ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal8a09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ234421.1|HVU234421 Hordeum vulgare partial mRNA; clone cMW... 890 0.0
2ref|XM_471067.1| Oryza sativa (japonica cultivar-group), predic... 48 0.026
3gb|BT016568.1| Zea mays clone Contig401 mRNA sequence 48 0.026
4dbj|AK061898.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
5gb|DQ427307.1| Sorghum bicolor voucher PI585454 locus CSU535 gen... 48 0.026
6gb|DQ427306.1| Sorghum bicolor voucher PI267539 locus CSU535 gen... 48 0.026
7gb|DQ427305.1| Sorghum bicolor voucher PI267408 locus CSU535 gen... 48 0.026
8gb|DQ427304.1| Sorghum bicolor voucher PI221607 locus CSU535 gen... 48 0.026
9gb|DQ427303.1| Sorghum bicolor voucher PI152702 locus CSU535 gen... 48 0.026
10gb|DQ427302.1| Sorghum bicolor voucher NSL92371 locus CSU535 gen... 48 0.026
11gb|DQ427301.1| Sorghum bicolor voucher NSL87902b locus CSU535 ge... 48 0.026
12gb|DQ427300.1| Sorghum bicolor voucher NSL87902a locus CSU535 ge... 48 0.026
13gb|DQ427299.1| Sorghum bicolor voucher NSL87666 locus CSU535 gen... 48 0.026
14gb|DQ427298.1| Sorghum bicolor voucher NSL77217 locus CSU535 gen... 48 0.026
15gb|DQ427297.1| Sorghum bicolor voucher NSL77034 locus CSU535 gen... 48 0.026
16gb|DQ427296.1| Sorghum bicolor voucher NSL56174 locus CSU535 gen... 48 0.026
17gb|DQ427295.1| Sorghum bicolor voucher NSL56003 locus CSU535 gen... 48 0.026
18gb|DQ427294.1| Sorghum bicolor voucher NSL55243 locus CSU535 gen... 48 0.026
19gb|DQ427293.1| Sorghum bicolor voucher NSL51365 locus CSU535 gen... 48 0.026
20gb|DQ427292.1| Sorghum bicolor voucher NSL51030 locus CSU535 gen... 48 0.026
21gb|DQ427291.1| Sorghum bicolor voucher NSL50875 locus CSU535 gen... 48 0.026
22gb|DQ427290.1| Sorghum bicolor voucher BTx623 locus CSU535 genom... 48 0.026
23emb|AJ698084.1| Oryza sativa (japonica cultivar-group) mRNA for ... 48 0.026
24dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
25dbj|AK065035.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
26emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4,... 48 0.026
27gb|DQ427308.1| Sorghum propinquum locus CSU535 genomic sequence 44 0.41
28gb|CP000302.1| Shewanella denitrificans OS217, complete genome 42 1.6
29gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 42 1.6
30gb|AF051802.1|AF051802 Feline immunodeficiency virus isolate FIV... 42 1.6
31gb|AC115033.9| Mus musculus chromosome 15, clone RP24-269A7, com... 40 6.4
32gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, comp... 40 6.4
33gb|AC101775.10| Mus musculus chromosome 19, clone RP24-116B5, co... 40 6.4
34gb|AC006024.1| Homo sapiens PAC clone RP5-1166G19 from 7, comple... 40 6.4
35emb|AL591069.5| Human DNA sequence from clone RP11-72O9 on chrom... 40 6.4
36emb|AL359714.18| Human DNA sequence from clone RP11-22A15 on chr... 40 6.4
37gb|AC159978.4| Mus musculus chromosome 15, clone RP24-173F4, com... 40 6.4
38gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 m... 40 6.4
39gb|AC022679.9| Homo sapiens chromosome 8, clone RP11-386G21, com... 40 6.4
40gb|AC148317.3| Pan troglodytes BAC clone CH251-519K22 from chrom... 40 6.4
41ref|NM_064268.1| Caenorhabditis elegans Serpentine Receptor, cla... 40 6.4
42ref|NM_064267.1| Caenorhabditis elegans Serpentine Receptor, cla... 40 6.4
43ref|XM_393538.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 6.4
44ref|XM_231251.3| PREDICTED: Rattus norvegicus G protein-coupled ... 40 6.4
45gb|AY107844.1| Zea mays PCO146552 mRNA sequence 40 6.4
46emb|Z81124.1|CET21B4 Caenorhabditis elegans Cosmid T21B4, comple... 40 6.4
47emb|CT009715.15| Mouse DNA sequence from clone RP23-85E24 on chr... 40 6.4
48emb|Y13298.1|HSY13298 Homo sapiens GDP dissociation inhibitor be... 40 6.4
49dbj|AP000829.4| Homo sapiens genomic DNA, chromosome 18p clone:R... 40 6.4

>emb|AJ234421.1|HVU234421 Hordeum vulgare partial mRNA; clone cMWG0682
          Length = 577

 Score =  890 bits (449), Expect = 0.0
 Identities = 463/465 (99%), Gaps = 2/465 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cactggacgggcaacctacccaaagtcttcgtgataggcagcgtggtcgccctggcttgc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112 cactggacgggcaacctacccaaagtcttcgtgataggcagcgtggtcgccctggcttgc 171

                                                                       
Query: 61  accttcgacaaggggctactgaccaaggctctcgtgttcggaacggcaagaaggtttgca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 accttcgacaaggggctactgaccaaggctctcgtgttcggaacggcaagaaggtttgca 231

                                                                       
Query: 121 ggaccaggaagaagatagg-aaccaaacatccgcgcctatcaccgcaatgccatgcacat 179
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 232 ggaccaggaagaagatagggaaccaaacatccgcgcctatcaccgcaatgccatgcacat 291

                                                                       
Query: 180 tcattctgatgcacaaccgagcgacgctatccggtattatctttggtcctgagacgctcg 239
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 292 tcattctgatgcacaaccgagcgacgctatccggtattatctt-ggtcctgagacgctcg 350

                                                                       
Query: 240 cgcttgcagatgaggacatagggacgaggtttgctcgtggtagaaagcatctgtaagcag 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 cgcttgcagatgaggacatagggacgaggtttgctcgtggtagaaagcatctgtaagcag 410

                                                                       
Query: 300 gcttgtgtacatactgctgtagctgcagtctgtgaagctgagagctgattaggacataga 359
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 gcttgtgtacatactgctgtagctgcagtctgtgaagctgagagctgattaggacataga 470

                                                                       
Query: 360 accatggtgataatgagactgattggattgttggatgctgagacataaccatcatcatta 419
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 accatggtgataatgagactgattggattgttggatgctgagacataaccatcatcatta 530

                                                        
Query: 420 atgatgatgtactgcaatgaataaggctcttattttggaggtgct 464
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 531 atgatgatgtactgcaatgaataaggctcttattttggaggtgct 575



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 409 catcatcattaatgatgatg 428
           ||||||||||||||||||||
Sbjct: 539 catcatcattaatgatgatg 520



to top

>ref|XM_471067.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1203

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 85   aaggctctcgtgttcggaacggcaagaaggtttgcaggaccaggaagaagat 136
            ||||||||| | || || ||||| || |||||||||||||||||||| ||||
Sbjct: 1150 aaggctctcatatttggtacggcgaggaggtttgcaggaccaggaaggagat 1201



to top

>gb|BT016568.1| Zea mays clone Contig401 mRNA sequence
          Length = 845

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 46  gtcgccctggcttgcaccttcgac 69
           ||||||||||||||||||||||||
Sbjct: 136 gtcgccctggcttgcaccttcgac 159



to top

>dbj|AK061898.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-H01, full
            insert sequence
          Length = 1620

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 85   aaggctctcgtgttcggaacggcaagaaggtttgcaggaccaggaagaagat 136
            ||||||||| | || || ||||| || |||||||||||||||||||| ||||
Sbjct: 1192 aaggctctcatatttggtacggcgaggaggtttgcaggaccaggaaggagat 1243



to top

>gb|DQ427307.1| Sorghum bicolor voucher PI585454 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427306.1| Sorghum bicolor voucher PI267539 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427305.1| Sorghum bicolor voucher PI267408 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427304.1| Sorghum bicolor voucher PI221607 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427303.1| Sorghum bicolor voucher PI152702 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427302.1| Sorghum bicolor voucher NSL92371 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427301.1| Sorghum bicolor voucher NSL87902b locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427300.1| Sorghum bicolor voucher NSL87902a locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427299.1| Sorghum bicolor voucher NSL87666 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427298.1| Sorghum bicolor voucher NSL77217 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427297.1| Sorghum bicolor voucher NSL77034 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427296.1| Sorghum bicolor voucher NSL56174 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427295.1| Sorghum bicolor voucher NSL56003 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427294.1| Sorghum bicolor voucher NSL55243 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427293.1| Sorghum bicolor voucher NSL51365 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427292.1| Sorghum bicolor voucher NSL51030 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427291.1| Sorghum bicolor voucher NSL50875 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>gb|DQ427290.1| Sorghum bicolor voucher BTx623 locus CSU535 genomic sequence
          Length = 689

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                   
Query: 106 gcaagaaggtttgcaggaccagga 129
           || |||||||||||||| ||||||
Sbjct: 136 gcgagaaggtttgcagggccagga 159



to top

>emb|AJ698084.1| Oryza sativa (japonica cultivar-group) mRNA for membrane related
            protein (mrp1 gene)
          Length = 1366

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 85   aaggctctcgtgttcggaacggcaagaaggtttgcaggaccaggaagaagat 136
            ||||||||| | || || ||||| || |||||||||||||||||||| ||||
Sbjct: 1195 aaggctctcatatttggtacggcgaggaggtttgcaggaccaggaaggagat 1246



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                   
Query: 85      aaggctctcgtgttcggaacggcaagaaggtttgcaggaccaggaagaagat 136
               ||||||||| | || || ||||| || |||||||||||||||||||| ||||
Sbjct: 1136407 aaggctctcatatttggtacggcgaggaggtttgcaggaccaggaaggagat 1136356



to top

>dbj|AK065035.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001H07, full
            insert sequence
          Length = 1869

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 85   aaggctctcgtgttcggaacggcaagaaggtttgcaggaccaggaagaagat 136
            ||||||||| | || || ||||| || |||||||||||||||||||| ||||
Sbjct: 1437 aaggctctcatatttggtacggcgaggaggtttgcaggaccaggaaggagat 1488



to top

>emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0020P07,
             complete sequence
          Length = 167895

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 85    aaggctctcgtgttcggaacggcaagaaggtttgcaggaccaggaagaagat 136
             ||||||||| | || || ||||| || |||||||||||||||||||| ||||
Sbjct: 78789 aaggctctcatatttggtacggcgaggaggtttgcaggaccaggaaggagat 78738



to top

>gb|DQ427308.1| Sorghum propinquum locus CSU535 genomic sequence
          Length = 696

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                                 
Query: 106 gcaagaaggtttgcaggaccag 127
           || |||||||||||||| ||||
Sbjct: 136 gcgagaaggtttgcagggccag 157



to top

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 398     tgagacataaccatcatcattaatg 422
               |||||||||||||||| ||||||||
Sbjct: 4407081 tgagacataaccatcaccattaatg 4407105



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 398     tgagacataaccatcatcattaatg 422
               |||||||||||||||| ||||||||
Sbjct: 2270129 tgagacataaccatcaccattaatg 2270153



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 366   gtgataatgagactgattggattgt 390
             ||||||| |||||||||||||||||
Sbjct: 18460 gtgataaagagactgattggattgt 18436



to top

>gb|AF051802.1|AF051802 Feline immunodeficiency virus isolate FIV-FcaWg1-2 pol polyprotein
           (pol) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcaggaccaggaagaagata 137
           |||||||||||||||||||||
Sbjct: 254 tgcaggaccaggaagaagata 274



to top

>gb|AC115033.9| Mus musculus chromosome 15, clone RP24-269A7, complete sequence
          Length = 147113

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 408    ccatcatcattaatgatgat 427
              ||||||||||||||||||||
Sbjct: 135891 ccatcatcattaatgatgat 135910



to top

>gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, complete sequence
          Length = 189100

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 310   atactgctgtagctgcagtctgtg 333
             ||||||||||||||| ||||||||
Sbjct: 70990 atactgctgtagctggagtctgtg 71013



to top

>gb|AC101775.10| Mus musculus chromosome 19, clone RP24-116B5, complete sequence
          Length = 167945

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 276   gtggtagaaagcatctgtaa 295
             ||||||||||||||||||||
Sbjct: 28418 gtggtagaaagcatctgtaa 28399



to top

>gb|AC006024.1| Homo sapiens PAC clone RP5-1166G19 from 7, complete sequence
          Length = 90583

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   tgcacattcattctgatgca 192
             ||||||||||||||||||||
Sbjct: 87496 tgcacattcattctgatgca 87477



to top

>emb|AL591069.5| Human DNA sequence from clone RP11-72O9 on chromosome 6q25.2-26
             Contains the 3' end of the SSLC22A3 gene for solute
             carrier family 22 (extraneuronal monoamine transporter),
             member 3 (extraneuronal monoamine transporter solute
             carrier family 22 (organic cation transporter), member
             3(EMT, EMTh, OCT3)), the APOARGC gene for apolipoprotein
             (a) related gene C and a plasminogen (PLG) pseudogene,
             complete sequence
          Length = 162083

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 334   aagctgagagctgattagga 353
             ||||||||||||||||||||
Sbjct: 42566 aagctgagagctgattagga 42585



to top

>emb|AL359714.18| Human DNA sequence from clone RP11-22A15 on chromosome 6 Contains part of
              the BAI3 gene for brain-specific angiogenesis inhibitor 3,
              complete sequence
          Length = 156129

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 241    gcttgcagatgaggacatag 260
              ||||||||||||||||||||
Sbjct: 141077 gcttgcagatgaggacatag 141096



to top

>gb|AC159978.4| Mus musculus chromosome 15, clone RP24-173F4, complete sequence
          Length = 113570

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 408   ccatcatcattaatgatgat 427
             ||||||||||||||||||||
Sbjct: 62291 ccatcatcattaatgatgat 62272



to top

>gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 map 17, complete sequence
          Length = 223005

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 317    tgtagctgcagtctgtgaagctga 340
              ||||||||||||||| ||||||||
Sbjct: 126398 tgtagctgcagtctgggaagctga 126421



to top

>gb|AC022679.9| Homo sapiens chromosome 8, clone RP11-386G21, complete sequence
          Length = 160766

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 168   tgccatgcacattcattctg 187
             ||||||||||||||||||||
Sbjct: 75074 tgccatgcacattcattctg 75055



to top

>gb|AC148317.3| Pan troglodytes BAC clone CH251-519K22 from chromosome 7, complete
             sequence
          Length = 154065

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   tgcacattcattctgatgca 192
             ||||||||||||||||||||
Sbjct: 65391 tgcacattcattctgatgca 65372



to top

>ref|NM_064268.1| Caenorhabditis elegans Serpentine Receptor, class H family member
           (srh-67) (srh-67) mRNA, complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 105 ggcaagaaggtttgcaggac 124
           ||||||||||||||||||||
Sbjct: 797 ggcaagaaggtttgcaggac 778



to top

>ref|NM_064267.1| Caenorhabditis elegans Serpentine Receptor, class H family member
           (srh-68) (srh-68) mRNA, complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 105 ggcaagaaggtttgcaggac 124
           ||||||||||||||||||||
Sbjct: 797 ggcaagaaggtttgcaggac 778



to top

>ref|XM_393538.2| PREDICTED: Apis mellifera similar to ENSANGP00000012260
           (LOC410052), partial mRNA
          Length = 6805

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 387 ttgttggatgctgagacata 406
           ||||||||||||||||||||
Sbjct: 800 ttgttggatgctgagacata 781



to top

>ref|XM_231251.3| PREDICTED: Rattus norvegicus G protein-coupled receptor 21
           (predicted) (Gpr21_predicted), mRNA
          Length = 3247

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 tgaagctgagagctgattag 351
           ||||||||||||||||||||
Sbjct: 346 tgaagctgagagctgattag 327



to top

>gb|AY107844.1| Zea mays PCO146552 mRNA sequence
          Length = 823

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 58  tgcaccttcgacaaggggctactgaccaaggctctc 93
           |||||| | ||| ||||||| |||||||||||||||
Sbjct: 421 tgcacccttgaccaggggctcctgaccaaggctctc 456



to top

>emb|Z81124.1|CET21B4 Caenorhabditis elegans Cosmid T21B4, complete sequence
          Length = 37797

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   ggcaagaaggtttgcaggac 124
             ||||||||||||||||||||
Sbjct: 19787 ggcaagaaggtttgcaggac 19768



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   ggcaagaaggtttgcaggac 124
             ||||||||||||||||||||
Sbjct: 18104 ggcaagaaggtttgcaggac 18085



to top

>emb|CT009715.15| Mouse DNA sequence from clone RP23-85E24 on chromosome 17, complete
            sequence
          Length = 178948

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 317  tgtagctgcagtctgtgaagctga 340
            ||||||||||||||| ||||||||
Sbjct: 6507 tgtagctgcagtctgggaagctga 6530



to top

>emb|Y13298.1|HSY13298 Homo sapiens GDP dissociation inhibitor beta pseudogene
          Length = 3628

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 173 tgcacattcattctgatgca 192
           ||||||||||||||||||||
Sbjct: 197 tgcacattcattctgatgca 178



to top

>dbj|AP000829.4| Homo sapiens genomic DNA, chromosome 18p clone:RP11-732L14, complete
              sequences
          Length = 186383

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    ggtattatctttggtcctga 231
              ||||||||||||||||||||
Sbjct: 174515 ggtattatctttggtcctga 174496


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,511,190
Number of Sequences: 3902068
Number of extensions: 3511190
Number of successful extensions: 61978
Number of sequences better than 10.0: 49
Number of HSP's better than 10.0 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61872
Number of HSP's gapped (non-prelim): 104
length of query: 474
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 452
effective length of database: 17,147,199,772
effective search space: 7750534296944
effective search space used: 7750534296944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top