ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal6i06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK068163.1| Oryza sativa (japonica cultivar-group) cDNA clon... 523 e-145
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
3dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
4dbj|AP004028.3| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
5gb|DQ335815.1| Medicago truncatula cytochrome P450 monooxygenase... 68 3e-08
6gb|AC124218.17| Medicago truncatula clone mth2-30b20, complete s... 66 1e-07
7gb|AC148994.3| Medicago truncatula chromosome 7 BAC clone mth2-3... 66 1e-07
8gb|DQ394572.1| Glycine max cytochrome P450 monooxygenase CYP97A ... 64 5e-07
9ref|NM_102914.2| Arabidopsis thaliana heme binding / iron ion bi... 50 0.008
10gb|AY142017.1| Arabidopsis thaliana At1g31800/68069_m00159 mRNA,... 50 0.008
11gb|AY058173.1| Arabidopsis thaliana At1g31800/68069_m00159 mRNA,... 50 0.008
12gb|AY056446.1| Arabidopsis thaliana At1g31800/68069_m00159 mRNA,... 50 0.008
13emb|BX813776.1|CNS0AC0F Arabidopsis thaliana Full-length cDNA Co... 50 0.008
14gb|AC015864.5| Homo sapiens chromosome 18, clone RP11-54A1, comp... 46 0.13
15dbj|AP001169.1| Homo sapiens genomic DNA, chromosome 18q21, dele... 46 0.13
16ref|NM_104965.2| Arabidopsis thaliana unknown protein AT1G62870 ... 44 0.49
17gb|AC011000.3|F16P17 Sequence of BAC F16P17 from Arabidopsis tha... 44 0.49
18emb|BX950181.11| Zebrafish DNA sequence from clone DKEY-28O19 in... 42 2.0
19emb|AL136958.9| Human DNA sequence from clone RP11-147L20 on chr... 42 2.0
20gb|AY016335.1| Phragmites australis haplotype 4 rbcL-psaI interg... 42 2.0
21gb|AY016334.1| Phragmites australis haplotype 3 rbcL-psaI interg... 42 2.0
22gb|AY016333.1| Phragmites australis haplotype 2 rbcL-psaI interg... 42 2.0
23gb|AY016332.1| Phragmites australis haplotype 1 rbcL-psaI interg... 42 2.0
24gb|AF457391.1| Phragmites australis haplotype 14 rbcL-psaI inter... 42 2.0
25gb|AF457390.1| Phragmites australis haplotype 13 rbcL-psaI inter... 42 2.0
26gb|AF457389.1| Phragmites australis haplotype 12 rbcL-psaI inter... 42 2.0
27gb|AF457388.1| Phragmites australis haplotype 11 rbcL-psaI inter... 42 2.0
28gb|AF457387.1| Phragmites australis haplotype 10 rbcL-psaI inter... 42 2.0
29gb|AF457386.1| Phragmites australis haplotype 9 rbcL-psaI interg... 42 2.0
30gb|AF457385.1| Phragmites australis haplotype 8 rbcL-psaI interg... 42 2.0
31gb|AF457384.1| Phragmites australis haplotype 7 rbcL-psaI interg... 42 2.0
32gb|AF457383.1| Phragmites australis haplotype 6 rbcL-psaI interg... 42 2.0
33gb|AF457382.1| Phragmites australis haplotype 5 rbcL-psaI interg... 42 2.0
34gb|AC108482.1| Homo sapiens chromosome 5 clone RP11-107N7, compl... 42 2.0
35gb|AC024578.3|AC024578 Homo sapiens chromosome 5 clone CTD-2363K... 42 2.0
36gb|AE010446.1| Methanopyrus kandleri AV19 section 145 of 157 of ... 40 7.7
37gb|AC110559.11| Mus musculus chromosome 7, clone RP23-253E12, co... 40 7.7
38gb|AC108911.9| Mus musculus chromosome 3, clone RP24-176P16, com... 40 7.7
39gb|AC006392.1| Homo sapiens BAC clone RP11-520M18 from 7, comple... 40 7.7
40gb|AC116590.4| Mus musculus BAC clone RP24-76O19 from X, complet... 40 7.7
41ref|XM_546239.2| PREDICTED: Canis familiaris similar to Serine/t... 40 7.7
42gb|AC162462.6| Mus musculus chromosome 3, clone RP23-55M9, compl... 40 7.7
43gb|AC151265.3| Mus musculus BAC clone RP24-372H7 from chromosome... 40 7.7
44gb|AC008766.4|AC008766 Homo sapiens chromosome 5 clone CTD-2004A... 40 7.7
45gb|AC079041.4|AC079041 Arabidopsis thaliana chromosome 1 BAC F5M... 40 7.7
46gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 7.7
47gb|AY963835.1| Uncultured bacterium clone SJ1_47 polyphosphate k... 40 7.7 
>dbj|AK068163.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013135B04, full
            insert sequence
          Length = 4217

 Score =  523 bits (264), Expect = e-145
 Identities = 459/524 (87%)
 Strand = Plus / Plus

                                                                        
Query: 40   ccgctctacgaccacttcctcacccacggcggcctctttcgcctcaacctcgggcccaag 99
            |||||||| || | |||||| ||| | |||||| |||||||||||||  |||| || |||
Sbjct: 519  ccgctctatgatctcttccttacctatggcggcatctttcgcctcaatttcggccctaag 578

                                                                        
Query: 100  tctttcgtcatcgtctctgatccagatatagctaagcatatcctgagggacaactccaag 159
            |||||| |||| ||||||||||||| |||||||||||| |||||||||||||||||||||
Sbjct: 579  tctttcctcattgtctctgatccagctatagctaagcacatcctgagggacaactccaag 638

                                                                        
Query: 160  gcttattccaagggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatc 219
            |||||||||||||||||||| ||||||||  | |||||||||||||| |||||| |||||
Sbjct: 639  gcttattccaagggtattctggcagaaattttagagtttgtgatgggtacgggtttgatc 698

                                                                        
Query: 220  ccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcag 279
            || |||||||||||| ||||||||||| |  |||| |||||||||||| || |||| |||
Sbjct: 699  cctgctgatggggagatttggcgtgttaggaggcgcgccattgtaccagcaatgcaccag 758

                                                                        
Query: 280  aagtttgtaacagagatgataggtctctttggaaaagcttcaggccggctatgtgagaag 339
            ||||  || || |  |||||| ||||||| ||| | |||||||  ||||| ||  |||||
Sbjct: 759  aagtacgttaccgcaatgataagtctcttcggatatgcttcagatcggctctgccagaag 818

                                                                        
Query: 340  ttggacaaggcagcagcggaaggagagattgtggagatggaatctttgttctctcgacta 399
            ||||||||||||||| |||| || |||  |||||||||||||||||||||||||||||||
Sbjct: 819  ttggacaaggcagcaacggatggggaggatgtggagatggaatctttgttctctcgacta 878

                                                                        
Query: 400  acattggatgtcattgggaaggcggtattcaattatgattttgattcattatcatacgat 459
            ||| ||||||||||||||||||| || |||||||||||||| || ||||| || ||||||
Sbjct: 879  acactggatgtcattgggaaggcagtcttcaattatgatttcgactcattgtcttacgat 938

                                                                        
Query: 460  aatggaatggttgaggctgtgtatgtaacactacgagaagcagaaatgcggagcacttct 519
            |||||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 939  aatggaatagttgaggcagtgtatgtgacactgcgagaagcagaaatgcggagcacttct 998

                                                        
Query: 520  cctataccaacttggaagatacccatatggaaagacatctcccc 563
            ||||||||||||||| | ||||||||||||||||| || |||||
Sbjct: 999  cctataccaacttgggaaatacccatatggaaagatatttcccc 1042
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  184 bits (93), Expect = 2e-43
 Identities = 159/181 (87%)
 Strand = Plus / Minus

                                                                            
Query: 295      atgataggtctctttggaaaagcttcaggccggctatgtgagaagttggacaaggcagca 354
                |||||| ||||||| ||| | |||||||  ||||| ||  ||||||||||||||||||||
Sbjct: 35116648 atgataagtctcttcggatatgcttcagatcggctctgccagaagttggacaaggcagca 35116589

                                                                            
Query: 355      gcggaaggagagattgtggagatggaatctttgttctctcgactaacattggatgtcatt 414
                 |||| || |||  |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 35116588 acggatggggaggatgtggagatggaatctttgttctctcgactaacactggatgtcatt 35116529

                                                                            
Query: 415      gggaaggcggtattcaattatgattttgattcattatcatacgataatggaatggttgag 474
                |||||||| || |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 35116528 gggaaggcagtcttcaattatgatttcgactcattgtcttacgataatggaatagttgag 35116469

                 
Query: 475      g 475
                |
Sbjct: 35116468 g 35116468



 Score =  125 bits (63), Expect = 2e-25
 Identities = 84/91 (92%)
 Strand = Plus / Minus

                                                                            
Query: 473      aggctgtgtatgtaacactacgagaagcagaaatgcggagcacttctcctataccaactt 532
                |||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 35116368 aggcagtgtatgtgacactgcgagaagcagaaatgcggagcacttctcctataccaactt 35116309

                                               
Query: 533      ggaagatacccatatggaaagacatctcccc 563
                || | ||||||||||||||||| || |||||
Sbjct: 35116308 gggaaatacccatatggaaagatatttcccc 35116278



 Score =  117 bits (59), Expect = 4e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                            
Query: 98       agtctttcgtcatcgtctctgatccagatatagctaagcatatcctgagggacaactcca 157
                |||||||| |||| ||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 35117013 agtctttcctcattgtctctgatccagctatagctaagcacatcctgagggacaactcca 35116954

                               
Query: 158      aggcttattccaagg 172
                |||||||||||||||
Sbjct: 35116953 aggcttattccaagg 35116939



 Score =  105 bits (53), Expect = 2e-19
 Identities = 98/113 (86%)
 Strand = Plus / Minus

                                                                            
Query: 170      agggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatcccagctgatg 229
                |||||||||| ||||||||  | |||||||||||||| |||||| ||||||| |||||||
Sbjct: 35116854 agggtattctggcagaaattttagagtttgtgatgggtacgggtttgatccctgctgatg 35116795

                                                                     
Query: 230      gggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcagaag 282
                ||||| ||||||||||| |  |||| |||||||||||| || |||| ||||||
Sbjct: 35116794 gggagatttggcgtgttaggaggcgcgccattgtaccagcaatgcaccagaag 35116742
to top
>dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1202_E07
          Length = 145014

 Score =  184 bits (93), Expect = 2e-43
 Identities = 159/181 (87%)
 Strand = Plus / Minus

                                                                         
Query: 295   atgataggtctctttggaaaagcttcaggccggctatgtgagaagttggacaaggcagca 354
             |||||| ||||||| ||| | |||||||  ||||| ||  ||||||||||||||||||||
Sbjct: 12004 atgataagtctcttcggatatgcttcagatcggctctgccagaagttggacaaggcagca 11945

                                                                         
Query: 355   gcggaaggagagattgtggagatggaatctttgttctctcgactaacattggatgtcatt 414
              |||| || |||  |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 11944 acggatggggaggatgtggagatggaatctttgttctctcgactaacactggatgtcatt 11885

                                                                         
Query: 415   gggaaggcggtattcaattatgattttgattcattatcatacgataatggaatggttgag 474
             |||||||| || |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 11884 gggaaggcagtcttcaattatgatttcgactcattgtcttacgataatggaatagttgag 11825

              
Query: 475   g 475
             |
Sbjct: 11824 g 11824



 Score =  125 bits (63), Expect = 2e-25
 Identities = 84/91 (92%)
 Strand = Plus / Minus

                                                                         
Query: 473   aggctgtgtatgtaacactacgagaagcagaaatgcggagcacttctcctataccaactt 532
             |||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 11724 aggcagtgtatgtgacactgcgagaagcagaaatgcggagcacttctcctataccaactt 11665

                                            
Query: 533   ggaagatacccatatggaaagacatctcccc 563
             || | ||||||||||||||||| || |||||
Sbjct: 11664 gggaaatacccatatggaaagatatttcccc 11634



 Score =  117 bits (59), Expect = 4e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                         
Query: 98    agtctttcgtcatcgtctctgatccagatatagctaagcatatcctgagggacaactcca 157
             |||||||| |||| ||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 12369 agtctttcctcattgtctctgatccagctatagctaagcacatcctgagggacaactcca 12310

                            
Query: 158   aggcttattccaagg 172
             |||||||||||||||
Sbjct: 12309 aggcttattccaagg 12295



 Score =  105 bits (53), Expect = 2e-19
 Identities = 98/113 (86%)
 Strand = Plus / Minus

                                                                         
Query: 170   agggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatcccagctgatg 229
             |||||||||| ||||||||  | |||||||||||||| |||||| ||||||| |||||||
Sbjct: 12210 agggtattctggcagaaattttagagtttgtgatgggtacgggtttgatccctgctgatg 12151

                                                                  
Query: 230   gggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcagaag 282
             ||||| ||||||||||| |  |||| |||||||||||| || |||| ||||||
Sbjct: 12150 gggagatttggcgtgttaggaggcgcgccattgtaccagcaatgcaccagaag 12098
to top
>dbj|AP004028.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C12
          Length = 103973

 Score =  184 bits (93), Expect = 2e-43
 Identities = 159/181 (87%)
 Strand = Plus / Minus

                                                                         
Query: 295   atgataggtctctttggaaaagcttcaggccggctatgtgagaagttggacaaggcagca 354
             |||||| ||||||| ||| | |||||||  ||||| ||  ||||||||||||||||||||
Sbjct: 89811 atgataagtctcttcggatatgcttcagatcggctctgccagaagttggacaaggcagca 89752

                                                                         
Query: 355   gcggaaggagagattgtggagatggaatctttgttctctcgactaacattggatgtcatt 414
              |||| || |||  |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 89751 acggatggggaggatgtggagatggaatctttgttctctcgactaacactggatgtcatt 89692

                                                                         
Query: 415   gggaaggcggtattcaattatgattttgattcattatcatacgataatggaatggttgag 474
             |||||||| || |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 89691 gggaaggcagtcttcaattatgatttcgactcattgtcttacgataatggaatagttgag 89632

              
Query: 475   g 475
             |
Sbjct: 89631 g 89631



 Score =  125 bits (63), Expect = 2e-25
 Identities = 84/91 (92%)
 Strand = Plus / Minus

                                                                         
Query: 473   aggctgtgtatgtaacactacgagaagcagaaatgcggagcacttctcctataccaactt 532
             |||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 89531 aggcagtgtatgtgacactgcgagaagcagaaatgcggagcacttctcctataccaactt 89472

                                            
Query: 533   ggaagatacccatatggaaagacatctcccc 563
             || | ||||||||||||||||| || |||||
Sbjct: 89471 gggaaatacccatatggaaagatatttcccc 89441



 Score =  117 bits (59), Expect = 4e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                         
Query: 98    agtctttcgtcatcgtctctgatccagatatagctaagcatatcctgagggacaactcca 157
             |||||||| |||| ||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 90176 agtctttcctcattgtctctgatccagctatagctaagcacatcctgagggacaactcca 90117

                            
Query: 158   aggcttattccaagg 172
             |||||||||||||||
Sbjct: 90116 aggcttattccaagg 90102



 Score =  105 bits (53), Expect = 2e-19
 Identities = 98/113 (86%)
 Strand = Plus / Minus

                                                                         
Query: 170   agggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatcccagctgatg 229
             |||||||||| ||||||||  | |||||||||||||| |||||| ||||||| |||||||
Sbjct: 90017 agggtattctggcagaaattttagagtttgtgatgggtacgggtttgatccctgctgatg 89958

                                                                  
Query: 230   gggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcagaag 282
             ||||| ||||||||||| |  |||| |||||||||||| || |||| ||||||
Sbjct: 89957 gggagatttggcgtgttaggaggcgcgccattgtaccagcaatgcaccagaag 89905
to top
>gb|DQ335815.1| Medicago truncatula cytochrome P450 monooxygenase CYP97B (CYP97B)
           mRNA, partial cds
          Length = 1599

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 atcccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcat 276
           |||||||||||||||||  | ||||| ||| |||||||| | ||||| ||| ||||||||
Sbjct: 16  atcccagctgatggggaaatatggcgagttagacggcgtactattgtcccagcattgcat 75

                                                     
Query: 277 cagaagtttgtaacagagatgataggtctctttggaaaagct 318
           | |||||||||| |||  ||||| || || |||||| |||||
Sbjct: 76  ctgaagtttgtagcagctatgatcggcctttttggacaagct 117



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 388 ttctctcgactaacattggatgtcattgggaaggcggtattcaattatgattttgat 444
           ||||||||| | || ||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 187 ttctctcgattgacgttggacgtcattgggaaagcagtattcaattatgattttgat 243
to top
>gb|AC124218.17| Medicago truncatula clone mth2-30b20, complete sequence
          Length = 120761

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 388 ttctctcgactaacattggatgtcattgggaaggcggtattcaattatgattttgat 444
           ||||||||| | || ||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 718 ttctctcgattgacgttggacgtcattgggaaagcagtattcaattatgattttgat 662



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 217  atcccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcat 276
            |||||||||||||||||  | ||||| ||| |||||||| | ||||| ||| ||||||||
Sbjct: 1284 atcccagctgatggggaaatatggcgagttagacggcgtactattgtcccagcattgcat 1225

                  
Query: 277  cagaag 282
            | ||||
Sbjct: 1224 ctgaag 1219
to top
>gb|AC148994.3| Medicago truncatula chromosome 7 BAC clone mth2-3c7, complete sequence
          Length = 109093

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                      
Query: 388   ttctctcgactaacattggatgtcattgggaaggcggtattcaattatgattttgat 444
             ||||||||| | || ||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 24907 ttctctcgattgacgttggacgtcattgggaaagcagtattcaattatgattttgat 24963



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                         
Query: 217   atcccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcat 276
             |||||||||||||||||  | ||||| ||| |||||||| | ||||| ||| ||||||||
Sbjct: 24341 atcccagctgatggggaaatatggcgagttagacggcgtactattgtcccagcattgcat 24400

                   
Query: 277   cagaag 282
             | ||||
Sbjct: 24401 ctgaag 24406
to top
>gb|DQ394572.1| Glycine max cytochrome P450 monooxygenase CYP97A (CYP97A) mRNA,
           partial cds
          Length = 1541

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 373 gagatggaatctttgttctctcgactaacattggatgtcattgggaaggcggtattcaat 432
           |||||||||||  | ||||||||| | || |||||  ||||||| ||||| |||||||||
Sbjct: 169 gagatggaatcacttttctctcgattgaccttggacatcattggcaaggcagtattcaat 228

                       
Query: 433 tatgattttgat 444
           ||||||||||||
Sbjct: 229 tatgattttgat 240



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 59/72 (81%)
 Strand = Plus / Plus

                                                                       
Query: 217 atcccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcat 276
           |||||||||||||| ||  | ||||| ||| |||| ||||| || || ||| ||||||| 
Sbjct: 13  atcccagctgatggtgaaatatggcgagttagacgtcgtgctatagtcccagcattgcac 72

                       
Query: 277 cagaagtttgta 288
           ||||||| ||||
Sbjct: 73  cagaagtatgta 84
to top
>ref|NM_102914.2| Arabidopsis thaliana heme binding / iron ion binding /
           monooxygenase/ oxygen binding AT1G31800 mRNA, complete
           cds
          Length = 2446

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 103/129 (79%)
 Strand = Plus / Plus

                                                                       
Query: 160 gcttattccaagggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatc 219
           ||||| |||||||| ||| | || ||||| || || ||||||||||| |  || || || 
Sbjct: 549 gcttactccaaggggattttagctgaaattctagattttgtgatgggaaaaggactcatt 608

                                                                       
Query: 220 ccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcag 279
           || |||||||||||| | ||||||   ||| ||||||||||||| ||  |||||||||| 
Sbjct: 609 cctgctgatggggagatatggcgtagacgaaggcgtgccattgttcctgcattgcatcaa 668

                    
Query: 280 aagtttgta 288
           |||| ||||
Sbjct: 669 aagtatgta 677
to top
>gb|AY142017.1| Arabidopsis thaliana At1g31800/68069_m00159 mRNA, complete cds
          Length = 1788

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 103/129 (79%)
 Strand = Plus / Plus

                                                                       
Query: 160 gcttattccaagggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatc 219
           ||||| |||||||| ||| | || ||||| || || ||||||||||| |  || || || 
Sbjct: 511 gcttactccaaggggattttagctgaaattctagattttgtgatgggaaaaggactcatt 570

                                                                       
Query: 220 ccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcag 279
           || |||||||||||| | ||||||   ||| ||||||||||||| ||  |||||||||| 
Sbjct: 571 cctgctgatggggagatatggcgtagacgaaggcgtgccattgttcctgcattgcatcaa 630

                    
Query: 280 aagtttgta 288
           |||| ||||
Sbjct: 631 aagtatgta 639
to top
>gb|AY058173.1| Arabidopsis thaliana At1g31800/68069_m00159 mRNA, complete cds
          Length = 2017

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 103/129 (79%)
 Strand = Plus / Plus

                                                                       
Query: 160 gcttattccaagggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatc 219
           ||||| |||||||| ||| | || ||||| || || ||||||||||| |  || || || 
Sbjct: 549 gcttactccaaggggattttagctgaaattctagattttgtgatgggaaaaggactcatt 608

                                                                       
Query: 220 ccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcag 279
           || |||||||||||| | ||||||   ||| ||||||||||||| ||  |||||||||| 
Sbjct: 609 cctgctgatggggagatatggcgtagacgaaggcgtgccattgttcctgcattgcatcaa 668

                    
Query: 280 aagtttgta 288
           |||| ||||
Sbjct: 669 aagtatgta 677
to top
>gb|AY056446.1| Arabidopsis thaliana At1g31800/68069_m00159 mRNA, complete cds
          Length = 2057

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 103/129 (79%)
 Strand = Plus / Plus

                                                                       
Query: 160 gcttattccaagggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatc 219
           ||||| |||||||| ||| | || ||||| || || ||||||||||| |  || || || 
Sbjct: 544 gcttactccaaggggattttagctgaaattctagattttgtgatgggaaaaggactcatt 603

                                                                       
Query: 220 ccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcag 279
           || |||||||||||| | ||||||   ||| ||||||||||||| ||  |||||||||| 
Sbjct: 604 cctgctgatggggagatatggcgtagacgaaggcgtgccattgttcctgcattgcatcaa 663

                    
Query: 280 aagtttgta 288
           |||| ||||
Sbjct: 664 aagtatgta 672
to top
>emb|BX813776.1|CNS0AC0F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB39ZD04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 2000

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 103/129 (79%)
 Strand = Plus / Plus

                                                                       
Query: 160 gcttattccaagggtattcttgcagaaatactggagtttgtgatgggcacgggtctgatc 219
           ||||| |||||||| ||| | || ||||| || || ||||||||||| |  || || || 
Sbjct: 517 gcttactccaaggggattttagctgaaattctagattttgtgatgggaaaaggactcatt 576

                                                                       
Query: 220 ccagctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatcag 279
           || |||||||||||| | ||||||   ||| ||||||||||||| ||  |||||||||| 
Sbjct: 577 cctgctgatggggagatatggcgtagacgaaggcgtgccattgttcctgcattgcatcaa 636

                    
Query: 280 aagtttgta 288
           |||| ||||
Sbjct: 637 aagtatgta 645
to top
>gb|AC015864.5| Homo sapiens chromosome 18, clone RP11-54A1, complete sequence
          Length = 177410

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 419   aggcggtattcaattatgattttgatt 445
             |||||||||| ||||||||||||||||
Sbjct: 69208 aggcggtatttaattatgattttgatt 69182
to top
>dbj|AP001169.1| Homo sapiens genomic DNA, chromosome 18q21, deleted region in human lung
              cancer, complete sequence
          Length = 146736

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 419    aggcggtattcaattatgattttgatt 445
              |||||||||| ||||||||||||||||
Sbjct: 123835 aggcggtatttaattatgattttgatt 123861
to top
>ref|NM_104965.2| Arabidopsis thaliana unknown protein AT1G62870 mRNA, complete cds
          Length = 2495

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 358 gaaggagagattgtggagatgg 379
           ||||||||||||||||||||||
Sbjct: 365 gaaggagagattgtggagatgg 344
to top
>gb|AC011000.3|F16P17 Sequence of BAC F16P17 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 98412

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 358   gaaggagagattgtggagatgg 379
             ||||||||||||||||||||||
Sbjct: 12511 gaaggagagattgtggagatgg 12532
to top
>emb|BX950181.11| Zebrafish DNA sequence from clone DKEY-28O19 in linkage group 10,
             complete sequence
          Length = 118366

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 425   tattcaattatgattttgatt 445
             |||||||||||||||||||||
Sbjct: 63592 tattcaattatgattttgatt 63572
to top
>emb|AL136958.9| Human DNA sequence from clone RP11-147L20 on chromosome 13q14.11-14.2
             Contains the ESD gene for esterase D/formylglutathione
             hydrolase, the 3' end of the HTR2A gene for
             5-hydroxytryptamine (serotonin) receptor 2A, the 3' end of
             a variant of gene KIAA1016 and a CpG island, complete
             sequence
          Length = 106317

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 164   attccaagggtattcttgcagaaat 188
             |||||||||||||| ||||||||||
Sbjct: 71668 attccaagggtatttttgcagaaat 71692
to top
>gb|AY016335.1| Phragmites australis haplotype 4 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1074

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 394 attatcatacgataatggaat 414
to top
>gb|AY016334.1| Phragmites australis haplotype 3 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1078

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 399 attatcatacgataatggaat 419
to top
>gb|AY016333.1| Phragmites australis haplotype 2 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1071

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 392 attatcatacgataatggaat 412
to top
>gb|AY016332.1| Phragmites australis haplotype 1 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1105

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 395 attatcatacgataatggaat 415
to top
>gb|AF457391.1| Phragmites australis haplotype 14 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1073

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 391 attatcatacgataatggaat 411
to top
>gb|AF457390.1| Phragmites australis haplotype 13 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1072

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 395 attatcatacgataatggaat 415
to top
>gb|AF457389.1| Phragmites australis haplotype 12 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1099

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 390 attatcatacgataatggaat 410
to top
>gb|AF457388.1| Phragmites australis haplotype 11 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1099

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 390 attatcatacgataatggaat 410
to top
>gb|AF457387.1| Phragmites australis haplotype 10 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1067

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 390 attatcatacgataatggaat 410
to top
>gb|AF457386.1| Phragmites australis haplotype 9 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1072

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 395 attatcatacgataatggaat 415
to top
>gb|AF457385.1| Phragmites australis haplotype 8 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1088

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 390 attatcatacgataatggaat 410
to top
>gb|AF457384.1| Phragmites australis haplotype 7 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1098

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 391 attatcatacgataatggaat 411
to top
>gb|AF457383.1| Phragmites australis haplotype 6 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1067

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 390 attatcatacgataatggaat 410
to top
>gb|AF457382.1| Phragmites australis haplotype 5 rbcL-psaI intergenic spacer,
           chloroplast sequence
          Length = 1067

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 447 attatcatacgataatggaat 467
           |||||||||||||||||||||
Sbjct: 390 attatcatacgataatggaat 410
to top
>gb|AC108482.1| Homo sapiens chromosome 5 clone RP11-107N7, complete sequence
          Length = 166716

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   tcccagctgatggggaggttt 238
             |||||||||||||||||||||
Sbjct: 10474 tcccagctgatggggaggttt 10454
to top
>gb|AC024578.3|AC024578 Homo sapiens chromosome 5 clone CTD-2363K11, complete sequence
          Length = 109685

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 218   tcccagctgatggggaggttt 238
             |||||||||||||||||||||
Sbjct: 66532 tcccagctgatggggaggttt 66552
to top
>gb|AE010446.1| Methanopyrus kandleri AV19 section 145 of 157 of the complete
           genome
          Length = 14300

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 40  ccgctctacgaccacttcct 59
           ||||||||||||||||||||
Sbjct: 149 ccgctctacgaccacttcct 168
to top
>gb|AC110559.11| Mus musculus chromosome 7, clone RP23-253E12, complete sequence
          Length = 192856

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 427   ttcaattatgattttgattc 446
             ||||||||||||||||||||
Sbjct: 56018 ttcaattatgattttgattc 55999
to top
>gb|AC108911.9| Mus musculus chromosome 3, clone RP24-176P16, complete sequence
          Length = 162278

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 424   gtattcaattatgattttga 443
             ||||||||||||||||||||
Sbjct: 13465 gtattcaattatgattttga 13446
to top
>gb|AC006392.1| Homo sapiens BAC clone RP11-520M18 from 7, complete sequence
          Length = 117381

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 114    ctctgatccagatatagctaagcatatc 141
              ||||||| ||||||||||||||| ||||
Sbjct: 115485 ctctgatacagatatagctaagcttatc 115458
to top
>gb|AC116590.4| Mus musculus BAC clone RP24-76O19 from X, complete sequence
          Length = 171054

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 357    ggaaggagagattgtggaga 376
              ||||||||||||||||||||
Sbjct: 105224 ggaaggagagattgtggaga 105243
to top
>ref|XM_546239.2| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase 10 (Lymphocyte-oriented kinase) (LOC489121), mRNA
          Length = 4245

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 347  aggcagcagcggaaggagag 366
            ||||||||||||||||||||
Sbjct: 2020 aggcagcagcggaaggagag 2039
to top
>gb|AC162462.6| Mus musculus chromosome 3, clone RP23-55M9, complete sequence
          Length = 191456

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 424    gtattcaattatgattttga 443
              ||||||||||||||||||||
Sbjct: 126233 gtattcaattatgattttga 126252
to top
>gb|AC151265.3| Mus musculus BAC clone RP24-372H7 from chromosome 17, complete sequence
          Length = 191739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 348    ggcagcagcggaaggagaga 367
              ||||||||||||||||||||
Sbjct: 127374 ggcagcagcggaaggagaga 127393
to top
>gb|AC008766.4|AC008766 Homo sapiens chromosome 5 clone CTD-2004A9, complete sequence
          Length = 147530

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   tgataggtctctttggaaaa 315
             ||||||||||||||||||||
Sbjct: 30764 tgataggtctctttggaaaa 30783
to top
>gb|AC079041.4|AC079041 Arabidopsis thaliana chromosome 1 BAC F5M6 genomic sequence, complete
             sequence
          Length = 119420

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 223   gctgatggggaggtttggcgtgttcgacggcgtgccattgtaccatcattgcatca 278
             |||||||||||| | ||||||   ||| ||||||||||||| ||  ||||||||||
Sbjct: 91818 gctgatggggagatatggcgtagacgaaggcgtgccattgttcctgcattgcatca 91763
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 1       gggcggggtcgctggcggcc 20
               ||||||||||||||||||||
Sbjct: 4949847 gggcggggtcgctggcggcc 4949828
to top
>gb|AY963835.1| Uncultured bacterium clone SJ1_47 polyphosphate kinase (ppk) gene,
           partial cds
          Length = 1215

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 543 catatggaaagacatctccc 562
           ||||||||||||||||||||
Sbjct: 138 catatggaaagacatctccc 157


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,676,961
Number of Sequences: 3902068
Number of extensions: 4676961
Number of successful extensions: 84154
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84026
Number of HSP's gapped (non-prelim): 122
length of query: 568
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 545
effective length of database: 17,143,297,704
effective search space: 9343097248680
effective search space used: 9343097248680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top