ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal7g24
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY596553.1| Saccharum officinarum clone SCUTLR1058C02, comple... 383 e-103
2gb|AY105327.1| Zea mays PCO147247 mRNA sequence 303 3e-79
3dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 198 1e-47
4gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 198 1e-47
5emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa... 198 1e-47
6dbj|AK071188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 6e-44
7dbj|AK059556.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 8e-34
8ref|NM_118819.2| Arabidopsis thaliana VTC2 (VITAMIN C DEFECTIVE ... 111 3e-21
9gb|AY056134.1| Arabidopsis thaliana unknown protein (At4g26850) ... 111 3e-21
10gb|AY093138.1| Arabidopsis thaliana putative protein (At4g26850)... 111 3e-21
11gb|BT006589.1| Arabidopsis thaliana At4g26850 mRNA, complete cds 111 3e-21
12emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, ... 96 2e-16
13emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, ... 96 2e-16
14emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, B... 96 2e-16
15gb|AF508793.1| Arabidopsis thaliana VTC2 (VTC2) gene, complete cds 88 4e-14
16gb|AY570979.1| Xerophyta humilis clone HC437 unknown mRNA 64 6e-07
17emb|CT573504.2| Medicago truncatula chromosome 5 clone mth2-178o... 62 2e-06
18ref|NM_124894.4| Arabidopsis thaliana unknown protein AT5G55120 ... 58 3e-05
19gb|AY091285.1| Arabidopsis thaliana unknown protein (At5g55120) ... 58 3e-05
20gb|AY063788.1| Arabidopsis thaliana unknown protein (At5g55120) ... 58 3e-05
21emb|BX831350.1|CNS0A1O4 Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
22emb|BX829969.1|CNS0A043 Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
23emb|BX831865.1|CNS09ZT1 Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
24emb|BX831807.1|CNS09ZUD Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
25emb|BX830641.1|CNS09ZZY Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
26dbj|AK111215.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
27dbj|AB010071.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 5e-04
28gb|AY489190.1| Capsicum annuum putative At4g26850-like protein ... 48 0.033
29gb|BT013858.1| Lycopersicon esculentum clone 132824R, mRNA sequence 46 0.13
30emb|BX294151.1| Pirellula sp. strain 1 complete genome; segment ... 46 0.13
31gb|AE009937.1|AE009937 Pyrobaculum aerophilum strain IM2 section... 46 0.13
32ref|XM_676408.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 2.1
33gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosom... 42 2.1
34gb|AC151729.6| Mus musculus BAC clone RP24-74F2 from chromosome ... 42 2.1
35gb|AF153765.1|AF153765 Emericella nidulans S-adenosylmethionine ... 42 2.1
36emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 2.1
37gb|AC154126.2| Mus musculus BAC clone RP23-471O11 from chromosom... 42 2.1
38gb|AC140109.4| Mus musculus BAC clone RP24-156A17 from chromosom... 40 8.2
39ref|XM_845849.1| PREDICTED: Canis familiaris similar to BTB (POZ... 40 8.2
40gb|U41107.1| Caenorhabditis elegans cosmid F55C12, complete sequ... 40 8.2
41gb|AC149580.19| Medicago truncatula clone mth2-123f14, complete ... 40 8.2
42emb|AL355315.18| Human DNA sequence from clone RP11-548K23 on ch... 40 8.2
43gb|AC115090.8| Homo sapiens chromosome 17, clone CTC-861O14, com... 40 8.2
44gb|AC164299.2| Mus musculus BAC clone RP23-313K8 from chromosome... 40 8.2
45emb|AL935256.1| Lactobacillus plantarum strain WCFS1 complete ge... 40 8.2
46emb|CR352285.4| Zebrafish DNA sequence from clone CH211-210K13 i... 40 8.2
47emb|AL662836.7| Mouse DNA sequence from clone RP23-313L19 on chr... 40 8.2
48ref|XM_936572.1| PREDICTED: Homo sapiens suppressor of cytokine ... 40 8.2
49gb|AF085249.1|AF085249 Gallus gallus calcium/calmodulin-dependen... 40 8.2
50gb|AC124789.12| Homo sapiens chromosome 17, clone RP11-923C2, co... 40 8.2
51ref|NM_204294.1| Gallus gallus calcium/calmodulin-dependent prot... 40 8.2
52ref|XM_573834.1| PREDICTED: Rattus norvegicus similar to OTTHUMP... 40 8.2
53emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on ch... 40 8.2
54emb|CR354563.13| Zebrafish DNA sequence from clone DKEY-210I1 in... 40 8.2
55ref|NM_014598.1| Homo sapiens suppressor of cytokine signaling 7... 40 8.2
56gb|AC135118.3| Mus musculus BAC clone RP24-450N10 from 3, comple... 40 8.2
57gb|AC167974.3| Mus musculus BAC clone RP23-314B11 from chromosom... 40 8.2
58emb|AL772288.12| Mouse DNA sequence from clone RP23-360H6 on chr... 40 8.2 
>gb|AY596553.1| Saccharum officinarum clone SCUTLR1058C02, complete sequence
          Length = 1732

 Score =  383 bits (193), Expect = e-103
 Identities = 409/481 (85%)
 Strand = Plus / Plus

                                                                       
Query: 115 agtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacca 174
           |||||||||||||| | ||||||||| ||||| | || || || || ||||| |||||||
Sbjct: 374 agtgggaggacaggatggcccgaggcttattccgctacgatgtcactgcctgtgagacca 433

                                                                       
Query: 175 aggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaaga 234
           |||| || |||||| | ||||||||||||||||| || || ||||| |||||||| ||||
Sbjct: 434 aggtcatccctggcaaccttgggtttgttgcacaactcaatgaagggcgccaccttaaga 493

                                                                       
Query: 235 agcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttca 294
           ||||||| || ||||| ||||| |||||||||||||||||||| ||  ||||||||||||
Sbjct: 494 agcgccctactgagtttcgtgtggaccgtgtgctccagccatttgaccctgccaagttca 553

                                                                       
Query: 295 acttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtggcgaca 354
           | |||||||| ||||||||||| |||||||| || |  ||||||||||||| ||| ||  
Sbjct: 554 atttcaccaaagttggccaggaagaggttcttttccaatttgagaatggtgatggtgatg 613

                                                                       
Query: 355 gcagctatttccttgaaaatgccccaagcattgagggtgaccgtgctcccagcgttgttg 414
            ||||||||||||  |  | || |||| |||||  | ||| |||||||| |  |||||||
Sbjct: 614 acagctatttcctgaatgacgctccaatcattgctgttgatcgtgctccaaatgttgttg 673

                                                                       
Query: 415 caatcaatgtgagccctattgagtacggtcatgtgcttctcattccacgtgtccttgacc 474
           | |||||||||||||| ||||| || || ||||||||||||||||| ||||| || ||||
Sbjct: 674 ctatcaatgtgagcccaattgaatatggacatgtgcttctcattcctcgtgttctggacc 733

                                                                       
Query: 475 gcctgcctcagcaaattgatcctgaaagcttcctgcttgcactacacatggcagctgagg 534
           ||||||||||| | |||||||| || || ||| |||||||||| || |||||||||||||
Sbjct: 734 gcctgcctcagaagattgatccagagagtttcttgcttgcactgcaaatggcagctgagg 793

                                                                       
Query: 535 ctgcaagcccatactttaggcttggttacaacagcttgggtgcctttgccaccatcaatc 594
           | || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 794 cagctagcccatacttcaggcttggttacaatagcttgggtgcctttgccaccatcaatc 853

            
Query: 595 a 595
           |
Sbjct: 854 a 854



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                    
Query: 2   gctgcttgcctgcttcca-gcttcccctctatgctttcaag 41
           ||||| |||||||||||| |||||||||||| || ||||||
Sbjct: 263 gctgcctgcctgcttccaagcttcccctctacgcgttcaag 303
to top
>gb|AY105327.1| Zea mays PCO147247 mRNA sequence
          Length = 1954

 Score =  303 bits (153), Expect = 3e-79
 Identities = 399/481 (82%)
 Strand = Plus / Plus

                                                                        
Query: 115  agtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacca 174
            |||||||||||||| |  | |||||| ||||| | || || || || ||||| |||||||
Sbjct: 632  agtgggaggacaggatgactcgaggcttattccgctacgatgtcactgcctgtgagacca 691

                                                                        
Query: 175  aggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaaga 234
            |||| ||||||||| | ||||||||||||||||| || || ||||| ||||| || ||||
Sbjct: 692  aggtcattcctggcaaccttgggtttgttgcacaactcaatgaagggcgccatcttaaga 751

                                                                        
Query: 235  agcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttca 294
            ||||||| || ||||| ||||| ||||||||||||||||| || ||  ||||||| ||||
Sbjct: 752  agcgccctactgagtttcgtgtggaccgtgtgctccagccgtttgaccctgccaaattca 811

                                                                        
Query: 295  acttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtggcgaca 354
            | ||||| || ||||||||||| ||||||||||| |  ||||||||| ||||||| ||  
Sbjct: 812  atttcacaaaagttggccaggaagaggttctcttccaatttgagaatagtggtggtgatg 871

                                                                        
Query: 355  gcagctatttccttgaaaatgccccaagcattgagggtgaccgtgctcccagcgttgttg 414
             ||||||||||||  | || || |||| |||||  | ||| || ||||| |  ||| |||
Sbjct: 872  acagctatttcctgaacaacgctccaatcattgctgttgatcgggctccaaatgttattg 931

                                                                        
Query: 415  caatcaatgtgagccctattgagtacggtcatgtgcttctcattccacgtgtccttgacc 474
            | |||||||| ||||| ||||| || || ||||||||||||||||| ||||| || ||||
Sbjct: 932  ctatcaatgtaagcccaattgaatatggacatgtgcttctcattcctcgtgttctggacc 991

                                                                        
Query: 475  gcctgcctcagcaaattgatcctgaaagcttcctgcttgcactacacatggcagctgagg 534
            |||||||||||   |||||||| || |||||| |||||||||| || |||||||| ||||
Sbjct: 992  gcctgcctcagaggattgatccagagagcttcttgcttgcactgcaaatggcagccgagg 1051

                                                                        
Query: 535  ctgcaagcccatactttaggcttggttacaacagcttgggtgcctttgccaccatcaatc 594
              |  ||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 1052 gaggtagcccatacttcaggcttggttacaatagcttgggtgcgtttgccaccatcaatc 1111

             
Query: 595  a 595
            |
Sbjct: 1112 a 1112



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                    
Query: 2   gctgcttgcctgcttcca-gcttcccctctatgctttcaag 41
           ||||| |||||||||||| |||||||||||| || ||||||
Sbjct: 521 gctgcctgcctgcttccaagcttcccctctacgcgttcaag 561
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  198 bits (100), Expect = 1e-47
 Identities = 202/236 (85%)
 Strand = Plus / Minus

                                                                           
Query: 114     cagtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacc 173
               |||||||| |||||| | ||||||||  | ||| ||||||| || || ||||| ||||||
Sbjct: 4534249 cagtgggaagacaggatggcccgaggtttgttccgatatgatgtcactgcctgtgagacc 4534190

                                                                           
Query: 174     aaggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaag 233
               ||||| || || ||| | ||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 4534189 aaggttatcccaggcaaccttgggtttgttgcacaactgaatgaaggacgccacctcaag 4534130

                                                                           
Query: 234     aagcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttc 293
               |||||||| || || ||||| || ||||||||||| || ||||| ||| |||||||||||
Sbjct: 4534129 aagcgccctactgaattccgcgtggaccgtgtgcttcaaccatttgatgctgccaagttc 4534070

                                                                       
Query: 294     aacttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtgg 349
               ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 4534069 aacttcaccaaagttggccaggaggaggtgctcttccaatttgagaatggtggtgg 4534014



 Score =  125 bits (63), Expect = 2e-25
 Identities = 141/167 (84%)
 Strand = Plus / Minus

                                                                           
Query: 426     agccctattgagtacggtcatgtgcttctcattccacgtgtccttgaccgcctgcctcag 485
               ||||| ||||| || || ||||| ||||||||||| ||||| || |||||||||||||||
Sbjct: 4533852 agcccaattgaatatggccatgttcttctcattccccgtgtactggaccgcctgcctcag 4533793

                                                                           
Query: 486     caaattgatcctgaaagcttcctgcttgcactacacatggcagctgaggctgcaagccca 545
                  ||||| |  || |||||| |||||||||| |||||||| ||||| || |||||||||
Sbjct: 4533792 aggattgaccaggagagcttcttgcttgcactgcacatggctgctgaagccgcaagccca 4533733

                                                              
Query: 546     tactttaggcttggttacaacagcttgggtgcctttgccaccatcaa 592
               ||||| |||||||| || || || |||||||||||||| ||||||||
Sbjct: 4533732 tacttcaggcttggctataatagtttgggtgcctttgcaaccatcaa 4533686
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  198 bits (100), Expect = 1e-47
 Identities = 202/236 (85%)
 Strand = Plus / Minus

                                                                           
Query: 114     cagtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacc 173
               |||||||| |||||| | ||||||||  | ||| ||||||| || || ||||| ||||||
Sbjct: 4534230 cagtgggaagacaggatggcccgaggtttgttccgatatgatgtcactgcctgtgagacc 4534171

                                                                           
Query: 174     aaggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaag 233
               ||||| || || ||| | ||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 4534170 aaggttatcccaggcaaccttgggtttgttgcacaactgaatgaaggacgccacctcaag 4534111

                                                                           
Query: 234     aagcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttc 293
               |||||||| || || ||||| || ||||||||||| || ||||| ||| |||||||||||
Sbjct: 4534110 aagcgccctactgaattccgcgtggaccgtgtgcttcaaccatttgatgctgccaagttc 4534051

                                                                       
Query: 294     aacttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtgg 349
               ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 4534050 aacttcaccaaagttggccaggaggaggtgctcttccaatttgagaatggtggtgg 4533995



 Score =  125 bits (63), Expect = 2e-25
 Identities = 141/167 (84%)
 Strand = Plus / Minus

                                                                           
Query: 426     agccctattgagtacggtcatgtgcttctcattccacgtgtccttgaccgcctgcctcag 485
               ||||| ||||| || || ||||| ||||||||||| ||||| || |||||||||||||||
Sbjct: 4533833 agcccaattgaatatggccatgttcttctcattccccgtgtactggaccgcctgcctcag 4533774

                                                                           
Query: 486     caaattgatcctgaaagcttcctgcttgcactacacatggcagctgaggctgcaagccca 545
                  ||||| |  || |||||| |||||||||| |||||||| ||||| || |||||||||
Sbjct: 4533773 aggattgaccaggagagcttcttgcttgcactgcacatggctgctgaagccgcaagccca 4533714

                                                              
Query: 546     tactttaggcttggttacaacagcttgggtgcctttgccaccatcaa 592
               ||||| |||||||| || || || |||||||||||||| ||||||||
Sbjct: 4533713 tacttcaggcttggctataatagtttgggtgcctttgcaaccatcaa 4533667
to top
>emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa0002O20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 129155

 Score =  198 bits (100), Expect = 1e-47
 Identities = 202/236 (85%)
 Strand = Plus / Plus

                                                                         
Query: 114   cagtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacc 173
             |||||||| |||||| | ||||||||  | ||| ||||||| || || ||||| ||||||
Sbjct: 70529 cagtgggaagacaggatggcccgaggtttgttccgatatgatgtcactgcctgtgagacc 70588

                                                                         
Query: 174   aaggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaag 233
             ||||| || || ||| | ||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 70589 aaggttatcccaggcaaccttgggtttgttgcacaactgaatgaaggacgccacctcaag 70648

                                                                         
Query: 234   aagcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttc 293
             |||||||| || || ||||| || ||||||||||| || ||||| ||| |||||||||||
Sbjct: 70649 aagcgccctactgaattccgcgtggaccgtgtgcttcaaccatttgatgctgccaagttc 70708

                                                                     
Query: 294   aacttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtgg 349
             ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 70709 aacttcaccaaagttggccaggaggaggtgctcttccaatttgagaatggtggtgg 70764



 Score =  125 bits (63), Expect = 2e-25
 Identities = 141/167 (84%)
 Strand = Plus / Plus

                                                                         
Query: 426   agccctattgagtacggtcatgtgcttctcattccacgtgtccttgaccgcctgcctcag 485
             ||||| ||||| || || ||||| ||||||||||| ||||| || |||||||||||||||
Sbjct: 70926 agcccaattgaatatggccatgttcttctcattccccgtgtactggaccgcctgcctcag 70985

                                                                         
Query: 486   caaattgatcctgaaagcttcctgcttgcactacacatggcagctgaggctgcaagccca 545
                ||||| |  || |||||| |||||||||| |||||||| ||||| || |||||||||
Sbjct: 70986 aggattgaccaggagagcttcttgcttgcactgcacatggctgctgaagccgcaagccca 71045

                                                            
Query: 546   tactttaggcttggttacaacagcttgggtgcctttgccaccatcaa 592
             ||||| |||||||| || || || |||||||||||||| ||||||||
Sbjct: 71046 tacttcaggcttggctataatagtttgggtgcctttgcaaccatcaa 71092
to top
>dbj|AK071188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086M14, full
           insert sequence
          Length = 2088

 Score =  186 bits (94), Expect = 6e-44
 Identities = 175/202 (86%)
 Strand = Plus / Plus

                                                                       
Query: 148 gatatgacgtaacagcctgcgagaccaaggtgattcctggcgagcttgggtttgttgcac 207
           ||||||| || || ||||| ||||||||||| || || ||| | ||||||||||||||||
Sbjct: 704 gatatgatgtcactgcctgtgagaccaaggttatcccaggcaaccttgggtttgttgcac 763

                                                                       
Query: 208 agcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgaccgtgtgc 267
           | || || ||||| |||||||||||||||||||| || || ||||| || ||||||||||
Sbjct: 764 aactgaatgaaggacgccacctcaagaagcgccctactgaattccgcgtggaccgtgtgc 823

                                                                       
Query: 268 tccagccattcgattctgccaagttcaacttcaccaaggttggccaggaggaggttctct 327
           | || ||||| ||| |||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 824 ttcaaccatttgatgctgccaagttcaacttcaccaaagttggccaggaggaggtgctct 883

                                 
Query: 328 ttcgctttgagaatggtggtgg 349
           | |  |||||||||||||||||
Sbjct: 884 tccaatttgagaatggtggtgg 905



 Score =  153 bits (77), Expect = 8e-34
 Identities = 158/185 (85%)
 Strand = Plus / Plus

                                                                        
Query: 408  gttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattccacgtgtc 467
            ||||||||||||||||| ||||| ||||| || || ||||| ||||||||||| ||||| 
Sbjct: 964  gttgttgcaatcaatgtaagcccaattgaatatggccatgttcttctcattccccgtgta 1023

                                                                        
Query: 468  cttgaccgcctgcctcagcaaattgatcctgaaagcttcctgcttgcactacacatggca 527
            || |||||||||||||||   ||||| |  || |||||| |||||||||| |||||||| 
Sbjct: 1024 ctggaccgcctgcctcagaggattgaccaggagagcttcttgcttgcactgcacatggct 1083

                                                                        
Query: 528  gctgaggctgcaagcccatactttaggcttggttacaacagcttgggtgcctttgccacc 587
            ||||| || |||||||||||||| |||||||| || || || |||||||||||||| |||
Sbjct: 1084 gctgaagccgcaagcccatacttcaggcttggctataatagtttgggtgcctttgcaacc 1143

                 
Query: 588  atcaa 592
            |||||
Sbjct: 1144 atcaa 1148
to top
>dbj|AK059556.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-G08, full
           insert sequence
          Length = 1295

 Score =  153 bits (77), Expect = 8e-34
 Identities = 158/185 (85%)
 Strand = Plus / Plus

                                                                       
Query: 408 gttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattccacgtgtc 467
           ||||||||||||||||| ||||| ||||| || || ||||| ||||||||||| ||||| 
Sbjct: 206 gttgttgcaatcaatgtaagcccaattgaatatggccatgttcttctcattccccgtgta 265

                                                                       
Query: 468 cttgaccgcctgcctcagcaaattgatcctgaaagcttcctgcttgcactacacatggca 527
           || |||||||||||||||   ||||| |  || |||||| |||||||||| |||||||| 
Sbjct: 266 ctggaccgcctgcctcagaggattgaccaggagagcttcttgcttgcactgcacatggct 325

                                                                       
Query: 528 gctgaggctgcaagcccatactttaggcttggttacaacagcttgggtgcctttgccacc 587
           ||||| || |||||||||||||| |||||||| || || || |||||||||||||| |||
Sbjct: 326 gctgaagccgcaagcccatacttcaggcttggctataatagtttgggtgcctttgcaacc 385

                
Query: 588 atcaa 592
           |||||
Sbjct: 386 atcaa 390



 Score =  147 bits (74), Expect = 5e-32
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                       
Query: 216 gaaggccgccacctcaagaagcgcccaaccgagttccgtgttgaccgtgtgctccagcca 275
           ||||| |||||||||||||||||||| || || ||||| || ||||||||||| || |||
Sbjct: 14  gaaggacgccacctcaagaagcgccctactgaattccgcgtggaccgtgtgcttcaacca 73

                                                                       
Query: 276 ttcgattctgccaagttcaacttcaccaaggttggccaggaggaggttctctttcgcttt 335
           || ||| |||||||||||||||||||||| ||||||||||||||||| ||||| |  |||
Sbjct: 74  tttgatgctgccaagttcaacttcaccaaagttggccaggaggaggtgctcttccaattt 133

                         
Query: 336 gagaatggtggtgg 349
           ||||||||||||||
Sbjct: 134 gagaatggtggtgg 147
to top
>ref|NM_118819.2| Arabidopsis thaliana VTC2 (VITAMIN C DEFECTIVE 2) AT4G26850 (VTC2)
            mRNA, complete cds
          Length = 2084

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                        
Query: 400  ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
            ||||||| |||||||| |||||||| || || || ||||| || |||||||| || ||||
Sbjct: 1015 ctcccagtgttgttgccatcaatgttagtccgatagagtatggccatgtgctgctgattc 1074

                                                                        
Query: 460  cacgtgtccttgaccgcctgcctcagcaaattgatcctgaaagcttcctgcttgcactac 519
            | ||||| |||||| || |||||||    || ||||   ||||| |  |||||||| | |
Sbjct: 1075 ctcgtgttcttgactgcttgcctcaaaggatcgatcacaaaagccttttgcttgcagttc 1134

                                                                        
Query: 520  acatggcagctgaggctgcaagcccatactttaggcttggttacaacagcttgggtgcct 579
            ||||||| ||||||||||| |  |||||||| || || |||||||||||||||||||| |
Sbjct: 1135 acatggctgctgaggctgctaatccatacttcagactcggttacaacagcttgggtgctt 1194

                                
Query: 580  ttgccaccatcaatcatctc 599
            ||||||| ||||||||||||
Sbjct: 1195 ttgccactatcaatcatctc 1214



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 201 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 819 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 874
to top
>gb|AY056134.1| Arabidopsis thaliana unknown protein (At4g26850) mRNA, complete cds
          Length = 2097

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                        
Query: 400  ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
            ||||||| |||||||| |||||||| || || || ||||| || |||||||| || ||||
Sbjct: 1013 ctcccagtgttgttgccatcaatgttagtccgatagagtatggccatgtgctgctgattc 1072

                                                                        
Query: 460  cacgtgtccttgaccgcctgcctcagcaaattgatcctgaaagcttcctgcttgcactac 519
            | ||||| |||||| || |||||||    || ||||   ||||| |  |||||||| | |
Sbjct: 1073 ctcgtgttcttgactgcttgcctcaaaggatcgatcacaaaagccttttgcttgcagttc 1132

                                                                        
Query: 520  acatggcagctgaggctgcaagcccatactttaggcttggttacaacagcttgggtgcct 579
            ||||||| ||||||||||| |  |||||||| || || |||||||||||||||||||| |
Sbjct: 1133 acatggctgctgaggctgctaatccatacttcagactcggttacaacagcttgggtgctt 1192

                                
Query: 580  ttgccaccatcaatcatctc 599
            ||||||| ||||||||||||
Sbjct: 1193 ttgccactatcaatcatctc 1212



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 201 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 817 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 872
to top
>gb|AY093138.1| Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds
          Length = 2045

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                        
Query: 400  ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
            ||||||| |||||||| |||||||| || || || ||||| || |||||||| || ||||
Sbjct: 1013 ctcccagtgttgttgccatcaatgttagtccgatagagtatggccatgtgctgctgattc 1072

                                                                        
Query: 460  cacgtgtccttgaccgcctgcctcagcaaattgatcctgaaagcttcctgcttgcactac 519
            | ||||| |||||| || |||||||    || ||||   ||||| |  |||||||| | |
Sbjct: 1073 ctcgtgttcttgactgcttgcctcaaaggatcgatcacaaaagccttttgcttgcagttc 1132

                                                                        
Query: 520  acatggcagctgaggctgcaagcccatactttaggcttggttacaacagcttgggtgcct 579
            ||||||| ||||||||||| |  |||||||| || || |||||||||||||||||||| |
Sbjct: 1133 acatggctgctgaggctgctaatccatacttcagactcggttacaacagcttgggtgctt 1192

                                
Query: 580  ttgccaccatcaatcatctc 599
            ||||||| ||||||||||||
Sbjct: 1193 ttgccactatcaatcatctc 1212



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 201 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 817 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 872
to top
>gb|BT006589.1| Arabidopsis thaliana At4g26850 mRNA, complete cds
          Length = 1329

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           ||||||| |||||||| |||||||| || || || ||||| || |||||||| || ||||
Sbjct: 512 ctcccagtgttgttgccatcaatgttagtccgatagagtatggccatgtgctgctgattc 571

                                                                       
Query: 460 cacgtgtccttgaccgcctgcctcagcaaattgatcctgaaagcttcctgcttgcactac 519
           | ||||| |||||| || |||||||    || ||||   ||||| |  |||||||| | |
Sbjct: 572 ctcgtgttcttgactgcttgcctcaaaggatcgatcacaaaagccttttgcttgcagttc 631

                                                                       
Query: 520 acatggcagctgaggctgcaagcccatactttaggcttggttacaacagcttgggtgcct 579
           ||||||| ||||||||||| |  |||||||| || || |||||||||||||||||||| |
Sbjct: 632 acatggctgctgaggctgctaatccatacttcagactcggttacaacagcttgggtgctt 691

                               
Query: 580 ttgccaccatcaatcatctc 599
           ||||||| ||||||||||||
Sbjct: 692 ttgccactatcaatcatctc 711



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 201 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 316 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 371
to top
>emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 66
          Length = 198372

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                        
Query: 508  tgcttgcactacacatggcagctgaggctgcaagcccatactttaggcttggttacaaca 567
            |||||||| | |||||||| ||||||||||| |  |||||||| || || ||||||||||
Sbjct: 4004 tgcttgcagttcacatggctgctgaggctgctaatccatacttcagactcggttacaaca 3945

                                            
Query: 568  gcttgggtgcctttgccaccatcaatcatctc 599
            |||||||||| |||||||| ||||||||||||
Sbjct: 3944 gcttgggtgcttttgccactatcaatcatctc 3913



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 201  gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
            ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 4402 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 4347
to top
>emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 65
          Length = 198320

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                          
Query: 508    tgcttgcactacacatggcagctgaggctgcaagcccatactttaggcttggttacaaca 567
              |||||||| | |||||||| ||||||||||| |  |||||||| || || ||||||||||
Sbjct: 197324 tgcttgcagttcacatggctgctgaggctgctaatccatacttcagactcggttacaaca 197265

                                              
Query: 568    gcttgggtgcctttgccaccatcaatcatctc 599
              |||||||||| |||||||| ||||||||||||
Sbjct: 197264 gcttgggtgcttttgccactatcaatcatctc 197233



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                      
Query: 201    gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
              ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 197722 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 197667
to top
>emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, BAC clone F10M23 (ESSA project)
          Length = 128574

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                         
Query: 508   tgcttgcactacacatggcagctgaggctgcaagcccatactttaggcttggttacaaca 567
             |||||||| | |||||||| ||||||||||| |  |||||||| || || ||||||||||
Sbjct: 48161 tgcttgcagttcacatggctgctgaggctgctaatccatacttcagactcggttacaaca 48102

                                             
Query: 568   gcttgggtgcctttgccaccatcaatcatctc 599
             |||||||||| |||||||| ||||||||||||
Sbjct: 48101 gcttgggtgcttttgccactatcaatcatctc 48070



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 201   gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
             ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 48559 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 48504
to top
>gb|AF508793.1| Arabidopsis thaliana VTC2 (VTC2) gene, complete cds
          Length = 1884

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                        
Query: 508  tgcttgcactacacatggcagctgaggctgcaagcccatactttaggcttggttacaaca 567
            |||||||| | |||||||| ||||||||||| |  |||||||| || || | ||||||||
Sbjct: 997  tgcttgcagttcacatggctgctgaggctgctaatccatacttcagactcgattacaaca 1056

                                            
Query: 568  gcttgggtgcctttgccaccatcaatcatctc 599
            |||||||||| |||||||| ||||||||||||
Sbjct: 1057 gcttgggtgcttttgccactatcaatcatctc 1088



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 201 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 256
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 599 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 654
to top
>gb|AY570979.1| Xerophyta humilis clone HC437 unknown mRNA
          Length = 1266

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 287 caagttcaacttcaccaaggttggccaggaggaggttctctttcgctt 334
           ||||||||| ||||||||||| || ||||||||||||||||| |||||
Sbjct: 121 caagttcaatttcaccaaggtcgggcaggaggaggttctcttccgctt 168



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 540 agcccatactttaggcttggttacaacagcttgggtgcctttgccaccatcaatcatct 598
           ||||||||||| ||||| |||||||||||  | ||||| ||||||||||| ||||||||
Sbjct: 371 agcccatacttcaggctaggttacaacagtcttggtgcttttgccaccattaatcatct 429



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 408 gttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattccacgtgt 466
           |||||||||||||| |||||||| || ||||| || ||||| || || ||||| |||||
Sbjct: 239 gttgttgcaatcaacgtgagcccaatcgagtatggccatgtcctgcttattccccgtgt 297
to top
>emb|CT573504.2| Medicago truncatula chromosome 5 clone mth2-178o19, COMPLETE SEQUENCE
          Length = 132030

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                          
Query: 489    attgatcctgaaagcttcctgcttgcactacacatggcagctgaggctgcaagcccatac 548
              ||||||| ||| |||||| |||||||||| |||||||||||||| ||||| |  ||||| 
Sbjct: 102197 attgatcatgagagcttcttgcttgcacttcacatggcagctgaagctgctaatccatat 102256

                                                 
Query: 549    tttaggcttggttacaacagcttgggtgcctttgc 583
              ||| |  | |||||||||||| | ||||| |||||
Sbjct: 102257 tttcgattgggttacaacagccttggtgcatttgc 102291



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 202    ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttc 251
              |||| ||||||||||| ||||| |||||||||||| | ||||| ||||||
Sbjct: 101810 ttgctcagcttaacgagggccgacacctcaagaagagaccaactgagttc 101859
to top
>ref|NM_124894.4| Arabidopsis thaliana unknown protein AT5G55120 mRNA, complete cds
          Length = 1874

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 923 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 982

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 983 ctcgtgttcttga 995



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 202 ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 260
           |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 719 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 777
to top
>gb|AY091285.1| Arabidopsis thaliana unknown protein (At5g55120) mRNA, complete cds
          Length = 1327

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 503 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 562

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 563 ctcgtgttcttga 575



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 202 ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 260
           |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 299 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 357
to top
>gb|AY063788.1| Arabidopsis thaliana unknown protein (At5g55120) mRNA, complete cds
          Length = 1788

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 819 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 878

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 879 ctcgtgttcttga 891



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 202 ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 260
           |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 615 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 673
to top
>emb|BX831350.1|CNS0A1O4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS80ZC01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1806

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 857 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 916

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 917 ctcgtgttcttga 929



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 228 ctcaagaagcgcccaaccgagttccgtgttgac 260
           ||||||||| | |||||||||||||||||||||
Sbjct: 680 ctcaagaagagaccaaccgagttccgtgttgac 712
to top
>emb|BX829969.1|CNS0A043 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB4ZG03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1694

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 808 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 867

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 868 ctcgtgttcttga 880



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 228 ctcaagaagcgcccaaccgagttccgtgttgac 260
           ||||||||| | |||||||||||||||||||||
Sbjct: 630 ctcaagaagagaccaaccgagttccgtgttgac 662
to top
>emb|BX831865.1|CNS09ZT1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1838

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 923 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 982

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 983 ctcgtgttcttga 995



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 228 ctcaagaagcgcccaaccgagttccgtgttgac 260
           ||||||||| | |||||||||||||||||||||
Sbjct: 745 ctcaagaagagaccaaccgagttccgtgttgac 777
to top
>emb|BX831807.1|CNS09ZUD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1692

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 783 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 842

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 843 ctcgtgttcttga 855



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 228 ctcaagaagcgcccaaccgagttccgtgttgac 260
           ||||||||| | |||||||||||||||||||||
Sbjct: 605 ctcaagaagagaccaaccgagttccgtgttgac 637
to top
>emb|BX830641.1|CNS09ZZY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB9ZD04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1684

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 400 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 459
           |||| ||||| ||||||||||||||||| || |||||||| || |||||| | || ||||
Sbjct: 771 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtgttgctgattc 830

                        
Query: 460 cacgtgtccttga 472
           | ||||| |||||
Sbjct: 831 ctcgtgttcttga 843



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 230 caagaagcgcccaaccgagttccgtgttgac 260
           ||||||| | |||||||||||||||||||||
Sbjct: 595 caagaagagaccaaccgagttccgtgttgac 625
to top
>dbj|AK111215.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-B04, full
           insert sequence
          Length = 2890

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 tttgttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgtt 257
           ||||| |||||||| ||||| |||||| ||  |||||||||||| || ||||||||||| 
Sbjct: 180 tttgtggcacagctgaacgagggccgctacagcaagaagcgccccacagagttccgtgtg 239

                                                            
Query: 258 gaccgtgtgctccagccattcgattctgccaagttcaacttcaccaagg 306
           ||||  ||| | ||| | |||||  |   ||||||||||||||||||||
Sbjct: 240 gaccaggtggtgcaggccttcgaccccaacaagttcaacttcaccaagg 288
to top
>dbj|AB010071.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15
          Length = 82918

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 202   ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 260
             |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 29107 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 29165
to top
>gb|AY489190.1| Capsicum annuum putative At4g26850-like protein  mRNA, complete
           sequence
          Length = 589

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 287 caagttcaacttcaccaaggttggccaggaggaggttctctttc 330
           ||||||||||||||| |||||||| ||||| ||| | |||||||
Sbjct: 524 caagttcaacttcactaaggttggacaggaagagttgctctttc 567



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 162 gcctgcgagaccaaggtgattcctgg 187
           |||||||| |||||||||||||||||
Sbjct: 399 gcctgcgaaaccaaggtgattcctgg 424
to top
>gb|BT013858.1| Lycopersicon esculentum clone 132824R, mRNA sequence
          Length = 2013

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 409 ttgttgcaatcaatgtgagccctattgagta 439
           ||||||| |||||||||||||| ||||||||
Sbjct: 947 ttgttgctatcaatgtgagcccaattgagta 977



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 222 cgccacctcaagaagcgcccaaccgagtt 250
           |||||||| |||||||||||||| |||||
Sbjct: 763 cgccacctaaagaagcgcccaacagagtt 791
to top
>emb|BX294151.1| Pirellula sp. strain 1 complete genome; segment 19/24
          Length = 295650

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 568   gcttgggtgcctttgccaccatc 590
             |||||||||||||||||||||||
Sbjct: 43619 gcttgggtgcctttgccaccatc 43641
to top
>gb|AE009937.1|AE009937 Pyrobaculum aerophilum strain IM2 section 192 of 201 of the complete
            genome
          Length = 11207

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 539  aagcccatactttaggcttggtt 561
            |||||||||||||||||||||||
Sbjct: 2161 aagcccatactttaggcttggtt 2183
to top
>ref|XM_676408.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8231.2), mRNA
          Length = 915

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 571 tgggtgcctttgccaccatca 591
           |||||||||||||||||||||
Sbjct: 536 tgggtgcctttgccaccatca 516
to top
>gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosome 7, complete sequence
          Length = 198646

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 308    tggccaggaggaggttctctt 328
              |||||||||||||||||||||
Sbjct: 158745 tggccaggaggaggttctctt 158765
to top
>gb|AC151729.6| Mus musculus BAC clone RP24-74F2 from chromosome 9, complete sequence
          Length = 224139

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 573    ggtgcctttgccaccatcaatcatc 597
              |||||||| ||||||||||||||||
Sbjct: 119319 ggtgccttagccaccatcaatcatc 119343
to top
>gb|AF153765.1|AF153765 Emericella nidulans S-adenosylmethionine decarboxylase mRNA,
           partial cds
          Length = 1086

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 571 tgggtgcctttgccaccatca 591
           |||||||||||||||||||||
Sbjct: 542 tgggtgcctttgccaccatca 522
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 390     ggtgaccgtgctcccagcgtt 410
               |||||||||||||||||||||
Sbjct: 2549882 ggtgaccgtgctcccagcgtt 2549862
to top
>gb|AC154126.2| Mus musculus BAC clone RP23-471O11 from chromosome 7, complete sequence
          Length = 198860

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 308    tggccaggaggaggttctctt 328
              |||||||||||||||||||||
Sbjct: 186600 tggccaggaggaggttctctt 186580
to top
>gb|AC140109.4| Mus musculus BAC clone RP24-156A17 from chromosome 3, complete sequence
          Length = 130716

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 550    ttaggcttggttacaacagc 569
              ||||||||||||||||||||
Sbjct: 110398 ttaggcttggttacaacagc 110379
to top
>ref|XM_845849.1| PREDICTED: Canis familiaris similar to BTB (POZ) domain containing 11
            isoform 3, transcript variant 2 (LOC481292), mRNA
          Length = 3430

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgttgaccgtgtgctccagc 273
            ||||||||||||||||||||
Sbjct: 1075 tgttgaccgtgtgctccagc 1056
to top
>gb|U41107.1| Caenorhabditis elegans cosmid F55C12, complete sequence
          Length = 39086

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 444   catgtgcttctcattccacg 463
             ||||||||||||||||||||
Sbjct: 20793 catgtgcttctcattccacg 20812
to top
>gb|AC149580.19| Medicago truncatula clone mth2-123f14, complete sequence
          Length = 123565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 81    actgagttcttcctcaattctctc 104
             |||||||| |||||||||||||||
Sbjct: 79670 actgagtttttcctcaattctctc 79693
to top
>emb|AL355315.18| Human DNA sequence from clone RP11-548K23 on chromosome 10 Contains the
              ANKRD2 gene for ankyrin repeat domain 2 (stretch responsive
              muscle), six novel genes, the gene for phosphatidylinositol
              4-kinase type II (PI4KII) and four CpG islands, complete
              sequence
          Length = 157193

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 299    caccaaggttggccaggagg 318
              ||||||||||||||||||||
Sbjct: 132404 caccaaggttggccaggagg 132423
to top
>gb|AC115090.8| Homo sapiens chromosome 17, clone CTC-861O14, complete sequence
          Length = 173716

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 435    gagtacggtcatgtgcttct 454
              ||||||||||||||||||||
Sbjct: 155346 gagtacggtcatgtgcttct 155365
to top
>gb|AC164299.2| Mus musculus BAC clone RP23-313K8 from chromosome 1, complete sequence
          Length = 160562

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 578   ctttgccaccatcaatcatc 597
             ||||||||||||||||||||
Sbjct: 32059 ctttgccaccatcaatcatc 32078
to top
>emb|AL935256.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 5/11
          Length = 302050

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 482    tcagcaaattgatcctgaaa 501
              ||||||||||||||||||||
Sbjct: 197316 tcagcaaattgatcctgaaa 197297
to top
>emb|CR352285.4| Zebrafish DNA sequence from clone CH211-210K13 in linkage group 11,
             complete sequence
          Length = 133334

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   agcagctatttccttgaaaa 373
             ||||||||||||||||||||
Sbjct: 42382 agcagctatttccttgaaaa 42401
to top
>emb|AL662836.7| Mouse DNA sequence from clone RP23-313L19 on chromosome 11, complete
             sequence
          Length = 120749

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   ccaggaggaggttctctttc 330
             ||||||||||||||||||||
Sbjct: 60215 ccaggaggaggttctctttc 60196
to top
>ref|XM_936572.1| PREDICTED: Homo sapiens suppressor of cytokine signaling 7 (SOCS7),
            mRNA
          Length = 1725

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 435  gagtacggtcatgtgcttct 454
            ||||||||||||||||||||
Sbjct: 1589 gagtacggtcatgtgcttct 1570
to top
>gb|AF085249.1|AF085249 Gallus gallus calcium/calmodulin-dependent kinase type II beta
           subunit mRNA, complete cds
          Length = 1703

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 308 tggccaggaggaggttctct 327
           ||||||||||||||||||||
Sbjct: 470 tggccaggaggaggttctct 451
to top
>gb|AC124789.12| Homo sapiens chromosome 17, clone RP11-923C2, complete sequence
          Length = 105701

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 435  gagtacggtcatgtgcttct 454
            ||||||||||||||||||||
Sbjct: 9527 gagtacggtcatgtgcttct 9546
to top
>ref|NM_204294.1| Gallus gallus calcium/calmodulin-dependent protein kinase (CaM
           kinase) II beta (CAMK2B), mRNA
          Length = 1703

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 308 tggccaggaggaggttctct 327
           ||||||||||||||||||||
Sbjct: 470 tggccaggaggaggttctct 451
to top
>ref|XM_573834.1| PREDICTED: Rattus norvegicus similar to OTTHUMP00000018508
           (LOC498559), mRNA
          Length = 1111

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 acagcagctatttccttgaa 371
           ||||||||||||||||||||
Sbjct: 362 acagcagctatttccttgaa 343
to top
>emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on chromosome 2, complete
              sequence
          Length = 195733

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     tcccctctatgctttcaagg 42
              ||||||||||||||||||||
Sbjct: 114212 tcccctctatgctttcaagg 114193
to top
>emb|CR354563.13| Zebrafish DNA sequence from clone DKEY-210I1 in linkage group 7,
             complete sequence
          Length = 147943

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    gagctccctactgagttctt 91
             ||||||||||||||||||||
Sbjct: 60496 gagctccctactgagttctt 60515
to top
>ref|NM_014598.1| Homo sapiens suppressor of cytokine signaling 7 (SOCS7), mRNA
          Length = 2162

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 435  gagtacggtcatgtgcttct 454
            ||||||||||||||||||||
Sbjct: 2054 gagtacggtcatgtgcttct 2035
to top
>gb|AC135118.3| Mus musculus BAC clone RP24-450N10 from 3, complete sequence
          Length = 188353

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 550   ttaggcttggttacaacagc 569
             ||||||||||||||||||||
Sbjct: 18589 ttaggcttggttacaacagc 18570
to top
>gb|AC167974.3| Mus musculus BAC clone RP23-314B11 from chromosome 1, complete sequence
          Length = 210757

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 578   ctttgccaccatcaatcatc 597
             ||||||||||||||||||||
Sbjct: 11846 ctttgccaccatcaatcatc 11865
to top
>emb|AL772288.12| Mouse DNA sequence from clone RP23-360H6 on chromosome 4, complete
             sequence
          Length = 132015

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   ccaggaggaggttctctttc 330
             ||||||||||||||||||||
Sbjct: 39010 ccaggaggaggttctctttc 38991


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,713,144
Number of Sequences: 3902068
Number of extensions: 5713144
Number of successful extensions: 106569
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106331
Number of HSP's gapped (non-prelim): 230
length of query: 599
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 576
effective length of database: 17,143,297,704
effective search space: 9874539477504
effective search space used: 9874539477504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top