRNA
          Length = 3454

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 438  gttgatgctgttgctgctca 457
            ||||||||||||||||||||
Sbjct: 2178 gttgatgctgttgctgctca 2159



to top

>emb|AL049539.21|HSJ836N17 Human DNA sequence from clone RP5-836N17 on chromosome 20q11.1-11.21
            Contains the 3' end of the HCK for hemopoietic cell
            kinase, the gene for novel protein (KIAA0255), the
            RPL24P1 gene for ribosomal protein L24 pseudogene 1 and
            two CpG Islands, complete sequence
          Length = 111694

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tgatgctgttgctgctcatg 459
            ||||||||||||||||||||
Sbjct: 1217 tgatgctgttgctgctcatg 1198



to top

>emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 on chromosome 6q24 Contains the
             3' end of a variant of the EPM2A gene for progressive
             myoclonus type 2 epilepsy (Lafora disease) protein
             (laforin) and a BTB/POZ domain zinc finger protein
             pseudogene, complete sequence
          Length = 115835

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 236   aagtaaatatcttgatgacc 255
             ||||||||||||||||||||
Sbjct: 70178 aagtaaatatcttgatgacc 70159



to top

>emb|AL806529.6| Mouse DNA sequence from clone RP23-234M1 on chromosome 11 Contains the
             3' end of the Nxn gene for nucleoredoxin, complete
             sequence
          Length = 74841

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 5     tgggttaccttcagacacaacaga 28
             |||| |||||||||||||||||||
Sbjct: 37947 tgggataccttcagacacaacaga 37970



to top

>emb|AL645704.9| Mouse DNA sequence from clone RP23-414F19 on chromosome 13 Contains the
             Spi11 and Spi14 genes for serine protease inhibitors 11
             and 14, the gene for a novel serine protease inhibitor
             (Spi) family member and a Spi11 pseudogene, complete
             sequence
          Length = 150424

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 418   acatcccaagaaatccactg 437
             ||||||||||||||||||||
Sbjct: 60850 acatcccaagaaatccactg 60869



to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 438    gttgatgctgttgctgctca 457
              ||||||||||||||||||||
Sbjct: 175413 gttgatgctgttgctgctca 175432



to top

>gb|AC151956.5| Medicago truncatula clone mth2-52p17, complete sequence
          Length = 120704

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 433   cactggttgatgctgttgct 452
             ||||||||||||||||||||
Sbjct: 94971 cactggttgatgctgttgct 94990



to top

>dbj|AB091589.1| Crassostrea gigas DNA, microsatellite locus TNFRI-Crgi46
          Length = 709

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 47  agtgttagaagaaggcaata 66
           ||||||||||||||||||||
Sbjct: 280 agtgttagaagaaggcaata 261



to top

>dbj|AK049045.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230095A10
            product:unclassifiable, full insert sequence
          Length = 1923

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 125  aggccagtcacatactgcagaatcaatg 152
            |||||||||||||| ||| |||||||||
Sbjct: 1282 aggccagtcacatagtgcggaatcaatg 1309



to top

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 245     tcttgatgaccttggtgaag 264
               ||||||||||||||||||||
Sbjct: 2555556 tcttgatgaccttggtgaag 2555537



to top

>emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chromosome 2, complete
              sequence
          Length = 105895

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 125    aggccagtcacatactgcagaatcaatg 152
              |||||||||||||| ||| |||||||||
Sbjct: 104108 aggccagtcacatagtgcggaatcaatg 104081



to top

>emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chromosome 2, complete
           sequence
          Length = 204398

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 125 aggccagtcacatactgcagaatcaatg 152
           |||||||||||||| ||| |||||||||
Sbjct: 213 aggccagtcacatagtgcggaatcaatg 186


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,172,196
Number of Sequences: 3902068
Number of extensions: 4172196
Number of successful extensions: 76677
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76445
Number of HSP's gapped (non-prelim): 232
length of query: 547
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 524
effective length of database: 17,143,297,704
effective search space: 8983087996896
effective search space used: 8983087996896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top