ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal6f24 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence Length = 1878 Score = 174 bits (88), Expect = 2e-40 Identities = 142/160 (88%) Strand = Plus / Plus Query: 70 gtgccctgcgagcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctg 129 |||||||| ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 1270 gtgccctgacagcaccacctgctgctgcatctacgagtacggcaagtactgcttcgcctg 1329 Query: 130 gggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccctca 189 |||||| ||||| || ||||| || ||||||||||| |||||||||||||||||||| || Sbjct: 1330 gggctgctgcccgctcgagggcgccacctgctgcgacgatcactacagctgctgccccca 1389 Query: 190 taactatcccatctgcaacaccaagcagggaacgtgcctc 229 | |||| |||||||||||| || ||||||||| |||||| Sbjct: 1390 tgactaccccatctgcaacgtcaggcagggaacctgcctc 1429 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Plus Query: 374 cactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 ||||||||||||||||| || ||| |||||||||||||| Sbjct: 1452 cactgtcagtgaaggctacgaagcgaaccctggccaagcc 1491
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor complex, complete cds Length = 1828 Score = 174 bits (88), Expect = 2e-40 Identities = 142/160 (88%) Strand = Plus / Plus Query: 70 gtgccctgcgagcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctg 129 |||||||| ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 1234 gtgccctgacagcaccacctgctgctgcatctacgagtacggcaagtactgcttcgcctg 1293 Query: 130 gggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccctca 189 |||||| ||||| || ||||| || ||||||||||| |||||||||||||||||||| || Sbjct: 1294 gggctgctgcccgctcgagggcgccacctgctgcgacgatcactacagctgctgccccca 1353 Query: 190 taactatcccatctgcaacaccaagcagggaacgtgcctc 229 | |||| |||||||||||| || ||||||||| |||||| Sbjct: 1354 tgactaccccatctgcaacgtcaggcagggaacctgcctc 1393 Score = 48.1 bits (24), Expect = 0.036 Identities = 47/54 (87%), Gaps = 3/54 (5%) Strand = Plus / Plus Query: 363 caaggacagcccactg---tcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||| |||||||||||| || ||| |||||||||||||| Sbjct: 1399 caaggacagcccactgctttcagtgaaggctacgaagcgaaccctggccaagcc 1452
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds Length = 1830 Score = 168 bits (85), Expect = 1e-38 Identities = 136/153 (88%) Strand = Plus / Plus Query: 70 gtgccctgcgagcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctg 129 |||||||| ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 1235 gtgccctgacagcaccacctgctgctgcatctacgagtacggcaagtactgcttcgcctg 1294 Query: 130 gggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccctca 189 |||||| ||||| || ||||| || ||||||||||| |||||||||||||||||||| || Sbjct: 1295 gggctgctgcccgctcgagggcgccacctgctgcgacgatcactacagctgctgccccca 1354 Query: 190 taactatcccatctgcaacaccaagcagggaac 222 | |||| |||||||||||| || ||||||||| Sbjct: 1355 tgactaccccatctgcaacgtcaggcagggaac 1387 Score = 46.1 bits (23), Expect = 0.14 Identities = 35/39 (89%) Strand = Plus / Plus Query: 374 cactgtcagtgaaggctcagaggcgtaccctggccaagc 412 ||||||||||||||||| || ||| ||||||||||||| Sbjct: 1417 cactgtcagtgaaggctacgaagcgaaccctggccaagc 1455
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1377 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Plus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 1126 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 1185 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 1186 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 1245 Query: 200 atctgcaa 207 |||||||| Sbjct: 1246 atctgcaa 1253 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 364 aaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 1282 aaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 1331
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 33157904 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 33157845 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 33157844 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 33157785 Query: 200 atctgcaa 207 |||||||| Sbjct: 33157784 atctgcaa 33157777 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 359 aggccaaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||| |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 33157657 aggctaaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 33157603 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 34207905 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 34207846 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 34207845 cctgactaccctgtctgcaacacc 34207822
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full insert sequence Length = 1753 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Plus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 1191 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 1250 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 1251 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 1310 Query: 200 atctgcaa 207 |||||||| Sbjct: 1311 atctgcaa 1318 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 364 aaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 1347 aaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 1396
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full insert sequence Length = 1774 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Plus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 1191 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 1250 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 1251 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 1310 Query: 200 atctgcaa 207 |||||||| Sbjct: 1311 atctgcaa 1318 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 364 aaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 1347 aaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 1396
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full insert sequence Length = 976 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Plus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 393 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 452 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 453 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 512 Query: 200 atctgcaa 207 |||||||| Sbjct: 513 atctgcaa 520 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 364 aaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 549 aaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 598
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete sequence Length = 118971 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 48297 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 48238 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 48237 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 48178 Query: 200 atctgcaa 207 |||||||| Sbjct: 48177 atctgcaa 48170 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 359 aggccaaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||| |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 48050 aggctaaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 47996
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha, complete cds Length = 1929 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Plus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 1171 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 1230 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 1231 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 1290 Query: 200 atctgcaa 207 |||||||| Sbjct: 1291 atctgcaa 1298 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 364 aaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 1327 aaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 1376
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02, complete sequence Length = 165745 Score = 143 bits (72), Expect = 8e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 80 agcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctggggctgttgc 139 ||||| ||||||||||||||||||||||| ||||| | |||| |||||||||||| ||| Sbjct: 40554 agcaccacctgctgctgcatctacgagtatggcaaatactgctacgcctggggctgctgc 40495 Query: 140 ccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatccc 199 ||||| ||||| || ||||||||||||||||||||||||||||||||||| | || ||| Sbjct: 40494 ccactcgagggcgccacctgctgcgatgatcactacagctgctgccctcacgagtacccc 40435 Query: 200 atctgcaa 207 |||||||| Sbjct: 40434 atctgcaa 40427 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 359 aggccaaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||| |||||||| |||||| |||||||||||| || |||||||||||| ||||| Sbjct: 40307 aggctaaggacagtccactggcagtgaaggctctgaagcgtaccctggcaaagcc 40253
>gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence Length = 718 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Plus Query: 110 ggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 |||||| | ||||||||||||||||| ||||| || ||||| || |||||||| || ||| Sbjct: 5 ggcaagtactgcttcgcctggggctgctgcccgctcgagggcgccacctgctgtgacgat 64 Query: 170 cactacagctgctgccctcataactatcccatctgcaacaccaagcagggaacgtgcctc 229 ||||||||||||||||| ||| |||| |||||||||||| | |||||||||| |||||| Sbjct: 65 cactacagctgctgcccccatgactaccccatctgcaacgtccagcagggaacctgcctc 124 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 363 caaggacagcccactgtcagtgaaggctcagaggcgtaccctggccaagcc 413 |||||||||||||||||||||||||||| || ||| |||||||||||||| Sbjct: 235 caaggacagcccactgtcagtgaaggctacgaagcgcaccctggccaagcc 285
>gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, complete cds Length = 1831 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||| || |||||||||||||||||||||||||| || || || || ||||||||||| Sbjct: 1242 tggggatgctgcccacttgagggtgctacctgctgtgaagaccattatagctgctgccca 1301 Query: 188 cataactatcccatctgcaacaccaagcagggaac 222 ||| |||||||||||||||||| || |||||||| Sbjct: 1302 catgactatcccatctgcaacattaaccagggaac 1336
>emb|AJ844007.1| Plantago major partial mRNA for cysteine protease 3 (cpr3 gene) Length = 648 Score = 89.7 bits (45), Expect = 1e-14 Identities = 96/113 (84%) Strand = Plus / Plus Query: 71 tgccctgcgagcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctgg 130 ||||||| |||||| ||||||||||||||||| |||||| | ||||||||||| ||| Sbjct: 41 tgccctgagagcactacctgctgctgcatctatgagtactggggtgagtgcttcgcatgg 100 Query: 131 ggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctg 183 || ||||| |||||||||||||| |||||||| || || || ||||| ||||| Sbjct: 101 ggatgttgtccacttgagggtgccacctgctgtgaggaccattacagttgctg 153
>emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor (clone cp71) Length = 1680 Score = 87.7 bits (44), Expect = 4e-14 Identities = 62/68 (91%) Strand = Plus / Plus Query: 143 cttgagggtgctacctgctgcgatgatcactacagctgctgccctcataactatcccatc 202 ||||| |||||||||||||| ||||| |||||||| |||||||| ||| ||||||||||| Sbjct: 1193 cttgaaggtgctacctgctgtgatgaccactacagttgctgcccccatgactatcccatc 1252 Query: 203 tgcaacac 210 |||||||| Sbjct: 1253 tgcaacac 1260
>emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine proteinase, partial Length = 995 Score = 67.9 bits (34), Expect = 4e-08 Identities = 76/90 (84%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 ||||||| ||||| ||||||||||| |||| ||| || ||||| ||||| || ||||| Sbjct: 510 tgcttcgagtggggatgttgcccactcgaggctgccacttgctgtgatgaccattacagt 569 Query: 179 tgctgccctcataactatcccatctgcaac 208 |||||||| ||| | ||||||||||||||| Sbjct: 570 tgctgcccacatgagtatcccatctgcaac 599
>gb|AF133838.1| Sandersonia aurantiaca papain-like cysteine protease (PRT15) mRNA, partial cds Length = 1456 Score = 65.9 bits (33), Expect = 2e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 |||||||| ||||| || || || ||||| ||||| |||||||| |||||||||| ||| Sbjct: 901 tgcttcgcatgggggtgctgtcctcttgaaggtgccacctgctgtgatgatcactctagc 960 Query: 179 tgctgccctcataactatcccatctgcaa 207 |||||||| ||| ||| ||| |||||||| Sbjct: 961 tgctgcccccatgactttcctatctgcaa 989
>gb|U41902.1|PMU41902 Pseudosuga menziesii cysteine protease pseudotzain (PM33cysP) mRNA, complete cds Length = 1882 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 155 acctgctgcgatgatcactacagctgctgccct 187 ||||||||||| ||||||||||||||||||||| Sbjct: 1366 acctgctgcgacgatcactacagctgctgccct 1398
>ref|XM_474291.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1401 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 1231 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 1290 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 1291 cctgactaccctgtctgcaacacc 1314
>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12, complete sequence Length = 190432 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 119287 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 119228 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 119227 cctgactaccctgtctgcaacacc 119204
>gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete sequence Length = 97953 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 151 tgctacctgctgcgatgatcactacagctgctgccctcat 190 |||||| ||||| |||||||||||||| |||||||||||| Sbjct: 70822 tgctacttgctgtgatgatcactacagttgctgccctcat 70783
>gb|AF366556.1| Oryza sativa saline responsive OSSRIII protein mRNA, partial cds Length = 368 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 204 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 263 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 264 cctgactaccctgtctgcaacacc 287
>gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-29a5, complete sequence Length = 124676 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 151 tgctacctgctgcgatgatcactacagctgctgccctcat 190 |||||| ||||| |||||||||||||| |||||||||||| Sbjct: 82111 tgctacttgctgtgatgatcactacagttgctgccctcat 82072
>dbj|AB098627.1| Daucus carota DcCysP4 mRNA for cysteine protease, complete cds Length = 1668 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 155 acctgctgcgatgatcactacagctgctgccc 186 ||||||||||||||||||| |||||||||||| Sbjct: 1221 acctgctgcgatgatcactccagctgctgccc 1252
>dbj|AB098624.1| Daucus carota DcCysP1 mRNA for cysteine protease, complete cds Length = 1768 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 155 acctgctgcgatgatcactacagctgctgccc 186 |||||||| ||||||||||||||||||||||| Sbjct: 1364 acctgctgtgatgatcactacagctgctgccc 1395
>dbj|AK109371.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E09, full insert sequence Length = 1766 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 1335 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 1394 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 1395 cctgactaccctgtctgcaacacc 1418
>dbj|AK073373.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033027D09, full insert sequence Length = 1753 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 1336 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 1395 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 1396 cctgactaccctgtctgcaacacc 1419
>emb|AL732346.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0818H01, complete sequence Length = 101125 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 58607 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 58548 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 58547 cctgactaccctgtctgcaacacc 58524
>dbj|D90407.1|RICOZB Oryza sativa (japonica cultivar-group) mRNA for oryzain beta, complete cds Length = 1675 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| Sbjct: 1247 tggggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccg 1306 Query: 188 cataactatcccatctgcaacacc 211 | | |||| || ||||||||||| Sbjct: 1307 cctgactaccctgtctgcaacacc 1330
>dbj|AB252653.1| Platycodon grandiflorus PgCP1 mRNA for cysteine proteinase, complete cds Length = 1676 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccc 186 ||||| || ||||||||||| ||||| |||||||| |||||||| || || |||||||| Sbjct: 1215 tggggatgctgcccacttgacggtgccacctgctgtgatgatcattatagttgctgccc 1273
>dbj|AK099358.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044I21, full insert sequence Length = 1742 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Plus Query: 130 gggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccctca 189 ||||||||||||| |||| ||||| ||||||||| | ||||| |||||||||||| | Sbjct: 1313 gggctgttgcccagttgaaggtgcaacctgctgcaaggatcatgccagctgctgcccgcc 1372 Query: 190 taactatcccatctgcaacacc 211 | |||| || ||||||||||| Sbjct: 1373 tgactaccctgtctgcaacacc 1394
>emb|AJ003137.1|LEAJ3137 Lycopersicon esculentum mRNA for cysteine protease CYP1, complete CDS Length = 1756 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 |||||| | ||||| || ||||||||||| || || || ||||| || || |||||||| Sbjct: 1220 tgcttctcttggggatgctgcccacttgaaggagccacttgctgtgaagaccactacagt 1279 Query: 179 tgctgccctcataactatcccatctgcaa 207 |||||||| || ||||||| |||||||| Sbjct: 1280 tgctgcccacacgactatcctatctgcaa 1308
>gb|AF172856.1|AF172856 Lycopersicon esculentum cysteine protease TDI-65 (tdi-65) mRNA, complete cds Length = 1779 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 |||||| | ||||| || ||||||||||| || || || ||||| || || |||||||| Sbjct: 1239 tgcttctcttggggatgctgcccacttgaaggagccacttgctgtgaagaccactacagt 1298 Query: 179 tgctgccctcataactatcccatctgcaa 207 |||||||| || ||||||| |||||||| Sbjct: 1299 tgctgcccacacgactatcctatctgcaa 1327
>dbj|AB098631.1| Daucus carota DcCysP8 mRNA for cysteine protease, complete cds Length = 1884 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 125 gcctggggctgttgcccacttgagggtgctacctgctgcgatgat 169 ||||||||||| ||||| |||||||| ||| |||| ||||||||| Sbjct: 1320 gcctggggctgctgccctcttgagggcgcttcctgttgcgatgat 1364
>dbj|AB109186.1| Helianthus annuus scp1 mRNA for cysteine protease-1, complete cds Length = 1589 Score = 50.1 bits (25), Expect = 0.009 Identities = 109/137 (79%) Strand = Plus / Plus Query: 71 tgccctgcgagcacgacctgctgctgcatctacgagtacggcaaggagtgcttcgcctgg 130 ||||||| ||||| ||||||||||||||||| |||||| | || ||||| ||| Sbjct: 1184 tgccctgaaagcacaacctgctgctgcatctatgagtactatggctactgtttcgcttgg 1243 Query: 131 ggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccctcat 190 || ||||| || | ||||||||| | ||||| |||||||| ||||| |||||||| ||| Sbjct: 1244 ggatgttgtccgttagagggtgcttcttgctgtgatgatcattacagttgctgcccacat 1303 Query: 191 aactatcccatctgcaa 207 | ||||| |||||||| Sbjct: 1304 gattatccaatctgcaa 1320
>gb|M21444.1|TOMLTITP Lycopersicon esculentum low-temperature-induced thiol protease mRNA, complete cds Length = 1353 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 |||||| | ||||| || ||||||||||| || || || ||||| || || |||||||| Sbjct: 832 tgcttctcttggggatgctgcccacttgaaggagccacttgctgtgaagaccactacagt 891 Query: 179 tgctgccctcataactatcccatctgcaa 207 |||||||| || ||||||| |||||||| Sbjct: 892 tgctgcccacacgactatcctatctgcaa 920
>dbj|AB098628.1| Daucus carota DcCysP5 mRNA for cysteine protease, complete cds Length = 1928 Score = 46.1 bits (23), Expect = 0.14 Identities = 59/71 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||| || ||||| ||||||| |||| |||||||||||||| ||| || ||||| || Sbjct: 1384 tggggttgctgcccgcttgaggctgcttcctgctgcgatgatggctatagttgctgtcca 1443 Query: 188 cataactatcc 198 ||| ||||||| Sbjct: 1444 catgactatcc 1454
>gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome 14, complete sequence Length = 202981 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 596 atgctcctgtacataatcctaaaatcgggtt 626 |||||||||| | |||||||||||||||||| Sbjct: 65998 atgctcctgttcctaatcctaaaatcgggtt 65968
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome Length = 5237682 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaatt 270 |||||||||||||||||||||| Sbjct: 464222 tttcatactgttttcttcaatt 464243
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome Length = 5227419 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaatt 270 |||||||||||||||||||||| Sbjct: 438767 tttcatactgttttcttcaatt 438788
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome Length = 5228663 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaatt 270 |||||||||||||||||||||| Sbjct: 438810 tttcatactgttttcttcaatt 438831
>gb|CP000001.1| Bacillus cereus E33L, complete genome Length = 5300915 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaatt 270 |||||||||||||||||||||| Sbjct: 457422 tttcatactgttttcttcaatt 457443
>emb|X66061.1|PSTHIOL P.sativum mRNA for thiolprotease Length = 1820 Score = 44.1 bits (22), Expect = 0.56 Identities = 52/62 (83%) Strand = Plus / Plus Query: 128 tggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccct 187 ||||| |||||||| || ||| |||||| ||||| || ||||| ||||| ||||||||| Sbjct: 1203 tggggatgttgccctctagagtctgctacttgctgtgacgatcattacagttgctgccct 1262 Query: 188 ca 189 || Sbjct: 1263 ca 1264
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 ccggcccaactccaccgtctcc 33 |||||||||||||||||||||| Sbjct: 16228153 ccggcccaactccaccgtctcc 16228174
>gb|AF454957.1| Brassica oleracea senescence-associated cysteine protease (CP2) mRNA, complete cds Length = 1699 Score = 44.1 bits (22), Expect = 0.56 Identities = 70/86 (81%) Strand = Plus / Plus Query: 105 agtacggcaaggagtgcttcgcctggggctgttgcccacttgagggtgctacctgctgcg 164 ||||||| ||| | ||||||| ||||| |||||||| || || | |||||| ||||||| Sbjct: 1199 agtacggtaagtactgcttcggttggggatgttgccctctcgaagctgctacttgctgcg 1258 Query: 165 atgatcactacagctgctgccctcat 190 ||||| || |||||||| |||||| Sbjct: 1259 atgataacactagctgctgtcctcat 1284
>dbj|AP005570.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1344_B01 Length = 170912 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 ccggcccaactccaccgtctcc 33 |||||||||||||||||||||| Sbjct: 44669 ccggcccaactccaccgtctcc 44690
>dbj|AP005424.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0556H01 Length = 149800 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 ccggcccaactccaccgtctcc 33 |||||||||||||||||||||| Sbjct: 132754 ccggcccaactccaccgtctcc 132775
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome Length = 5227293 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaatt 270 |||||||||||||||||||||| Sbjct: 438767 tttcatactgttttcttcaatt 438788
>gb|AY700588.1| Zingiber officinale cysteine protease gp3b mRNA, complete cds Length = 1575 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 146 gagggtgctacctgctgcgatgatcactacagctgctgccc 186 ||||| || ||||||||| | || ||||||||||||||||| Sbjct: 1246 gagggggcgacctgctgcaaggaccactacagctgctgccc 1286
>gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, complete cds Length = 1597 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 146 gagggtgctacctgctgcgatgatcactacagctgctgccc 186 ||||| || ||||||||| | || ||||||||||||||||| Sbjct: 1275 gagggggcgacctgctgcaaagaccactacagctgctgccc 1315
>emb|AL596164.1| Listeria innocua Clip11262 complete genome, segment 2/12 Length = 224650 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 157 ctgctgcgatgatcactacagctgctgccctca 189 ||||||||||||| |||||| ||||||| |||| Sbjct: 200347 ctgctgcgatgataactacatctgctgcgctca 200315
>gb|AC152395.9| Mus musculus chromosome 15, clone RP23-391D2, complete sequence Length = 210006 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 341 ttttattgcttcatgaatagg 361 ||||||||||||||||||||| Sbjct: 78096 ttttattgcttcatgaatagg 78116
>emb|BX548050.11| Zebrafish DNA sequence from clone DKEY-267D18 in linkage group 10, complete sequence Length = 208578 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 253 atactgttttcttcaattaat 273 ||||||||||||||||||||| Sbjct: 113986 atactgttttcttcaattaat 114006
>gb|AC114899.5| Ustilago hordei strain 4875-4 clone uhobac-1n1, complete sequence Length = 100185 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 gtgccctgcgagcacgacctg 90 ||||||||||||||||||||| Sbjct: 89329 gtgccctgcgagcacgacctg 89349
>gb|AC104637.5| Homo sapiens 3 BAC RP11-387L24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 99960 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 245 accatttcatactgttttctt 265 ||||||||||||||||||||| Sbjct: 39329 accatttcatactgttttctt 39349
>gb|AC112645.3| Homo sapiens 3 BAC RP11-100J1 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 46996 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 245 accatttcatactgttttctt 265 ||||||||||||||||||||| Sbjct: 5794 accatttcatactgttttctt 5774
>emb|AM118080.1| Ustilago hordei mating type region MAT-1, strain 364 Length = 526707 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 gtgccctgcgagcacgacctg 90 ||||||||||||||||||||| Sbjct: 363334 gtgccctgcgagcacgacctg 363354
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome Length = 5411809 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaat 269 ||||||||||||||||||||| Sbjct: 451852 tttcatactgttttcttcaat 451872
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 249 tttcatactgttttcttcaat 269 ||||||||||||||||||||| Sbjct: 547239 tttcatactgttttcttcaat 547259
>ref|NM_123672.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type peptidase AT5G43060 mRNA, complete cds Length = 1675 Score = 40.1 bits (20), Expect = 8.7 Identities = 59/72 (81%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 ||||||| ||||| |||||||| || || | |||||| |||||||||||| ||| || Sbjct: 1235 tgcttcggatggggatgttgcccgctcgaagctgctacttgctgcgatgataactcaagt 1294 Query: 179 tgctgccctcat 190 ||||| |||||| Sbjct: 1295 tgctgtcctcat 1306
>gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosome 8, complete sequence Length = 235813 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 578 gtatcttctttataatagatgctc 601 |||||| ||||||||||||||||| Sbjct: 211191 gtatctcctttataatagatgctc 211168
>ref|XM_424550.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen 11/4 precursor - chicken (LOC426939), mRNA Length = 1599 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 ctacagctgctgccctcata 191 |||||||||||||||||||| Sbjct: 140 ctacagctgctgccctcata 159
>ref|XM_422997.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen 11/4 precursor - chicken (LOC425214), partial mRNA Length = 1648 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 ctacagctgctgccctcata 191 |||||||||||||||||||| Sbjct: 687 ctacagctgctgccctcata 706
>ref|XM_608030.2| PREDICTED: Bos taurus aminopeptidase N, transcript variant 1 (APN), mRNA Length = 2610 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccaactccaccgtctcccgcccc 39 ||||||||||||||| |||||||| Sbjct: 1780 cccaactccaccgtcacccgcccc 1803
>ref|XM_875495.1| PREDICTED: Bos taurus aminopeptidase N, transcript variant 4 (APN), mRNA Length = 3504 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccaactccaccgtctcccgcccc 39 ||||||||||||||| |||||||| Sbjct: 1855 cccaactccaccgtcacccgcccc 1878
>ref|XM_875424.1| PREDICTED: Bos taurus aminopeptidase N, transcript variant 3 (APN), mRNA Length = 3495 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccaactccaccgtctcccgcccc 39 ||||||||||||||| |||||||| Sbjct: 1846 cccaactccaccgtcacccgcccc 1869
>ref|XM_865178.1| PREDICTED: Bos taurus aminopeptidase N, transcript variant 2 (APN), mRNA Length = 3495 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccaactccaccgtctcccgcccc 39 ||||||||||||||| |||||||| Sbjct: 1846 cccaactccaccgtcacccgcccc 1869
>gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds Length = 3146 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 589 ataatagatgctcctgtacataat 612 ||||||||||||||||||| |||| Sbjct: 1995 ataatagatgctcctgtacctaat 1972
>gb|AC127306.3| Mus musculus BAC clone RP23-290H17 from chromosome 7, complete sequence Length = 204478 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 244 gaccatttcatactgttttc 263 |||||||||||||||||||| Sbjct: 119256 gaccatttcatactgttttc 119237
>emb|Z73897.1|CEZK617 Caenorhabditis elegans Cosmid ZK617, complete sequence Length = 45230 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 258 gttttcttcaattaatgtggttat 281 |||||||||||||||| ||||||| Sbjct: 12414 gttttcttcaattaatttggttat 12391
>gb|AC110028.8| Mus musculus chromosome 6, clone RP23-44E17, complete sequence Length = 243770 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 ttatgatgtcatgtaaatct 297 |||||||||||||||||||| Sbjct: 203346 ttatgatgtcatgtaaatct 203327
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5' end of the RORB gene for RAR-related orphan receptor B protein (RZRB, ROR-BETA), two novel genes and two CpG islands, complete sequence Length = 174874 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 505 tgattaacttctgcaaatgatcac 528 ||||||||||||| |||||||||| Sbjct: 81896 tgattaacttctgaaaatgatcac 81873
>ref|XM_791539.1| PREDICTED: Strongylocentrotus purpuratus similar to sacsin (LOC591996), partial mRNA Length = 1273 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 cggcccaactccaccgtctc 32 |||||||||||||||||||| Sbjct: 462 cggcccaactccaccgtctc 481
>emb|AL139342.7| Human DNA sequence from clone RP5-1016N21 on chromosome 1q42.13-43 Contains the 5' end of a novel gene (FLJ11383), complete sequence Length = 151553 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 atttcatactgttttcttca 267 |||||||||||||||||||| Sbjct: 66596 atttcatactgttttcttca 66615
>gb|AC079313.35| Homo sapiens 12q BAC RP11-753H16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160232 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 ccgtctcccgccccaccgtcttcc 49 ||||||||||||||| |||||||| Sbjct: 23046 ccgtctcccgccccagcgtcttcc 23023
>ref|XM_781911.1| PREDICTED: Strongylocentrotus purpuratus similar to sacsin (LOC581934), mRNA Length = 2007 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 cggcccaactccaccgtctc 32 |||||||||||||||||||| Sbjct: 21 cggcccaactccaccgtctc 40
>emb|X15423.1|CEUNC22 Caenorhabditis elegans unc-22 gene for twitchin Length = 47081 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 258 gttttcttcaattaatgtggttat 281 |||||||||||||||| ||||||| Sbjct: 20553 gttttcttcaattaatttggttat 20576
>gb|AC093920.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1725_E07, complete sequence Length = 87244 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 281 tgatgtcatgtaaatctctagcaa 304 |||||||||| ||||||||||||| Sbjct: 85553 tgatgtcatgcaaatctctagcaa 85530
>gb|AY114661.1| Arabidopsis thaliana cysteine protease component of protease-inhibitor complex (At5g43060) mRNA, complete cds Length = 1485 Score = 40.1 bits (20), Expect = 8.7 Identities = 59/72 (81%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 ||||||| ||||| |||||||| || || | |||||| |||||||||||| ||| || Sbjct: 1192 tgcttcggatggggatgttgcccgctcgaagctgctacttgctgcgatgataactcaagt 1251 Query: 179 tgctgccctcat 190 ||||| |||||| Sbjct: 1252 tgctgtcctcat 1263
>gb|BC105142.1| Bos taurus cDNA clone MGC:126949 IMAGE:7929135, complete cds Length = 3412 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccaactccaccgtctcccgcccc 39 ||||||||||||||| |||||||| Sbjct: 1745 cccaactccaccgtcacccgcccc 1768
>gb|AY062608.1| Arabidopsis thaliana cysteine protease component of protease-inhibitor complex (At5g43060; MMG4.7) mRNA, complete cds Length = 1628 Score = 40.1 bits (20), Expect = 8.7 Identities = 59/72 (81%) Strand = Plus / Plus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 ||||||| ||||| |||||||| || || | |||||| |||||||||||| ||| || Sbjct: 1236 tgcttcggatggggatgttgcccgctcgaagctgctacttgctgcgatgataactcaagt 1295 Query: 179 tgctgccctcat 190 ||||| |||||| Sbjct: 1296 tgctgtcctcat 1307
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence Length = 220673 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 578 gtatcttctttataatagatgctc 601 |||||| ||||||||||||||||| Sbjct: 75802 gtatctcctttataatagatgctc 75779
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 257 tgttttcttcaattaatgtg 276 |||||||||||||||||||| Sbjct: 20487890 tgttttcttcaattaatgtg 20487909
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 281 tgatgtcatgtaaatctctagcaa 304 |||||||||| ||||||||||||| Sbjct: 5270271 tgatgtcatgcaaatctctagcaa 5270248
>gb|AF493427.1| Gallus gallus Ig V-region-like antigen precursor, precursor RNA, complete cds Length = 1940 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 ctacagctgctgccctcata 191 |||||||||||||||||||| Sbjct: 22 ctacagctgctgccctcata 41
>gb|AC067719.12| Homo sapiens 3 BAC RP11-183L23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172945 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 attaatgtggttatgatgtc 287 |||||||||||||||||||| Sbjct: 37463 attaatgtggttatgatgtc 37482
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 75 ctgcgagcacgacctgctgc 94 |||||||||||||||||||| Sbjct: 904251 ctgcgagcacgacctgctgc 904232
>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence Length = 151453 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 200 atctgcaacaccaagcaggg 219 |||||||||||||||||||| Sbjct: 20126 atctgcaacaccaagcaggg 20107
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gcgagcacgacctgctgctg 96 |||||||||||||||||||| Sbjct: 2208329 gcgagcacgacctgctgctg 2208310
>dbj|AP003686.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0659D09 Length = 168253 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 257 tgttttcttcaattaatgtg 276 |||||||||||||||||||| Sbjct: 60185 tgttttcttcaattaatgtg 60204
>dbj|AB008267.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMG4 Length = 79046 Score = 40.1 bits (20), Expect = 8.7 Identities = 59/72 (81%) Strand = Plus / Minus Query: 119 tgcttcgcctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagc 178 ||||||| ||||| |||||||| || || | |||||| |||||||||||| ||| || Sbjct: 16007 tgcttcggatggggatgttgcccgctcgaagctgctacttgctgcgatgataactcaagt 15948 Query: 179 tgctgccctcat 190 ||||| |||||| Sbjct: 15947 tgctgtcctcat 15936
>emb|AJ339394.1|HSA339394 Homo sapiens genomic sequence surrounding NotI site, clone NR5-FF21C Length = 640 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 ccgtctcccgccccaccgtcttcc 49 ||||||||||||||| |||||||| Sbjct: 271 ccgtctcccgccccagcgtcttcc 294
>emb|AJ342112.1|HSA342112 Homo sapiens genomic sequence surrounding NotI site, clone NL4-CL21C Length = 722 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 ccgtctcccgccccaccgtcttcc 49 ||||||||||||||| |||||||| Sbjct: 271 ccgtctcccgccccagcgtcttcc 294
>emb|AJ340172.1|HSA340172 Homo sapiens genomic sequence surrounding NotI site, clone NR5-GG20C Length = 722 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 ccgtctcccgccccaccgtcttcc 49 ||||||||||||||| |||||||| Sbjct: 271 ccgtctcccgccccagcgtcttcc 294
>emb|AJ339912.1|HSA339912 Homo sapiens genomic sequence surrounding NotI site, clone NR5-FG5C Length = 844 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 ccgtctcccgccccaccgtcttcc 49 ||||||||||||||| |||||||| Sbjct: 271 ccgtctcccgccccagcgtcttcc 294
>gb|AY106278.1| Zea mays PCO137999 mRNA sequence Length = 1382 Score = 40.1 bits (20), Expect = 8.7 Identities = 50/60 (83%) Strand = Plus / Plus Query: 127 ctggggctgttgcccacttgagggtgctacctgctgcgatgatcactacagctgctgccc 186 ||||||||| ||||| | ||||| || ||||||||| | |||||| |||||||||||| Sbjct: 984 ctggggctgctgcccggtcgagggcgccacctgctgcaaggatcacgccagctgctgccc 1043
>gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1097_A12, complete sequence Length = 88725 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 281 tgatgtcatgtaaatctctagcaa 304 |||||||||| ||||||||||||| Sbjct: 6972 tgatgtcatgcaaatctctagcaa 6949
>gb|M61861.1|CHKBGB Chicken B-G mRNA, complete cds Length = 2080 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 ctacagctgctgccctcata 191 |||||||||||||||||||| Sbjct: 22 ctacagctgctgccctcata 41
>gb|L10351.1|CELTWIMUSC Caenorhabditis elegans gene, exons 1 through 31 Length = 54962 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 258 gttttcttcaattaatgtggttat 281 |||||||||||||||| ||||||| Sbjct: 28434 gttttcttcaattaatttggttat 28457 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,833,245 Number of Sequences: 3902068 Number of extensions: 4833245 Number of successful extensions: 96346 Number of sequences better than 10.0: 118 Number of HSP's better than 10.0 without gapping: 118 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95707 Number of HSP's gapped (non-prelim): 637 length of query: 636 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 613 effective length of database: 17,143,297,704 effective search space: 10508841492552 effective search space used: 10508841492552 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
