ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal7p04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_184140.2| Oryza sativa (japonica cultivar-group), mRNA Length = 988 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 30 agggagccgagcaccaaggaccccttcttcctgtggttctacgtcgacgaggagatcgc 88 |||||||||||||| |||||||| ||||| |||||||||| || || ||||| ||||| Sbjct: 697 agggagccgagcacaaaggaccctttctttgtgtggttctatgttgatgaggaaatcgc 755
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 30 agggagccgagcaccaaggaccccttcttcctgtggttctacgtcgacgaggagatcgc 88 |||||||||||||| |||||||| ||||| |||||||||| || || ||||| ||||| Sbjct: 1159489 agggagccgagcacaaaggaccctttctttgtgtggttctatgttgatgaggaaatcgc 1159431
>dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698A04 Length = 141079 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 30 agggagccgagcaccaaggaccccttcttcctgtggttctacgtcgacgaggagatcgc 88 |||||||||||||| |||||||| ||||| |||||||||| || || ||||| ||||| Sbjct: 128803 agggagccgagcacaaaggaccctttctttgtgtggttctatgttgatgaggaaatcgc 128745
>dbj|AP002487.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0684C01 Length = 78600 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 30 agggagccgagcaccaaggaccccttcttcctgtggttctacgtcgacgaggagatcgc 88 |||||||||||||| |||||||| ||||| |||||||||| || || ||||| ||||| Sbjct: 13792 agggagccgagcacaaaggaccctttctttgtgtggttctatgttgatgaggaaatcgc 13734
>dbj|AK070131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023046G14, full insert sequence Length = 988 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 30 agggagccgagcaccaaggaccccttcttcctgtggttctacgtcgacgaggagatcgc 88 |||||||||||||| |||||||| ||||| |||||||||| || || ||||| ||||| Sbjct: 697 agggagccgagcacaaaggaccctttctttgtgtggttctatgttgatgaggaaatcgc 755
>gb|AC161435.7| Mus musculus chromosome 8, clone RP23-78L21, complete sequence Length = 219937 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 321 tgggttgggatgggatggggaag 343 ||||||||||||||||||||||| Sbjct: 124972 tgggttgggatgggatggggaag 124994
>gb|AC167959.2| Mus musculus chromosome 1, clone wi1-870H21, complete sequence Length = 40520 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 31775 gggatgggttgggatgggatggg 31753 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 31670 gggatgggttgggatgggatggg 31648 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 31645 gggatgggttgggatgggatggg 31623 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 31610 gggatgggttgggatgggatggg 31588
>ref|XM_714691.1| Candida albicans SC5314 hypothetical protein (CaO19_14098), mRNA Length = 315 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 67 gggatgggttgggatgggatggg 89 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 52 gggatgggttgggatgggatggg 74 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 37 gggatgggttgggatgggatggg 59 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 22 gggatgggttgggatgggatggg 44
>ref|XM_714808.1| Candida albicans SC5314 hypothetical protein (CaO19_6806), mRNA Length = 315 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 67 gggatgggttgggatgggatggg 89 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 52 gggatgggttgggatgggatggg 74 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 37 gggatgggttgggatgggatggg 59 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 22 gggatgggttgggatgggatggg 44
>gb|AE009093.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 119 of 256 of the complete sequence Length = 10029 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 94 cgcagggcaagggcggcggcacc 116 ||||||||||||||||||||||| Sbjct: 3167 cgcagggcaagggcggcggcacc 3189
>emb|AL031123.14|HS80N2 Human DNA sequence from clone RP1-80N2 on chromosome 6p24.1-25.3 Contains the gene for MD-1,RP105-associated, part of a putative novel gene and three putative CpG islands, complete sequence Length = 193731 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 87346 gggatgggttgggatgggatggg 87368
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 94 cgcagggcaagggcggcggcacc 116 ||||||||||||||||||||||| Sbjct: 1304252 cgcagggcaagggcggcggcacc 1304274
>gb|AF197897.1|AF197897 Takifugu rubripes Nemo-like kinase (NLK) and FN5 protein (FN5) genes, complete cds; and neurofibromatosis type 1 neurofibromin (NF1) gene, partial cds Length = 16370 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 15169 gggatgggttgggatgggatggg 15147 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 15064 gggatgggttgggatgggatggg 15042 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 15034 gggatgggttgggatgggatggg 15012 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 6620 gggatgggatgggatgggatgggg 6643
>gb|AF064564.2|AF064564 Fugu rubripes neurofibromatosis type 1 (NF1), A-kinase anchor protein (AKAP84), BAW protein (BAW), and WSB1 protein (WSB1) genes, complete cds Length = 49254 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 3068 gggatgggttgggatgggatggg 3046 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 2963 gggatgggttgggatgggatggg 2941 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 2933 gggatgggttgggatgggatggg 2911
>gb|AC162375.2| Mus musculus BAC clone RP24-466F1 from chromosome 9, complete sequence Length = 164119 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggg 339 ||||||||||||||||||||||| Sbjct: 104055 gggatgggttgggatgggatggg 104077
>gb|AC115766.9| Mus musculus chromosome 1, clone RP23-82I24, complete sequence Length = 225600 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatggggaa 342 |||||||| ||||||||||||||||| Sbjct: 218586 gggatgggatgggatgggatggggaa 218561
>gb|AC117808.8| Mus musculus chromosome 1, clone RP24-570C24, complete sequence Length = 189713 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatggggaa 342 |||||||| ||||||||||||||||| Sbjct: 176459 gggatgggatgggatgggatggggaa 176484
>gb|AC092494.2| Drosophila melanogaster clone BACR23I18, complete sequence Length = 172029 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 315 tagggatgggttgggatgggatggg 339 |||||||||| |||||||||||||| Sbjct: 119306 tagggatgggatgggatgggatggg 119330
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 315 tagggatgggttgggatgggatggg 339 |||||||||| |||||||||||||| Sbjct: 159418 tagggatgggatgggatgggatggg 159442
>gb|AY456696.1| Arthrobacter aurescens strain TC1 plasmid pAA1 atrazine catabolic region, partial sequence Length = 161264 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 85 tcgccgtcgcgcagggcaagggcggcggc 113 ||||||||||||||||| |||| |||||| Sbjct: 145451 tcgccgtcgcgcagggcgagggtggcggc 145423
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 4 tccccttcggcggcggcgaca 24 ||||||||||||||||||||| Sbjct: 7656778 tccccttcggcggcggcgaca 7656798
>gb|AC009030.10| Homo sapiens chromosome 16 clone RP11-13G6, complete sequence Length = 189379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatg 337 ||||||||||||||||||||| Sbjct: 133388 gggatgggttgggatgggatg 133408
>gb|AY994717.1| Costus subsessilis voucher C.D. Specht 98-217 (NY) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence Length = 476 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 318 ggatgggttgggatgggatgg 338 ||||||||||||||||||||| Sbjct: 34 ggatgggttgggatgggatgg 14
>gb|AC129008.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0096L14, from chromosome 3, complete sequence Length = 131142 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 tccccttcggcggcggcgaca 24 ||||||||||||||||||||| Sbjct: 58512 tccccttcggcggcggcgaca 58492
>gb|AC098575.6| Drosophila melanogaster X BAC RP98-3D13 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 155685 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 84134 gggatgggatgggatgggatgggga 84110
>gb|DQ277263.1| Drosophila melanogaster isolate mz42 locus 204 genomic sequence Length = 830 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 624 gggatgggatgggatgggatgggga 648
>gb|DQ277262.1| Drosophila melanogaster isolate mz41 locus 204 genomic sequence Length = 828 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 622 gggatgggatgggatgggatgggga 646
>gb|DQ277261.1| Drosophila melanogaster isolate mz39 locus 204 genomic sequence Length = 830 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 624 gggatgggatgggatgggatgggga 648
>gb|DQ277260.1| Drosophila melanogaster isolate mz36 locus 204 genomic sequence Length = 834 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 628 gggatgggatgggatgggatgggga 652
>gb|DQ277259.1| Drosophila melanogaster isolate mz35 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277258.1| Drosophila melanogaster isolate mz22 locus 204 genomic sequence Length = 837 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 631 gggatgggatgggatgggatgggga 655
>gb|DQ277256.1| Drosophila melanogaster isolate mz20 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277254.1| Drosophila melanogaster isolate mz16 locus 204 genomic sequence Length = 834 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 628 gggatgggatgggatgggatgggga 652
>gb|DQ277253.1| Drosophila melanogaster isolate mz15 locus 204 genomic sequence Length = 827 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 634 gggatgggatgggatgggatgggga 658
>gb|DQ277251.1| Drosophila melanogaster isolate mz10 locus 204 genomic sequence Length = 834 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 628 gggatgggatgggatgggatgggga 652
>gb|DQ277250.1| Drosophila melanogaster isolate mz07 locus 204 genomic sequence Length = 831 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 625 gggatgggatgggatgggatgggga 649
>gb|DQ277249.1| Drosophila melanogaster isolate mb77 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277248.1| Drosophila melanogaster isolate mb56 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277247.1| Drosophila melanogaster isolate mb52 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277245.1| Drosophila melanogaster isolate mb39 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277244.1| Drosophila melanogaster isolate mb36 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277242.1| Drosophila melanogaster isolate mb22 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277241.1| Drosophila melanogaster isolate mb18 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277240.1| Drosophila melanogaster isolate mb15 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277239.1| Drosophila melanogaster isolate mb12 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277238.1| Drosophila melanogaster isolate mb05 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277237.1| Drosophila melanogaster isolate me68 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277236.1| Drosophila melanogaster isolate me66 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277235.1| Drosophila melanogaster isolate me54 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277234.1| Drosophila melanogaster isolate me46 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277233.1| Drosophila melanogaster isolate me38 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277231.1| Drosophila melanogaster isolate me27 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277229.1| Drosophila melanogaster isolate me20 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277228.1| Drosophila melanogaster isolate me17 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277227.1| Drosophila melanogaster isolate me13 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>gb|DQ277226.1| Drosophila melanogaster isolate me08 locus 204 genomic sequence Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 629 gggatgggatgggatgggatgggga 653
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 4 tccccttcggcggcggcgaca 24 ||||||||||||||||||||| Sbjct: 7654613 tccccttcggcggcggcgaca 7654633
>gb|AC154741.3| Mus musculus BAC clone RP24-392C9 from chromosome 9, complete sequence Length = 178684 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 107586 gggatgggatgggatgggatgggga 107562
>gb|AC130449.2| Homo sapiens chromosome 16 clone CTA-233A7, complete sequence Length = 175104 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatg 337 ||||||||||||||||||||| Sbjct: 82303 gggatgggttgggatgggatg 82283
>dbj|AK119222.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-E03, full insert sequence Length = 2098 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 tccccttcggcggcggcgaca 24 ||||||||||||||||||||| Sbjct: 1662 tccccttcggcggcggcgaca 1642
>dbj|AK112059.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A11, full insert sequence Length = 2025 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 tccccttcggcggcggcgaca 24 ||||||||||||||||||||| Sbjct: 1662 tccccttcggcggcggcgaca 1642
>dbj|AK111566.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074J05, full insert sequence Length = 1556 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 tccccttcggcggcggcgaca 24 ||||||||||||||||||||| Sbjct: 1088 tccccttcggcggcggcgaca 1068
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 315 tagggatgggttgggatgggatggg 339 |||||||||| |||||||||||||| Sbjct: 259398 tagggatgggatgggatgggatggg 259422
>gb|AE003426.3| Drosophila melanogaster chromosome X, section 10 of 74 of the complete sequence Length = 396604 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 37126 gggatgggatgggatgggatgggga 37150
>gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, complete sequence Length = 169085 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggga 341 |||||||| |||||||||||||||| Sbjct: 34054 gggatgggatgggatgggatgggga 34030
>gb|AY693425.1| Drosophila pseudoobscura isolate BP_159_160_C distal Arrowhead inversion breakpoint region Length = 20941 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 16324 gggatgggatgggatgggatgggg 16347
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 17457 gggatgggatgggatgggatgggg 17480
>gb|AC137855.14| Mus musculus chromosome 16, clone RP24-444E8, complete sequence Length = 196783 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 27606 gggatgggatgggatgggatgggg 27583
>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11, complete sequence Length = 115808 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 tcggcggcggcgacatgagc 29 |||||||||||||||||||| Sbjct: 3641 tcggcggcggcgacatgagc 3622
>gb|AC119291.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052K01, complete sequence Length = 144395 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 tcggcggcggcgacatgagc 29 |||||||||||||||||||| Sbjct: 136119 tcggcggcggcgacatgagc 136100
>ref|XM_475799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1596 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 tcggcggcggcgacatgagc 29 |||||||||||||||||||| Sbjct: 795 tcggcggcggcgacatgagc 814
>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence Length = 216652 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 25642 gggatgggatgggatgggatgggg 25665
>gb|AC151667.1| Pan troglodytes chromosome X clone RP43-007H19 map human ortholog q28, complete sequence Length = 200796 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 90170 agggatgggatgggatgggatggg 90147 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 90164 gggatgggatgggatgggatgggg 90141
>gb|AC114908.9| Mus musculus chromosome 3, clone RP24-173L8, complete sequence Length = 145363 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 90863 gggatgggatgggatgggatgggg 90886 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 90837 agggatgggatgggatgggatggg 90860
>gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, complete sequence Length = 195159 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 174132 agggatgggatgggatgggatggg 174109
>gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, complete sequence Length = 220762 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 196577 gggatgggatgggatgggatgggg 196554
>gb|AC148878.2| Chlamydomonas reinhardtii clone cr-29B2, complete sequence Length = 64153 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 gcagggcaagggcggcggca 114 |||||||||||||||||||| Sbjct: 55441 gcagggcaagggcggcggca 55460
>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome Length = 2650701 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 180 ggtttcaacataatttagat 199 |||||||||||||||||||| Sbjct: 773503 ggtttcaacataatttagat 773522
>gb|AC133090.4| Mus musculus BAC clone RP24-194H23 from chromosome 15, complete sequence Length = 148555 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 107765 agggatgggatgggatgggatggg 107788
>gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, complete sequence Length = 236536 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 202117 gggatggggtgggatgggatgggg 202094
>gb|AC140353.2| Mus musculus BAC clone RP24-67E1 from chromosome 5, complete sequence Length = 161652 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 45007 gggatgggatgggatgggatgggg 44984
>gb|AC005158.3| Homo sapiens BAC clone GS1-250N6 from 7, complete sequence Length = 266344 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 147953 gggatgggatgggatgggatgggg 147976
>ref|XM_757301.1| Ustilago maydis 521 hypothetical protein (UM06247.1) partial mRNA Length = 1434 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 199 agggatgggatgggatgggatggg 176
>gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome 6, complete sequence Length = 154613 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 19021 gggatgggatgggatgggatgggg 19044
>gb|AC121839.3| Mus musculus BAC clone RP24-76E2 from chromosome 13, complete sequence Length = 182835 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 73724 gggatgggatgggatgggatgggg 73747
>gb|AC087728.3| Papio anubis clone RP41-340H23, complete sequence Length = 198888 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 71059 agggatgggatgggatgggatggg 71036
>emb|BX640401.2| Chicken DNA sequence from clone WAG-106I4, complete sequence Length = 104753 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 13926 gggatgggatgggatgggatgggg 13903
>gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-132J21, complete sequence Length = 200910 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 108586 gggatgggatgggatgggatgggg 108609
>gb|AC124189.3| Mus musculus BAC clone RP23-254C8 from 5, complete sequence Length = 150507 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 143355 gggatgggatgggatgggatgggg 143332
>emb|Z97635.10|HS438L4 Human DNA sequence from clone RP3-438L4 on chromosome 1p36.2-36.3 Contains part of the CAMTA1 gene for calmodulin binding transcription activator 1, complete sequence Length = 87100 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 12310 gggatgggatgggatgggatgggg 12287
>emb|Z68754.1|HSE78H10 Human DNA sequence from clone LL22NC01-78H10 on chromosome 22, complete sequence Length = 24888 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 2257 gggatgggatgggatgggatgggg 2234
>emb|AL512628.12| Human DNA sequence from clone RP11-6P10 on chromosome 10 Contains the gene for 155kD polymerase (RNA) III (DNA directed) (RPC155), the RPS24 gene for ribosomal protein S24 and a CpG island, complete sequence Length = 95562 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 69636 agggatgggatgggatgggatggg 69659
>emb|AJ893305.1| Uncultured ectomycorrhiza (Thelephoraceae) 5.8S rRNA gene, 28S rRNA gene (partial), ITS1 and ITS2, isolate L280_T14 Length = 959 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 tcttcctgtggttctacgtc 74 |||||||||||||||||||| Sbjct: 115 tcttcctgtggttctacgtc 134
>ref|XM_965102.1| PREDICTED: Tribolium castaneum similar to CG8814-PA (LOC658740), mRNA Length = 2361 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 agggcggcgtcccgccttct 171 |||||||||||||||||||| Sbjct: 1659 agggcggcgtcccgccttct 1678
>gb|AC161921.5| Mus musculus chromosome 1, clone RP24-402C17, complete sequence Length = 170279 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 154972 gggatgggatgggatgggatgggg 154949
>emb|AJ238108.1|ACH238108 Acremonium chrysogenum cah gene, exons 1-3 Length = 1621 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 319 gatgggttgggatgggatgg 338 |||||||||||||||||||| Sbjct: 106 gatgggttgggatgggatgg 87
>gb|AC158749.5| Mus musculus chromosome 7, clone RP23-285C18, complete sequence Length = 237364 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 177457 gggatgggatgggatgggatgggg 177480 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 177392 gggatgggatgggatgggatgggg 177415
>gb|AC153008.4| Mus musculus BAC clone RP23-457I7 from chromosome 15, complete sequence Length = 171878 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 165216 agggatgggatgggatgggatggg 165193
>emb|BX908803.7| Zebrafish DNA sequence from clone CH211-13C14 in linkage group 3, complete sequence Length = 186802 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 384 aaatgctagacgtataagga 403 |||||||||||||||||||| Sbjct: 53064 aaatgctagacgtataagga 53083
>gb|AC144374.5| Gallus gallus strain White Leghorn clone xx-37d21, complete sequence Length = 141874 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 136987 gggatgggatgggatgggatgggg 137010
>gb|DQ417225.1| Aspergillus niger strain CBS 513.88 putative endo-rhamnogalacturonase F (rhgF) gene, complete cds Length = 2218 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 320 atgggttgggatgggatggg 339 |||||||||||||||||||| Sbjct: 2048 atgggttgggatgggatggg 2067
>gb|AC051654.9| Homo sapiens chromosome 8, clone RP11-35O14, complete sequence Length = 176393 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 126319 gggatgggatgggatgggatgggg 126342 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 126279 gggatgggatgggatgggatgggg 126302
>gb|AC092133.2| Homo sapiens chromosome 16 clone RP11-20D16, complete sequence Length = 156351 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 ggtttcaacataatttagatagat 203 |||||||| ||||||||||||||| Sbjct: 17392 ggtttcaaaataatttagatagat 17369
>gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, complete sequence Length = 200525 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 151915 agggatgggatgggatgggatggg 151938
>gb|AC108131.2| Homo sapiens chromosome 16 clone RP11-337N9, complete sequence Length = 151941 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 ggtttcaacataatttagatagat 203 |||||||| ||||||||||||||| Sbjct: 74285 ggtttcaaaataatttagatagat 74262
>gb|AC015617.8| Homo sapiens, clone RP11-45H23, complete sequence Length = 160541 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 93500 agggatgggatgggatgggatggg 93477
>gb|AC169375.4| Sorghum bicolor clone SB_BBc0020O07, complete sequence Length = 117931 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 gaggatcatgcatgtatagg 318 |||||||||||||||||||| Sbjct: 60107 gaggatcatgcatgtatagg 60126
>gb|AC099027.1| Drosophila melanogaster, chromosome 2R, region 53C-53D, BAC clone BACR06I15, complete sequence Length = 185425 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 131846 gggatgggatgggatgggatgggg 131823
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 86 cgccgtcgcgcagggcaagggcgg 109 |||| ||||||||||||||||||| Sbjct: 3371662 cgccctcgcgcagggcaagggcgg 3371685
>gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9, complete sequence Length = 185444 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 83878 gggatggggtgggatgggatgggg 83855
>gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome 9, complete sequence Length = 241917 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 10792 agggatgggatgggatgggatggg 10815
>gb|AC159880.2| Mus musculus BAC clone RP24-490L14 from chromosome 9, complete sequence Length = 142451 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 55583 gggatgggatgggatgggatgggg 55606
>gb|AC133897.15| Mus musculus chromosome 5, clone RP24-357G2, complete sequence Length = 177013 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 7237 gggatgggatgggatgggatgggg 7214
>gb|AF328738.1|AF328738 Agelaius phoeniceus cosmid Rwcos3, partial sequence Length = 45375 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 9414 agggatgggatgggatgggatggg 9391 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 9363 gggatgggatgggatgggatgggg 9340
>gb|AC010339.8|AC010339 Homo sapiens chromosome 5 clone CTD-2009A17, complete sequence Length = 122480 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 115033 agggatgggatgggatgggatggg 115056
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 315 tagggatgggttgggatgggatgg 338 |||||||||||| ||||||||||| Sbjct: 1240725 tagggatgggttaggatgggatgg 1240748
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 tcggcggcggcgacatgagc 29 |||||||||||||||||||| Sbjct: 26622644 tcggcggcggcgacatgagc 26622625
>gb|AC008313.3|AC008313 Drosophila melanogaster, chromosome 3R, region 84D-84E, BAC clone BACR11D12, complete sequence Length = 189596 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 116243 gggatgggatgggatgggatgggg 116220
>gb|AC104815.4| Homo sapiens BAC clone RP11-687B11 from 2, complete sequence Length = 41839 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 20508 gggatgggatgggatgggatgggg 20531 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 20322 gggatgggatgggatgggatgggg 20345 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 20105 gggatgggatgggatgggatgggg 20128
>gb|AC008663.6|AC008663 Homo sapiens chromosome 5 clone CTB-33O18, complete sequence Length = 142859 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 26782 agggatgggatgggatgggatggg 26805
>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence Length = 164201 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 125888 agggatgggatgggatgggatggg 125865
>gb|AC146165.2| Pan troglodytes BAC clone RP43-36N14 from chromosome 7, complete sequence Length = 159324 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 93665 gggatgggatgggatgggatgggg 93642 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 91286 gggatgggatgggatgggatgggg 91309
>gb|AC012365.6| Homo sapiens BAC clone RP11-459C22 from 2, complete sequence Length = 187848 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 95070 agggatgggatgggatgggatggg 95047
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 tcgcgcagggcaagggcggc 110 |||||||||||||||||||| Sbjct: 6231473 tcgcgcagggcaagggcggc 6231492
>gb|AE004918.1| Pseudomonas aeruginosa PAO1, section 479 of 529 of the complete genome Length = 11170 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 90 gtcgcgcagggcaagggcggcggc 113 |||||||||||| ||||||||||| Sbjct: 302 gtcgcgcagggccagggcggcggc 325
>gb|U82671.5| Homo sapiens chromosome X multiple clones map q28, complete sequence Length = 324604 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 200428 agggatgggatgggatgggatggg 200405 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 200407 gggatgggatgggatgggatgggg 200384
>ref|XM_574731.1| PREDICTED: Rattus norvegicus similar to B7-like protein GL50-B (LOC499415), mRNA Length = 1644 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 1586 gggatgggatgggatgggatgggg 1563
>gb|AF170972.1|AF170972 Agelaius phoeniceus cosmid 10, complete sequence Length = 38786 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 8529 agggatgggatgggatgggatggg 8552
>gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosome 9, complete sequence Length = 212426 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 47921 gggatgggatgggatgggatgggg 47898
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 88 ccgtcgcgcagggcaagggcggcggcac 115 |||||||||| | ||||||||||||||| Sbjct: 6485046 ccgtcgcgcatgccaagggcggcggcac 6485073
>emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chromosome 2, complete sequence Length = 115075 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 tgggttgggatgggatgggg 340 |||||||||||||||||||| Sbjct: 42103 tgggttgggatgggatgggg 42122
>emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on chromosome 2, complete sequence Length = 103290 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 39198 gggatggggtgggatgggatgggg 39175
>emb|BX649229.2| Chicken DNA sequence from clone WAG-41C10, complete sequence Length = 147869 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 21913 gggatgggatgggatgggatgggg 21890
>emb|AL929140.16| Mouse DNA sequence from clone RP23-188A4 on chromosome 2, complete sequence Length = 120665 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 105715 gggatgggatgggatgggatgggg 105738
>dbj|AK119438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-133-B04, full insert sequence Length = 2579 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 tcggcggcggcgacatgagc 29 |||||||||||||||||||| Sbjct: 1700 tcggcggcggcgacatgagc 1719
>emb|AJ329179.1|HSA329179 Homo sapiens genomic sequence surrounding NotI site, clone NR1-KN16R Length = 1031 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 agggcaagggcggcggcacc 116 |||||||||||||||||||| Sbjct: 118 agggcaagggcggcggcacc 137
>emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046 Length = 340000 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 117095 agggatgggatgggatgggatggg 117118
>emb|CT573036.11| Mouse DNA sequence from clone RP24-376I11 on chromosome 9, complete sequence Length = 136639 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 101153 agggatgggatgggatgggatggg 101176
>gb|AC140346.4| Mus musculus BAC clone RP24-260I8 from 16, complete sequence Length = 185587 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 51598 gggatgggatgggatgggatgggg 51621
>gb|AE003676.4| Drosophila melanogaster chromosome 3R, section 14 of 118 of the complete sequence Length = 267607 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 192782 gggatgggatgggatgggatgggg 192759
>gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43 of 73 of the complete sequence Length = 258223 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 236968 gggatgggatgggatgggatgggg 236991
>gb|AC101699.9| Mus musculus chromosome 1, clone RP23-244H18, complete sequence Length = 173113 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 37091 gggatgggatgggatgggatgggg 37068
>gb|AC161468.2| Gallus gallus BAC clone CH261-94J19 from chromosome unknown, complete sequence Length = 238361 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 175697 gggatgggatgggatgggatgggg 175674 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||||||| ||||||||||| Sbjct: 138869 gggatgggttggaatgggatgggg 138892 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||||||| ||||||||||| Sbjct: 138844 gggatgggttggaatgggatgggg 138867 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||||||| ||||||||||| Sbjct: 138794 gggatgggttggaatgggatgggg 138817 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||||||| ||||||||||| Sbjct: 138744 gggatgggttggaatgggatgggg 138767 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||||||| ||||||||||| Sbjct: 138694 gggatgggttggaatgggatgggg 138717
>dbj|AP000486.6| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-23I22, complete sequence Length = 152472 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 151454 agggatgggatgggatgggatggg 151477
>gb|AC164569.3| Gallus gallus BAC clone CH261-138K23 from chromosome unknown, complete sequence Length = 248284 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 214533 gggatgggatgggatgggatgggg 214556
>gb|AC005147.1|AC005147 Drosophila melanogaster DNA sequence (P1s DS02829 (D189) and DS00090 (D235)), complete sequence Length = 90065 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 87608 gggatgggatgggatgggatgggg 87585
>dbj|AP003354.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1507C5 Length = 148405 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 85921 gggatgggatgggatgggatgggg 85898 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 85881 gggatgggatgggatgggatgggg 85858
>emb|AL845534.7| Mouse DNA sequence from clone RP23-223C17 on chromosome 2, complete sequence Length = 191379 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 55589 agggatgggatgggatgggatggg 55612
>emb|AL512308.19| Human DNA sequence from clone RP11-164H16 on chromosome 6, complete sequence Length = 107455 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 32907 agggatgggatgggatgggatggg 32884
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 315 tagggatgggttgggatgggatgg 338 |||||||||||| ||||||||||| Sbjct: 1240725 tagggatgggttaggatgggatgg 1240748
>emb|BX000509.2|CNS08CDZ Oryza sativa chromosome 12, . BAC OJ1085_G07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 121556 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 tagggatgggttgggatgggatgg 338 |||||||||||| ||||||||||| Sbjct: 52057 tagggatgggttaggatgggatgg 52034
>gb|AC126669.4| Mus musculus BAC clone RP24-457D15 from 9, complete sequence Length = 180081 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 4958 gggatggggtgggatgggatgggg 4935 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 4768 gggatgggatgggatgggatgggg 4745 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 4673 gggatgggatgggatgggatgggg 4650 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 4563 gggatggggtgggatgggatgggg 4540 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 4143 gggatgggatgggatgggatgggg 4120
>emb|AL772137.8| Mouse DNA sequence from clone RP23-229A22 on chromosome 4, complete sequence Length = 165975 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 45967 agggatgggatgggatgggatggg 45944
>emb|CT025619.9| Mouse DNA sequence from clone RP23-442M18 on chromosome 9, complete sequence Length = 193329 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 317 gggatgggttgggatgggatgggg 340 |||||||| ||||||||||||||| Sbjct: 80164 gggatgggatgggatgggatgggg 80187
>gb|U73780.1|PAU73780 Pseudomonas aeruginosa penicillin-binding protein 1A (ponA) gene, complete cds, and malic enzyme gene, partial cds Length = 3045 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 90 gtcgcgcagggcaagggcggcggc 113 |||||||||||| ||||||||||| Sbjct: 2901 gtcgcgcagggccagggcggcggc 2924
>emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F18108Q13, complete sequence Length = 152383 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 114135 agggatgggatgggatgggatggg 114158
>gb|AC122127.31| Mus musculus chromosome 1, clone RP24-401K1, complete sequence Length = 193324 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 33320 agggatgggatgggatgggatggg 33297
>dbj|AP003680.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-739B23, complete sequences Length = 49000 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 agggatgggttgggatgggatggg 339 ||||||||| |||||||||||||| Sbjct: 1235 agggatgggatgggatgggatggg 1258 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,115,332 Number of Sequences: 3902068 Number of extensions: 3115332 Number of successful extensions: 65560 Number of sequences better than 10.0: 158 Number of HSP's better than 10.0 without gapping: 158 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63675 Number of HSP's gapped (non-prelim): 1765 length of query: 437 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 415 effective length of database: 17,147,199,772 effective search space: 7116087905380 effective search space used: 7116087905380 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
