ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal6b13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK103487.1| Oryza sativa (japonica cultivar-group) cDNA clon... 636 e-179
2dbj|AK059521.1| Oryza sativa (japonica cultivar-group) cDNA clon... 636 e-179
3dbj|AB026561.1| Oryza sativa (japonica cultivar-group) OsPAE1 mR... 636 e-179
4gb|BT017253.1| Zea mays clone EL01N0307H03.c mRNA sequence 579 e-162
5gb|BT019190.1| Zea mays clone Contig862.F mRNA sequence 555 e-155
6gb|BT017580.1| Zea mays clone EL01N0429D12.c mRNA sequence 323 4e-85
7gb|AY110522.1| Zea mays CL4677_2 mRNA sequence 274 3e-70
8gb|AF255338.1|AF255338 Glycine max 20S proteasome subunit mRNA, ... 268 2e-68
9ref|NM_104262.1| Arabidopsis thaliana PAE1; endopeptidase/ pepti... 252 1e-63
10gb|AY114616.1| Arabidopsis thaliana 20S proteasome subunit PAE1 ... 252 1e-63
11gb|AY072371.1| Arabidopsis thaliana 20S proteasome subunit PAE1 ... 252 1e-63
12gb|AY086045.1| Arabidopsis thaliana clone 20801 mRNA, complete s... 252 1e-63
13ref|NM_112287.2| Arabidopsis thaliana PAE2; endopeptidase/ pepti... 250 5e-63
14gb|AY062970.1| Arabidopsis thaliana putative 20S proteasome subu... 250 5e-63
15gb|AF370245.1| Arabidopsis thaliana putative 20S proteasome subu... 250 5e-63
16emb|BX823159.1|CNS0A658 Arabidopsis thaliana Full-length cDNA Co... 250 5e-63
17emb|BX822992.1|CNS0A648 Arabidopsis thaliana Full-length cDNA Co... 250 5e-63
18gb|AF043525.1|AF043525 Arabidopsis thaliana 20S proteasome subun... 250 5e-63
19gb|AF043524.1|AF043524 Arabidopsis thaliana 20S proteasome subun... 244 3e-61
20emb|BX822092.1|CNS0A644 Arabidopsis thaliana Full-length cDNA Co... 236 7e-59
21gb|BT014224.1| Lycopersicon esculentum clone 133419F, mRNA sequence 224 3e-55
22emb|BX822457.1|CNS0A63I Arabidopsis thaliana Full-length cDNA Co... 218 2e-53
23gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome... 165 2e-37
24dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
25gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 165 2e-37
26emb|AJ291735.1|NTA291735 Nicotiana tabacum partial mRNA for puta... 147 5e-32
27dbj|AK220949.1| Arabidopsis thaliana mRNA for hypothetical prote... 145 2e-31
28emb|AJ418041.1|PPA418041 Physcomitrella patens mRNA for 20S prot... 131 3e-27
29emb|BX824071.1|CNS0A5L7 Arabidopsis thaliana Full-length cDNA Co... 100 1e-17
30emb|BX063332.1|CNS09L14 Single read from an extremity of a full-... 94 7e-16
31emb|BX062751.1|CNS09KKZ Single read from an extremity of a full-... 94 7e-16
32emb|BX056699.1|CNS09FWV Single read from an extremity of a full-... 94 7e-16
33emb|BX031436.1|CNS08WF4 Single read from an extremity of a full-... 94 7e-16
34emb|BX019821.1|CNS08NGH Single read from an extremity of a full-... 94 7e-16
35emb|BX017936.1|CNS08M04 Single read from an extremity of a full-... 94 7e-16
36emb|BX018241.1|CNS08M8L Single read from an extremity of a full-... 94 7e-16
37emb|BX015753.1|CNS08KBH Single read from an extremity of a full-... 94 7e-16
38emb|BX011882.1|CNS08HBY Single read from an extremity of a full-... 94 7e-16
39emb|BX011202.1|CNS08GT2 Single read from an extremity of a full-... 94 7e-16
40emb|BX010636.1|CNS08GDC Single read from an extremity of a full-... 94 7e-16
41emb|BX009604.1|CNS08FKO Single read from an extremity of a full-... 94 7e-16
42ref|XM_314945.2| Anopheles gambiae str. PEST ENSANGP00000019329 ... 94 7e-16
43gb|DQ214008.1| Taeniopygia guttata clone 0064P0007F03 proteasome... 92 3e-15
44gb|AC009324.2| Arabidopsis thaliana chromosome I BAC T18A20 geno... 88 4e-14
45ref|NM_001031407.1| Gallus gallus proteasome (prosome, macropain... 86 2e-13
46emb|BX066418.1|CNS09NEU Single read from an extremity of a full-... 86 2e-13
47emb|AJ720305.1| Gallus gallus mRNA for hypothetical protein, clo... 86 2e-13
48emb|CR386956.1| Gallus gallus finished cDNA, clone ChEST102f7 86 2e-13
49gb|DQ214009.1| Taeniopygia guttata clone 0061P0007F09 proteasome... 84 6e-13
50emb|BX011881.1|CNS08HBX Single read from an extremity of a full-... 82 3e-12
51dbj|AB022220.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 82 3e-12
52ref|XM_956973.1| Neurospora crassa OR74A hypothetical protein (N... 78 4e-11
53ref|XM_324651.1| Neurospora crassa OR74A hypothetical protein (N... 78 4e-11
54gb|AY232148.1| Drosophila yakuba clone yak-ad_ProsMA5 mRNA sequence 74 6e-10
55ref|XM_367205.1| Magnaporthe grisea 70-15 hypothetical protein (... 70 1e-08
56ref|XM_386335.1| Gibberella zeae PH-1 chromosome 3 conserved hyp... 70 1e-08
57ref|NM_166221.2| Drosophila melanogaster Proteasome subunit CG1... 66 2e-07
58ref|NM_057854.3| Drosophila melanogaster Proteasome subunit CG1... 66 2e-07
59gb|AY061404.1| Drosophila melanogaster LD33318 full length cDNA 66 2e-07
60gb|AC009535.9| Drosophila melanogaster, chromosome 2R, region 54... 66 2e-07
61gb|AC008004.5|AC008004 Drosophila melanogaster, chromosome 2R, r... 66 2e-07
62gb|AY104937.1| Zea mays PCO082324 mRNA sequence 66 2e-07
63gb|AE003803.4| Drosophila melanogaster chromosome 2R, section 47... 66 2e-07
64gb|U64721.1|DMU64721 Drosophila melanogaster 20S proteasome alph... 66 2e-07
65gb|BT017945.1| Zea mays clone EL01N0521D09.c mRNA sequence 64 6e-07
66ref|XM_464030.1| Oryza sativa (japonica cultivar-group), mRNA 62 2e-06
67dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
68dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
69dbj|AK109376.2| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
70dbj|AP004799.3| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
71dbj|AK103646.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
72dbj|D37886.1|RICPC2SA Rice mRNA for proteasome C2 subunit, compl... 62 2e-06
73ref|XM_750383.1| Aspergillus fumigatus Af293 proteasome componen... 60 9e-06
74emb|BX063333.1|CNS09L15 Single read from an extremity of a full-... 60 9e-06
75dbj|AK099876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 9e-06
76gb|AF424643.1| Phytophthora infestans clone MY-03-E-06 proteasom... 58 4e-05
77gb|AY431444.1| Aedes aegypti ASAP ID: 43014 proteasome endopepti... 56 1e-04
78gb|DQ440413.1| Aedes aegypti clone AET-5533 20S proteasome regul... 56 1e-04
79gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
80ref|XM_757040.1| Ustilago maydis 521 hypothetical protein (UM059... 52 0.002
81ref|XM_757288.1| Ustilago maydis 521 hypothetical protein (UM062... 52 0.002
82emb|BX017937.1|CNS08M05 Single read from an extremity of a full-... 50 0.009
83ref|NM_185696.1| Oryza sativa (japonica cultivar-group), Ozsa804... 48 0.036
84ref|NM_185686.1| Oryza sativa (japonica cultivar-group), Ozsa803... 48 0.036
85gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.036
86ref|XM_572324.1| Cryptococcus neoformans var. neoformans JEC21 p... 48 0.036
87emb|X52319.1|DMPROS29 Fruit fly mRNA for proteosome subunit 48 0.036
88ref|NM_057343.3| Drosophila melanogaster Proteasome 29kD subunit... 48 0.036
89gb|AY084140.1| Drosophila melanogaster RE23862 full insert cDNA 48 0.036
90gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.036
91dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.036
92gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, r... 48 0.036
93dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.036
94ref|NM_211639.1| Eremothecium gossypii AGL089Wp (AGL089W), mRNA 48 0.036
95dbj|AK059984.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.036
96gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60... 48 0.036
97gb|AC005268.1|AC005268 Drosophila melanogaster DNA sequence (P1s... 48 0.036
98dbj|AB026560.1| Oryza sativa (japonica cultivar-group) OsPAC1 mR... 48 0.036
99gb|BT016493.1| Zea mays clone Contig326 mRNA sequence 46 0.14
100emb|AJ293343.1|ZMA293343 Zea mays mRNA for maize 20S proteasome ... 46 0.14
101emb|BX062752.1|CNS09KL0 Single read from an extremity of a full-... 46 0.14
102dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
103dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
104dbj|AP006067.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
105gb|AY107760.1| Zea mays PCO113667 mRNA sequence 46 0.14
106gb|AY104377.1| Zea mays PCO108605 mRNA sequence 46 0.14
107dbj|AB032061.1| Oryza sativa (japonica cultivar-group) OsPAD1 mR... 46 0.14
108ref|XM_463746.1| Oryza sativa (japonica cultivar-group), predic... 44 0.56
109ref|XM_817190.1| Trypanosoma brucei TREU927 proteasome subunit a... 44 0.56
110gb|AC135114.4| Mus musculus BAC clone RP24-69H7 from chromosome ... 44 0.56
111dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
112dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
113gb|AF210324.1|AF210324 Oryza sativa clone C26554 UMP synthase (U... 44 0.56
114gb|AF210323.1|AF210323 Oryza sativa clone C26785 UMP synthase (U... 44 0.56
115gb|AF140353.1|AF140353 Trypanosoma brucei brucei 20S proteasome ... 44 0.56
116dbj|AK069565.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.56
117dbj|AB031395.1| Oryza sativa (japonica cultivar-group) mRNA for ... 44 0.56
118gb|AE010335.1| Methanopyrus kandleri AV19 section 34 of 157 of t... 42 2.2
119gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 2.2
120ref|XM_658384.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 2.2
121ref|XM_804684.1| Trypanosoma cruzi strain CL Brener proteasome a... 42 2.2
122ref|XM_797774.1| Trypanosoma cruzi strain CL Brener proteasome a... 42 2.2
123gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 2.2
124emb|AL160290.15| Human DNA sequence from clone RP11-338O1 on chr... 42 2.2
125ref|XM_963562.1| PREDICTED: Tribolium castaneum similar to prote... 42 2.2
126emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... 42 2.2
127dbj|AB225066.1| Aspergillus oryzae cDNA, contig sequence: AoEST1917 42 2.2
128gb|AY184356.1| Gasterosteus aculeatus proteasome subunit alpha 3... 42 2.2
129gb|AC112259.4| Mus musculus BAC clone RP23-179F7 from 12, comple... 42 2.2
130gb|U75302.1|TCU75302 Trypanosoma cruzi 29 kDa proteasome subunit... 42 2.2
131gb|U73851.1|TCU73851 Trypanosoma cruzi 29 kDa proteasome subunit... 42 2.2
132dbj|AB045320.1| Homo sapiens genomic DNA, chromosome 10q25-q26, ... 42 2.2
133ref|NM_105712.1| Arabidopsis thaliana SRO3 AT1G70440 (SRO3) mRNA... 40 8.7
134gb|DQ088635.1| Tramitichromis intermedius putative green sensiti... 40 8.7
135gb|DQ088632.1| Tramitichromis intermedius putative green sensiti... 40 8.7
136gb|DQ088631.1| Melanochromis vermivorus putative green sensitive... 40 8.7
137gb|DQ088630.1| Pseudotropheus acei putative green sensitive visu... 40 8.7
138gb|DQ088651.1| Synthetic construct green sensitive visual pigmen... 40 8.7
139ref|NM_185665.2| Oryza sativa (japonica cultivar-group), mRNA 40 8.7
140ref|XM_514406.1| PREDICTED: Pan troglodytes similar to vacuolar ... 40 8.7
141gb|BT016358.1| Zea mays clone Contig191 mRNA sequence 40 8.7
142gb|AF030453.1| Homo sapiens chromosome 7 clone PAC 76h2 map 7q22... 40 8.7
143gb|AF024533.1| Homo sapiens cosmid 123E15, complete sequence 40 8.7
144gb|AC105169.9| Mus musculus chromosome 10, clone RP24-124K4, com... 40 8.7
145ref|NM_148976.1| Homo sapiens proteasome (prosome, macropain) su... 40 8.7
146ref|NM_002786.2| Homo sapiens proteasome (prosome, macropain) su... 40 8.7
147gb|AY558511.1| Saccharomyces cerevisiae clone FLH003175.01X YGR2... 40 8.7
148gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger prote... 40 8.7
149emb|CR727970.2|CNS0GONC Tetraodon nigroviridis full-length cDNA 40 8.7
150emb|CR727498.2|CNS0GOA8 Tetraodon nigroviridis full-length cDNA 40 8.7
151emb|CR727201.2|CNS0GO1Z Tetraodon nigroviridis full-length cDNA 40 8.7
152emb|CR725216.2|CNS0GMIU Tetraodon nigroviridis full-length cDNA 40 8.7
153emb|CR705071.2|CNS0G6ZF Tetraodon nigroviridis full-length cDNA 40 8.7
154emb|CR704698.2|CNS0G6P2 Tetraodon nigroviridis full-length cDNA 40 8.7
155emb|CR700470.2|CNS0G3FM Tetraodon nigroviridis full-length cDNA 40 8.7
156emb|CR699896.2|CNS0G2ZO Tetraodon nigroviridis full-length cDNA 40 8.7
157emb|CR698069.2|CNS0G1KX Tetraodon nigroviridis full-length cDNA 40 8.7
158emb|CR697897.1|CNS0G1G5 Tetraodon nigroviridis full-length cDNA 40 8.7
159emb|CR694814.2|CNS0FZ2I Tetraodon nigroviridis full-length cDNA 40 8.7
160emb|CR692623.2|CNS0FXDN Tetraodon nigroviridis full-length cDNA 40 8.7
161emb|CR685960.2|CNS0FS8K Tetraodon nigroviridis full-length cDNA 40 8.7
162emb|CR688259.2|CNS0FU0F Tetraodon nigroviridis full-length cDNA 40 8.7
163emb|CR688135.1|CNS0FTWZ Tetraodon nigroviridis full-length cDNA 40 8.7
164emb|CR681238.2|CNS0FOLE Tetraodon nigroviridis full-length cDNA 40 8.7
165emb|CR679103.2|CNS0FMY3 Tetraodon nigroviridis full-length cDNA 40 8.7
166emb|CR678237.2|CNS0FMA9 Tetraodon nigroviridis full-length cDNA 40 8.7
167emb|CR677793.2|CNS0FLY1 Tetraodon nigroviridis full-length cDNA 40 8.7
168emb|CR676703.2|CNS0FL3V Tetraodon nigroviridis full-length cDNA 40 8.7
169emb|CR675798.2|CNS0FKF0 Tetraodon nigroviridis full-length cDNA 40 8.7
170emb|CR673260.2|CNS0FIGI Tetraodon nigroviridis full-length cDNA 40 8.7
171emb|CR672112.2|CNS0FHKM Tetraodon nigroviridis full-length cDNA 40 8.7
172emb|CR672105.2|CNS0FHKF Tetraodon nigroviridis full-length cDNA 40 8.7
173emb|CR671749.2|CNS0FHAJ Tetraodon nigroviridis full-length cDNA 40 8.7
174emb|CR671990.2|CNS0FHH8 Tetraodon nigroviridis full-length cDNA 40 8.7
175emb|CR671579.2|CNS0FH5T Tetraodon nigroviridis full-length cDNA 40 8.7
176emb|CR670122.2|CNS0FG1C Tetraodon nigroviridis full-length cDNA 40 8.7
177emb|CR668423.2|CNS0FEQ5 Tetraodon nigroviridis full-length cDNA 40 8.7
178emb|CR667949.2|CNS0FECZ Tetraodon nigroviridis full-length cDNA 40 8.7
179emb|CR664328.2|CNS0FBKE Tetraodon nigroviridis full-length cDNA 40 8.7
180emb|CR661379.2|CNS0F9AH Tetraodon nigroviridis full-length cDNA 40 8.7
181emb|CR658674.1|CNS0F77C Tetraodon nigroviridis full-length cDNA 40 8.7
182emb|CR646148.2|CNS0EXJE Tetraodon nigroviridis full-length cDNA 40 8.7
183gb|U40413.2| Caenorhabditis elegans cosmid C18B2, complete sequence 40 8.7
184gb|AC144389.22| Medicago truncatula clone mth2-25e14, complete s... 40 8.7
185gb|DQ124327.1| Tribalister striatellus isolate extract MSC132 cy... 40 8.7
186emb|BX682532.4| Human DNA sequence from clone WI2-801539E12 on c... 40 8.7
187ref|XM_501939.1| Yarrowia lipolytica CLIB122, YALI0C17325g predi... 40 8.7
188ref|NM_015378.2| Homo sapiens vacuolar protein sorting 13 homolo... 40 8.7
189ref|NM_018156.2| Homo sapiens vacuolar protein sorting 13 homolo... 40 8.7
190ref|XM_961880.1| PREDICTED: Tribolium castaneum similar to prote... 40 8.7
191emb|X99228.1|SCCHRVII S.cerevisiae genomic sequence from chromos... 40 8.7
192emb|X73293.1|MVRPO M.vannielii genes rpoH, rpoB and rpoA 40 8.7
193emb|X61969.1|HSMPNU H.sapiens mRNA for macropain subunit nu 40 8.7
194gb|AY993505.1| Uncultured bacterium clone C19_C20 16S ribosomal ... 40 8.7
195gb|AY990789.1| Uncultured bacterium clone C4_G011 16S ribosomal ... 40 8.7
196gb|BC022372.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
197gb|BC009576.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
198gb|BC015105.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
199gb|BC015356.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
200gb|BC002577.2| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
201gb|BC008472.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
202gb|BC005932.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
203gb|BT008064.1| Synthetic construct Homo sapiens proteasome (pros... 40 8.7
204gb|BT006647.1| Homo sapiens proteasome (prosome, macropain) subu... 40 8.7
205emb|X64918.1|SCPUP2A S.cerevisiae PUP2 gene 40 8.7
206emb|AJ608775.1| Homo sapiens mRNA for VPS13D protein, transcript... 40 8.7
207emb|AJ608774.1| Homo sapiens mRNA for VPS13D protein, transcript... 40 8.7
208emb|CR623849.1| full-length cDNA clone CS0DA006YP22 of Neuroblas... 40 8.7
209dbj|AK125118.1| Homo sapiens cDNA FLJ43128 fis, clone CTONG3005325 40 8.7
210emb|CR620774.1| full-length cDNA clone CS0DI030YJ03 of Placenta ... 40 8.7
211emb|CR617103.1| full-length cDNA clone CS0DI052YO22 of Placenta ... 40 8.7
212emb|CR612800.1| full-length cDNA clone CS0DA012YD16 of Neuroblas... 40 8.7
213emb|CR610121.1| full-length cDNA clone CS0DI083YG05 of Placenta ... 40 8.7
214emb|CR607472.1| full-length cDNA clone CS0DB001YP20 of Neuroblas... 40 8.7
215emb|CR607412.1| full-length cDNA clone CS0DE014YI10 of Placenta ... 40 8.7
216emb|CR599736.1| full-length cDNA clone CS0DK007YL19 of HeLa cell... 40 8.7
217emb|CR599649.1| full-length cDNA clone CS0DI069YC24 of Placenta ... 40 8.7
218emb|CR598938.1| full-length cDNA clone CS0DI075YJ10 of Placenta ... 40 8.7
219emb|CR597642.1| full-length cDNA clone CL0BB027ZF05 of Neuroblas... 40 8.7
220dbj|AK001481.1| Homo sapiens cDNA FLJ10619 fis, clone NT2RP2005472 40 8.7
221gb|AF155766.1| Pisum sativum clone Psat27-29 repetitive sequence 40 8.7
222gb|DQ311211.1| Bombyx mori proteasome zeta subunit mRNA, complet... 40 8.7
223gb|AC150443.2| Medicago truncatula chromosome 7 BAC clone mth2-7... 40 8.7
224gb|AF247124.1|AF247124 Oreochromis niloticus putative green sens... 40 8.7
225ref|NM_076219.3| Caenorhabditis elegans C18B2.4 (C18B2.4) mRNA, ... 40 8.7
226emb|AL113369.1|CNS01ATD Botrytis cinerea strain T4 cDNA library 40 8.7
227dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
228gb|AY775092.1| Lethrinops parvidens cone opsin (RH2) gene, compl... 40 8.7
229gb|AY775090.1| Aulonocara hueseri cone opsin (RH2) gene, complet... 40 8.7
230gb|AY775089.1| Tropheus duboisi cone opsin (RH2) gene, complete cds 40 8.7
231gb|AY775070.1| Stigmatochromis modestus cone opsin (RH2) mRNA, c... 40 8.7
232gb|AY775068.1| Neolamprologus brichardi cone opsin (RH2) mRNA, c... 40 8.7
233gb|AY775067.1| Ophthalmotilapia ventralis cone opsin (RH2) mRNA,... 40 8.7
234gb|AC010967.3| Homo sapiens BAC clone RP11-7H13 from 2, complete... 40 8.7
235dbj|AP002864.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
236dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
237dbj|AP003808.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
238gb|AY892634.1| Synthetic construct Homo sapiens clone FLH015536.... 40 8.7
239gb|AY890152.1| Synthetic construct Homo sapiens clone FLH015541.... 40 8.7
240gb|AY890151.1| Synthetic construct Homo sapiens clone FLH015540.... 40 8.7
241emb|BX641035.1|HSM806688 Homo sapiens mRNA; cDNA DKFZp686D20110 ... 40 8.7
242dbj|AB007922.3| Homo sapiens mRNA for KIAA0453 protein, partial cds 40 8.7
243ref|NM_211393.1| Eremothecium gossypii AGL336Wp (AGL336W), mRNA 40 8.7
244dbj|AK067977.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.7
245gb|AY107786.1| Zea mays PCO106817 mRNA sequence 40 8.7
246emb|Z73038.1|SCYGR253C S.cerevisiae chromosome VII reading frame... 40 8.7
247dbj|D00759.1|HUMPSC2 Homo sapiens mRNA for proteasome subunit C2... 40 8.7
248emb|AL589986.15| Human DNA sequence from clone RP11-107M16 on ch... 40 8.7
249gb|AC003671.1|F17O7 Arabidopsis thaliana chromosome 1 BAC F17O7 ... 40 8.7
250emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 8.7
251gb|U73850.1|TCU73850 Trypanosoma cruzi 29 kDa proteasome subunit... 40 8.7
252gb|M64992.1|HUMPROS30 Human prosomal protein P30-33K (pros-30) m... 40 8.7
253emb|AL445229.12| Human DNA sequence from clone RP5-1190M18 on ch... 40 8.7
254emb|AL671923.15| Mouse DNA sequence from clone RP23-322C16 on ch... 40 8.7

>dbj|AK103487.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033130M12, full
           insert sequence
          Length = 1188

 Score =  636 bits (321), Expect = e-179
 Identities = 462/508 (90%), Gaps = 1/508 (0%)
 Strand = Plus / Plus

                                                                       
Query: 120 gatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccggaggggcg 179
           |||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 193 gatgttcctcacgaggacggagtacgaccgcggggtgaacaccttctccccggaggggcg 252

                                                                       
Query: 180 gctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgccatcggctt 239
           | |||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 253 gttgttccaggtcgagtacgccattgaggccatcaagttggggtcaactgcgatcgggtt 312

                                                                       
Query: 240 gatgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgctgctgga 299
           || ||| ||| ||||||||||||| ||||| |||||||| || ||||| || ||||||||
Sbjct: 313 gaagaccaaggatggtgttgtccttgctgtagagaaacgtgtgacctcgccactgctgga 372

                                                                       
Query: 300 acctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtgg 359
           ||| ||||||||||||||||||||||||||||| |||||  | |||||||| ||||||||
Sbjct: 373 accaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgagtgg 432

                                                                       
Query: 360 ccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcatag 419
           |||||||||||| || |||||| | ||||||||||||||||| || || |||||||||||
Sbjct: 433 ccttattgctgatgctagaacattggttgagcatgctcgtgttgaaacccagaatcatag 492

                                                                       
Query: 420 gttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggc 479
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 493 gttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgacttagc 552

                                                                       
Query: 480 tttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctcct 539
           | |||| |||||||||||||||||||| || |||||||| || ||||| |||||||||||
Sbjct: 553 tctgcgttttggtgaaggtgatgaagagtcgatgtcacgaccatttggtgtctctctcct 612

                                                                       
Query: 540 tattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgggaccct 599
           |||||||||||||||||| ||||||||||||||||||||||| ||||||||  ||| |||
Sbjct: 613 tattgctggtcatgatgagaatggacccagcttgtactacactgacccatc-aggaacct 671

                                       
Query: 600 tctggcagtgcaatgccaaggcaattgg 627
           | ||||||||||||||||||||||||||
Sbjct: 672 tttggcagtgcaatgccaaggcaattgg 699



to top

>dbj|AK059521.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C07, full
           insert sequence
          Length = 1056

 Score =  636 bits (321), Expect = e-179
 Identities = 462/508 (90%), Gaps = 1/508 (0%)
 Strand = Plus / Plus

                                                                       
Query: 120 gatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccggaggggcg 179
           |||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 88  gatgttcctcacgaggacggagtacgaccgcggggtgaacaccttctccccggaggggcg 147

                                                                       
Query: 180 gctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgccatcggctt 239
           | |||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 148 gttgttccaggtcgagtacgccattgaggccatcaagttggggtcaactgcgatcgggtt 207

                                                                       
Query: 240 gatgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgctgctgga 299
           || ||| ||| ||||||||||||| ||||| |||||||| || ||||| || ||||||||
Sbjct: 208 gaagaccaaggatggtgttgtccttgctgtagagaaacgtgtgacctcgccactgctgga 267

                                                                       
Query: 300 acctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtgg 359
           ||| ||||||||||||||||||||||||||||| |||||  | |||||||| ||||||||
Sbjct: 268 accaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgagtgg 327

                                                                       
Query: 360 ccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcatag 419
           |||||||||||| || |||||| | ||||||||||||||||| || || |||||||||||
Sbjct: 328 ccttattgctgatgctagaacattggttgagcatgctcgtgttgaaacccagaatcatag 387

                                                                       
Query: 420 gttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggc 479
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 388 gttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgacttagc 447

                                                                       
Query: 480 tttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctcct 539
           | |||| |||||||||||||||||||| || |||||||| || ||||| |||||||||||
Sbjct: 448 tctgcgttttggtgaaggtgatgaagagtcgatgtcacgaccatttggtgtctctctcct 507

                                                                       
Query: 540 tattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgggaccct 599
           |||||||||||||||||| ||||||||||||||||||||||| ||||||||  ||| |||
Sbjct: 508 tattgctggtcatgatgagaatggacccagcttgtactacactgacccatc-aggaacct 566

                                       
Query: 600 tctggcagtgcaatgccaaggcaattgg 627
           | ||||||||||||||||||||||||||
Sbjct: 567 tttggcagtgcaatgccaaggcaattgg 594



to top

>dbj|AB026561.1| Oryza sativa (japonica cultivar-group) OsPAE1 mRNA for alpha 5
           subunit of 20S proteasome, complete cds
          Length = 1056

 Score =  636 bits (321), Expect = e-179
 Identities = 462/508 (90%), Gaps = 1/508 (0%)
 Strand = Plus / Plus

                                                                       
Query: 120 gatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccggaggggcg 179
           |||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 93  gatgttcctcacgaggacggagtacgaccgcggggtgaacaccttctccccggaggggcg 152

                                                                       
Query: 180 gctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgccatcggctt 239
           | |||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 153 gttgttccaggtcgagtacgccattgaggccatcaagttggggtcaactgcgatcgggtt 212

                                                                       
Query: 240 gatgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgctgctgga 299
           || ||| ||| ||||||||||||| ||||| |||||||| || ||||| || ||||||||
Sbjct: 213 gaagaccaaggatggtgttgtccttgctgtagagaaacgtgtgacctcgccactgctgga 272

                                                                       
Query: 300 acctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtgg 359
           ||| ||||||||||||||||||||||||||||| |||||  | |||||||| ||||||||
Sbjct: 273 accaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgagtgg 332

                                                                       
Query: 360 ccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcatag 419
           |||||||||||| || |||||| | ||||||||||||||||| || || |||||||||||
Sbjct: 333 ccttattgctgatgctagaacattggttgagcatgctcgtgttgaaacccagaatcatag 392

                                                                       
Query: 420 gttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggc 479
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 393 gttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgacttagc 452

                                                                       
Query: 480 tttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctcct 539
           | |||| |||||||||||||||||||| || |||||||| || ||||| |||||||||||
Sbjct: 453 tctgcgttttggtgaaggtgatgaagagtcgatgtcacgaccatttggtgtctctctcct 512

                                                                       
Query: 540 tattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgggaccct 599
           |||||||||||||||||| ||||||||||||||||||||||| ||||||||  ||| |||
Sbjct: 513 tattgctggtcatgatgagaatggacccagcttgtactacactgacccatc-aggaacct 571

                                       
Query: 600 tctggcagtgcaatgccaaggcaattgg 627
           | ||||||||||||||||||||||||||
Sbjct: 572 tttggcagtgcaatgccaaggcaattgg 599



to top

>gb|BT017253.1| Zea mays clone EL01N0307H03.c mRNA sequence
          Length = 1104

 Score =  579 bits (292), Expect = e-162
 Identities = 463/519 (89%), Gaps = 1/519 (0%)
 Strand = Plus / Plus

                                                                       
Query: 121 atgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccggaggggcgg 180
           ||||| ||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 197 atgtttctcacgaggacggagtacgaccgcggggtgaacaccttctcgccggaggggcgg 256

                                                                       
Query: 181 ctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgccatcggcttg 240
           ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 257 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatccactgcgatcgggttg 316

                                                                       
Query: 241 atgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgctgctggaa 300
           |  || ||| ||||||||||||| |||||||||||||| || ||||| || |||||||||
Sbjct: 317 aaaacaaaggatggtgttgtccttgctgttgagaaacgtgtgacctcgccactgctggaa 376

                                                                       
Query: 301 cctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggc 360
           || ||||||||||| |||||||||||||||||||||||  | |||||||| |||||||| 
Sbjct: 377 ccaagcagtgtggaaaaaatcatggaaattgatgagcacataggctgtgccatgagtggg 436

                                                                       
Query: 361 cttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcatagg 420
           ||||||||||| || |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 437 cttattgctgatgctagaacactagtcgagcatgctcgtgttgaaactcagaatcatagg 496

                                                                       
Query: 421 ttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggct 480
           |||||||| |||||||||||||| ||||||||| | ||||||||||| |||||||| |||
Sbjct: 497 ttctcatacggggagccaatgaccgtagaatcttcaacacaagctatttgtgacttagct 556

                                                                       
Query: 481 ttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctcctt 540
            |||||||||| |||||||| ||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 557 ctgcgctttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctctccta 616

                                                                       
Query: 541 attgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgggaccctt 600
           |||||||| || ||||| |||||||| ||| |||||||||| ||||||||||| | | ||
Sbjct: 617 attgctggacacgatgagaatggacctagcctgtactacaccgacccatctggta-cttt 675

                                                  
Query: 601 ctggcagtgcaatgccaaggcaattgggtcgggctctga 639
            ||||| ||||| || ||||||||||| || ||||||||
Sbjct: 676 ttggcaatgcaacgcgaaggcaattggatctggctctga 714



to top

>gb|BT019190.1| Zea mays clone Contig862.F mRNA sequence
          Length = 1161

 Score =  555 bits (280), Expect = e-155
 Identities = 457/515 (88%), Gaps = 1/515 (0%)
 Strand = Plus / Minus

                                                                        
Query: 113  ccgacacgatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccgg 172
            |||||| |||||| ||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 1063 ccgacaggatgtttctcacgaggacggagtacgaccgtggggtgaacaccttctctccgg 1004

                                                                        
Query: 173  aggggcggctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgcca 232
            ||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||| |
Sbjct: 1003 aggggcggctgttcccggtcgagtacgccctcgaggccatcaagttgggatccactgcga 944

                                                                        
Query: 233  tcggcttgatgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgc 292
            |||| |||| ||| ||| ||||||||||||| || ||||||||||| || |||||||| |
Sbjct: 943  tcggtttgaagacaaaggatggtgttgtcctcgccgttgagaaacgtgtgacctcacccc 884

                                                                        
Query: 293  tgctggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaa 352
            |||||||||| ||||||||||| ||||| |||||||||||||||||  | |||||||| |
Sbjct: 883  tgctggaaccaagcagtgtggaaaaaataatggaaattgatgagcacataggctgtgcca 824

                                                                        
Query: 353  tgagtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcaga 412
            ||||||| ||||||||||| || |||||||| || || ||||||||||| || |||||||
Sbjct: 823  tgagtggacttattgctgatgctagaacactagtggaacatgctcgtgttgaaactcaga 764

                                                                        
Query: 413  atcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtg 472
            |||||||||||||||| || ||||||||||| ||||||||| | ||||||||||||||||
Sbjct: 763  atcataggttctcatacggagagccaatgactgtagaatcttcgacacaagctatctgtg 704

                                                                        
Query: 473  acttggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtct 532
            |||| ||| |||| ||||| |||||||| ||||| |||||||||||||| ||||||||||
Sbjct: 703  acttagctctgcgttttggcgaaggtgacgaagagtcaatgtcacggccatttggagtct 644

                                                                        
Query: 533  ctctccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctg 592
            ||||||| |||||||| |||||||| |||||||| ||| |||||||||| || |||||||
Sbjct: 643  ctctcctaattgctggacatgatgagaatggacctagcctgtactacactgatccatctg 584

                                               
Query: 593  ggacccttctggcagtgcaatgccaaggcaattgg 627
            | | | || ||||| ||||| || |||||||||||
Sbjct: 583  gta-cattttggcaatgcaacgcaaaggcaattgg 550



to top

>gb|BT017580.1| Zea mays clone EL01N0429D12.c mRNA sequence
          Length = 1354

 Score =  323 bits (163), Expect = 4e-85
 Identities = 290/331 (87%), Gaps = 1/331 (0%)
 Strand = Plus / Plus

                                                                       
Query: 297 ggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgag 356
           |||||| ||||||||||| ||||| |||||||||||||||||  | |||||||| |||||
Sbjct: 583 ggaaccaagcagtgtggaaaaaataatggaaattgatgagcacataggctgtgccatgag 642

                                                                       
Query: 357 tggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatca 416
           ||| ||||||||||| || |||||||| || || ||||||||||| || |||||||||||
Sbjct: 643 tggacttattgctgatgctagaacactagtggaacatgctcgtgttgaaactcagaatca 702

                                                                       
Query: 417 taggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgactt 476
           |||||||||||| || ||||||||||| ||||||||| | ||||||||||||||||||||
Sbjct: 703 taggttctcatacggagagccaatgactgtagaatcttcgacacaagctatctgtgactt 762

                                                                       
Query: 477 ggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctct 536
            ||| |||| ||||| |||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 763 agctctgcgttttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctct 822

                                                                       
Query: 537 ccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgggac 596
           ||| |||||||| |||||||| |||||||| ||| |||||||||| || |||||||| | 
Sbjct: 823 cctaattgctggacatgatgagaatggacctagcctgtactacactgatccatctggta- 881

                                          
Query: 597 ccttctggcagtgcaatgccaaggcaattgg 627
           | || ||||| ||||| || |||||||||||
Sbjct: 882 cattttggcaatgcaacgcaaaggcaattgg 912



to top

>gb|AY110522.1| Zea mays CL4677_2 mRNA sequence
          Length = 1304

 Score =  274 bits (138), Expect = 3e-70
 Identities = 185/201 (92%)
 Strand = Plus / Plus

                                                                       
Query: 113 ccgacacgatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccgg 172
           |||||| |||||| ||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 292 ccgacaggatgtttctcacgaggacggagtacgaccgtggggtgaacaccttctctccgg 351

                                                                       
Query: 173 aggggcggctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgcca 232
           ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
Sbjct: 352 aggggcggctgttccaggtcgagtacgccatcgaggccatcaagttgggatccactgcga 411

                                                                       
Query: 233 tcggcttgatgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgc 292
           |||| |||| ||| ||| ||||||||||||| || ||||||||||| || |||||||| |
Sbjct: 412 tcggtttgaagacaaaggatggtgttgtcctcgccgttgagaaacgtgtgacctcaccac 471

                                
Query: 293 tgctggaacctagcagtgtgg 313
           |||||||||| ||||||||||
Sbjct: 472 tgctggaaccaagcagtgtgg 492



 Score =  268 bits (135), Expect = 2e-68
 Identities = 235/267 (88%), Gaps = 1/267 (0%)
 Strand = Plus / Plus

                                                                       
Query: 361 cttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcatagg 420
           ||||||||||| || |||||||| || || ||||||||||| || |||||||||||||||
Sbjct: 540 cttattgctgatgctagaacactagtggaacatgctcgtgttgaaactcagaatcatagg 599

                                                                       
Query: 421 ttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggct 480
           |||||||| || ||||||||||| ||||||||| | |||||||||||||||||||| |||
Sbjct: 600 ttctcatacggagagccaatgactgtagaatcttcgacacaagctatctgtgacttagct 659

                                                                       
Query: 481 ttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctcctt 540
            |||| ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 660 ctgcgttttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctctccta 719

                                                                       
Query: 541 attgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgggaccctt 600
           |||||||| |||||||| |||||||| ||| |||||||||| ||||||||||| | | ||
Sbjct: 720 attgctggacatgatgagaatggacctagcctgtactacactgacccatctggta-catt 778

                                      
Query: 601 ctggcagtgcaatgccaaggcaattgg 627
            ||||| ||||| || |||||||||||
Sbjct: 779 ttggcaatgcaacgcaaaggcaattgg 805



to top

>gb|AF255338.1|AF255338 Glycine max 20S proteasome subunit mRNA, complete cds
          Length = 966

 Score =  268 bits (135), Expect = 2e-68
 Identities = 389/474 (82%)
 Strand = Plus / Plus

                                                                       
Query: 120 gatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccggaggggcg 179
           |||||| ||||| ||||| ||||| ||||| || ||||||||||| || || || || ||
Sbjct: 13  gatgtttctcacaaggactgagtatgaccgaggagtcaacaccttttctcccgaaggccg 72

                                                                       
Query: 180 gctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgccatcggctt 239
             |||| ||||| ||||| || ||||| ||||||||| |||| || ||||| || || ||
Sbjct: 73  tttgtttcaggttgagtatgcaatcgaagccatcaagctgggatcaactgcgattgggtt 132

                                                                       
Query: 240 gatgactaagtatggtgttgtcctggctgttgagaaacgcgtcacctcaccgctgctgga 299
           || ||| ||  | || |||||||| || ||||| || ||| |||| || ||||| |||||
Sbjct: 133 gaagaccaaagaaggagttgtccttgcagttgaaaagcgcatcacatcgccgctcctgga 192

                                                                       
Query: 300 acctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtgg 359
            ||||| ||||| |||||||| |||||||||||||||||  | || ||||||||||||||
Sbjct: 193 gcctagtagtgttgagaaaattatggaaattgatgagcacatcggttgtgcaatgagtgg 252

                                                                       
Query: 360 ccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcatag 419
             | ||||| || ||  ||||||||||||||||||| || || || ||||||||||| ||
Sbjct: 253 gttgattgcagatgctcgaacacttgttgagcatgcacgggtggaaactcagaatcacag 312

                                                                       
Query: 420 gttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggc 479
           |||||| ||||| ||||| ||||| || || || ||||| |||||| | |||||  | ||
Sbjct: 313 gttctcctatggtgagcctatgactgttgagtccaccacccaagctctttgtgatctagc 372

                                                                       
Query: 480 tttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctcct 539
            ||||| |||||||||||||||||||| || ||||| || || |||||||| ||||||||
Sbjct: 373 cttgcgttttggtgaaggtgatgaagagtccatgtcccgaccatttggagtatctctcct 432

                                                                 
Query: 540 tattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgg 593
            ||||||||||||||||| |||||||| ||||| |||||||| || ||||||||
Sbjct: 433 cattgctggtcatgatgagaatggacctagcttatactacactgatccatctgg 486



to top

>ref|NM_104262.1| Arabidopsis thaliana PAE1; endopeptidase/ peptidase/ threonine
           endopeptidase AT1G53850 (PAE1) mRNA, complete cds
          Length = 1006

 Score =  252 bits (127), Expect = 1e-63
 Identities = 284/335 (84%), Gaps = 1/335 (0%)
 Strand = Plus / Plus

                                                                       
Query: 293 tgctggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaa 352
           |||||||||| |||||||||||||| || |||||||||||||| ||| |||| ||||| |
Sbjct: 288 tgctggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgcta 347

                                                                       
Query: 353 tgagtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcaga 412
           |||| ||  | |||||||||||  | |||||||||||||||||| | || || ||||| |
Sbjct: 348 tgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagttgaaactcaaa 407

                                                                       
Query: 413 atcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtg 472
           | ||||| ||||| ||||| ||||| ||||| ||||| || || ||||||||  | ||||
Sbjct: 408 accatagattctcgtatggtgagccgatgactgtagagtccacaacacaagcactgtgtg 467

                                                                       
Query: 473 acttggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtct 532
           |  ||||||| || ||||||||||| || |||||||||||||| |||||||||||||| |
Sbjct: 468 atctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccgtttggagtat 527

                                                                       
Query: 533 ctctccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctg 592
           |||| || |||||||| ||||||||||||||||| |||||||||||||| || || ||  
Sbjct: 528 ctcttctcattgctggccatgatgaaaatggaccaagcttgtactacactgatccttc-a 586

                                              
Query: 593 ggacccttctggcagtgcaatgccaaggcaattgg 627
           ||| | ||||||||||||||||| |||||||||||
Sbjct: 587 ggaacattctggcagtgcaatgcaaaggcaattgg 621



to top

>gb|AY114616.1| Arabidopsis thaliana 20S proteasome subunit PAE1 (At1g53850) mRNA,
           complete cds
          Length = 869

 Score =  252 bits (127), Expect = 1e-63
 Identities = 284/335 (84%), Gaps = 1/335 (0%)
 Strand = Plus / Plus

                                                                       
Query: 293 tgctggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaa 352
           |||||||||| |||||||||||||| || |||||||||||||| ||| |||| ||||| |
Sbjct: 173 tgctggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgcta 232

                                                                       
Query: 353 tgagtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcaga 412
           |||| ||  | |||||||||||  | |||||||||||||||||| | || || ||||| |
Sbjct: 233 tgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagttgaaactcaaa 292

                                                                       
Query: 413 atcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtg 472
           | ||||| ||||| ||||| ||||| ||||| ||||| || || ||||||||  | ||||
Sbjct: 293 accatagattctcgtatggtgagccgatgactgtagagtccacaacacaagcactgtgtg 352

                                                                       
Query: 473 acttggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtct 532
           |  ||||||| || ||||||||||| || |||||||||||||| |||||||||||||| |
Sbjct: 353 atctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccgtttggagtat 412

                                                                       
Query: 533 ctctccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctg 592
           |||| || |||||||| ||||||||||||||||| |||||||||||||| || || ||  
Sbjct: 413 ctcttctcattgctggccatgatgaaaatggaccaagcttgtactacactgatccttc-a 471

                                              
Query: 593 ggacccttctggcagtgcaatgccaaggcaattgg 627
           ||| | ||||||||||||||||| |||||||||||
Sbjct: 472 ggaacattctggcagtgcaatgcaaaggcaattgg 506



to top

>gb|AY072371.1| Arabidopsis thaliana 20S proteasome subunit PAE1 (At1g53850) mRNA,
           complete cds
          Length = 1003

 Score =  252 bits (127), Expect = 1e-63
 Identities = 284/335 (84%), Gaps = 1/335 (0%)
 Strand = Plus / Plus

                                                                       
Query: 293 tgctggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaa 352
           |||||||||| |||||||||||||| || |||||||||||||| ||| |||| ||||| |
Sbjct: 286 tgctggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgcta 345

                                                                       
Query: 353 tgagtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcaga 412
           |||| ||  | |||||||||||  | |||||||||||||||||| | || || ||||| |
Sbjct: 346 tgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagttgaaactcaaa 405

                                                                       
Query: 413 atcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtg 472
           | ||||| ||||| ||||| ||||| ||||| ||||| || || ||||||||  | ||||
Sbjct: 406 accatagattctcgtatggtgagccgatgactgtagagtccacaacacaagcactgtgtg 465

                                                                       
Query: 473 acttggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtct 532
           |  ||||||| || ||||||||||| || |||||||||||||| |||||||||||||| |
Sbjct: 466 atctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccgtttggagtat 525

                                                                       
Query: 533 ctctccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctg 592
           |||| || |||||||| ||||||||||||||||| |||||||||||||| || || ||  
Sbjct: 526 ctcttctcattgctggccatgatgaaaatggaccaagcttgtactacactgatccttc-a 584

                                              
Query: 593 ggacccttctggcagtgcaatgccaaggcaattgg 627
           ||| | ||||||||||||||||| |||||||||||
Sbjct: 585 ggaacattctggcagtgcaatgcaaaggcaattgg 619



to top

>gb|AY086045.1| Arabidopsis thaliana clone 20801 mRNA, complete sequence
          Length = 1006

 Score =  252 bits (127), Expect = 1e-63
 Identities = 284/335 (84%), Gaps = 1/335 (0%)
 Strand = Plus / Plus

                                                                       
Query: 293 tgctggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaa 352
           |||||||||| |||||||||||||| || |||||||||||||| ||| |||| ||||| |
Sbjct: 288 tgctggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgcta 347

                                                                       
Query: 353 tgagtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcaga 412
           |||| ||  | |||||||||||  | |||||||||||||||||| | || || ||||| |
Sbjct: 348 tgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagttgaaactcaaa 407

                                                                       
Query: 413 atcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtg 472
           | ||||| ||||| ||||| ||||| ||||| ||||| || || ||||||||  | ||||
Sbjct: 408 accatagattctcgtatggtgagccgatgactgtagagtccacaacacaagcactgtgtg 467

                                                                       
Query: 473 acttggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtct 532
           |  ||||||| || ||||||||||| || |||||||||||||| |||||||||||||| |
Sbjct: 468 atctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccgtttggagtat 527

                                                                       
Query: 533 ctctccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctg 592
           |||| || |||||||| ||||||||||||||||| |||||||||||||| || || ||  
Sbjct: 528 ctcttctcattgctggccatgatgaaaatggaccaagcttgtactacactgatccttc-a 586

                                              
Query: 593 ggacccttctggcagtgcaatgccaaggcaattgg 627
           ||| | ||||||||||||||||| |||||||||||
Sbjct: 587 ggaacattctggcagtgcaatgcaaaggcaattgg 621



to top

>ref|NM_112287.2| Arabidopsis thaliana PAE2; endopeptidase/ peptidase/ threonine
           endopeptidase AT3G14290 (PAE2) mRNA, complete cds
          Length = 1023

 Score =  250 bits (126), Expect = 5e-63
 Identities = 280/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 291 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 350

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  ||||||||||||||||||| || || ||||| ||||| || |||||||| 
Sbjct: 351 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 410

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| || 
Sbjct: 411 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 470

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||
Sbjct: 471 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 530

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 531 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 589

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 590 atgcaatgcaaaggcaattgggtctggctc 619



to top

>gb|AY062970.1| Arabidopsis thaliana putative 20S proteasome subunit PAE2
           (At3g14290) mRNA, complete cds
          Length = 745

 Score =  250 bits (126), Expect = 5e-63
 Identities = 280/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 187 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 246

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  ||||||||||||||||||| || || ||||| ||||| || |||||||| 
Sbjct: 247 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 306

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| || 
Sbjct: 307 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 366

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||
Sbjct: 367 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 426

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 427 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 485

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 486 atgcaatgcaaaggcaattgggtctggctc 515



to top

>gb|AF370245.1| Arabidopsis thaliana putative 20S proteasome subunit PAE2
           (At3g14290) mRNA, complete cds
          Length = 987

 Score =  250 bits (126), Expect = 5e-63
 Identities = 280/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 290 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 349

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  ||||||||||||||||||| || || ||||| ||||| || |||||||| 
Sbjct: 350 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 409

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| || 
Sbjct: 410 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 469

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||
Sbjct: 470 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 529

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 530 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 588

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 589 atgcaatgcaaaggcaattgggtctggctc 618



to top

>emb|BX823159.1|CNS0A658 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB94ZC05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score =  250 bits (126), Expect = 5e-63
 Identities = 280/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 265 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 324

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  ||||||||||||||||||| || || ||||| ||||| || |||||||| 
Sbjct: 325 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 384

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| || 
Sbjct: 385 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 444

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||
Sbjct: 445 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 504

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 505 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 563

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 564 atgcaatgcaaaggcaattgggtctggctc 593



to top

>emb|BX822992.1|CNS0A648 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB79ZG11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 948

 Score =  250 bits (126), Expect = 5e-63
 Identities = 280/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 225 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 284

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  ||||||||||||||||||| || || ||||| ||||| || |||||||| 
Sbjct: 285 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 344

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| || 
Sbjct: 345 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 404

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||
Sbjct: 405 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 464

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 465 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 523

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 524 atgcaatgcaaaggcaattgggtctggctc 553



to top

>gb|AF043525.1|AF043525 Arabidopsis thaliana 20S proteasome subunit PAE2 (PAE2) mRNA,
           complete cds
          Length = 983

 Score =  250 bits (126), Expect = 5e-63
 Identities = 280/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 229 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 288

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  ||||||||||||||||||| || || ||||| ||||| || |||||||| 
Sbjct: 289 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 348

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| || 
Sbjct: 349 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 408

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||
Sbjct: 409 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 468

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 469 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 527

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 528 atgcaatgcaaaggcaattgggtctggctc 557



to top

>gb|AF043524.1|AF043524 Arabidopsis thaliana 20S proteasome subunit PAE1 (PAE1) mRNA,
           complete cds
          Length = 1005

 Score =  244 bits (123), Expect = 3e-61
 Identities = 283/335 (84%), Gaps = 1/335 (0%)
 Strand = Plus / Plus

                                                                       
Query: 293 tgctggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaa 352
           |||||||||| |||||||||||||| || |||||||||||||| ||| |||| ||||| |
Sbjct: 266 tgctggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgcta 325

                                                                       
Query: 353 tgagtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcaga 412
           |||| ||  | |||||||||||  | |||||||||||||||||| | || || ||||| |
Sbjct: 326 tgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagttgaaactcaaa 385

                                                                       
Query: 413 atcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtg 472
           | ||||| ||||| ||||| ||||| ||||| ||||| || || ||||||||  | ||||
Sbjct: 386 accatagattctcgtatggtgagccgatgactgtagagtccacaacacaagcactgtgtg 445

                                                                       
Query: 473 acttggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtct 532
           |  ||||||| || ||||||||||| || |||||||||||||| |||||||| ||||| |
Sbjct: 446 atctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccgttcggagtat 505

                                                                       
Query: 533 ctctccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctg 592
           |||| || |||||||| ||||||||||||||||| |||||||||||||| || || ||  
Sbjct: 506 ctcttctcattgctggccatgatgaaaatggaccaagcttgtactacactgatccttc-a 564

                                              
Query: 593 ggacccttctggcagtgcaatgccaaggcaattgg 627
           ||| | ||||||||||||||||| |||||||||||
Sbjct: 565 ggaacattctggcagtgcaatgcaaaggcaattgg 599



to top

>emb|BX822092.1|CNS0A644 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 844

 Score =  236 bits (119), Expect = 7e-59
 Identities = 280/331 (84%), Gaps = 2/331 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 210 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 269

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactc-agaatcataggttctc 425
           ||||||||  ||||||||||||||||||| || || ||||| | |||| || ||||||||
Sbjct: 270 gctgacgcgcgaacacttgttgagcatgcacgagtagagaccccagaaccacaggttctc 329

                                                                       
Query: 426 atatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcg 485
            ||||| ||||||||||| ||||||||||| ||||||||| | |||||  | ||||| ||
Sbjct: 330 gtatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacg 389

                                                                       
Query: 486 ctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgc 545
            ||||||||||| || ||||| |||||||| || || |||||||| || || || |||||
Sbjct: 390 gtttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgc 449

                                                                       
Query: 546 tggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggc 605
           ||| ||||||||||||||||| ||| |||||||||| || ||||| |||| | |||||||
Sbjct: 450 tgggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggc 508

                                          
Query: 606 agtgcaatgccaaggcaattgggtcgggctc 636
           | |||||||| |||||||||||||| |||||
Sbjct: 509 aatgcaatgcaaaggcaattgggtctggctc 539



to top

>gb|BT014224.1| Lycopersicon esculentum clone 133419F, mRNA sequence
          Length = 1119

 Score =  224 bits (113), Expect = 3e-55
 Identities = 351/429 (81%), Gaps = 1/429 (0%)
 Strand = Plus / Plus

                                                                       
Query: 211 atcaagttgggctccactgccatcggcttgatgactaagtatggtgttgtcctggctgtt 270
           ||||||||||| || ||||| || || |||| ||||||| | || ||||| || ||||| 
Sbjct: 156 atcaagttgggttcaactgcaattggattgaagactaaggaaggagttgttcttgctgtg 215

                                                                       
Query: 271 gagaaacgcgtcacctcaccgctgctggaacctagcagtgtggagaaaatcatggaaatt 330
           ||||| ||| | || ||||| || ||||| || ||||||||||||||||| |||||||| 
Sbjct: 216 gagaagcgcattacttcaccacttctggagccaagcagtgtggagaaaattatggaaatc 275

                                                                       
Query: 331 gatgagcatgttggctgtgcaatgagtggccttattgctgacgccagaacacttgttgag 390
           || |||||| |||||||||||||||||||  | || ||||| ||  |||||||||| || 
Sbjct: 276 gacgagcatattggctgtgcaatgagtggattgatagctgatgcacgaacacttgtggaa 335

                                                                       
Query: 391 catgctcgtgtcgagactcagaatcataggttctcatatggggagccaatgacagtagaa 450
           ||||| || || || |||||||| ||||| ||||| ||||| ||||| ||||| || || 
Sbjct: 336 catgcacgggttgaaactcagaaccatagattctcttatggcgagcccatgactgttgag 395

                                                                       
Query: 451 tctaccacacaagctatctgtgacttggctttgcgctttggtgaaggtgatgaagaatca 510
           || || || |||||| ||||||| ||||| ||||| |||||||| || ||||||||||| 
Sbjct: 396 tccactacccaagctctctgtgatttggcgttgcgatttggtgagggcgatgaagaatct 455

                                                                       
Query: 511 atgtcacggccgtttggagtctctctccttattgctggtcatgatgaaaatggacccagc 570
           |||||  |||| ||||| || || || || ||||||||||||||||| ||||| ||||||
Sbjct: 456 atgtccaggccttttggtgtgtcccttctcattgctggtcatgatgagaatggtcccagc 515

                                                                       
Query: 571 ttgtactacacggacccatctgggacccttctggcagtgcaatgccaaggcaattgggtc 630
           |||||||| || || || ||||| | | |||||||| |||||||| || || ||||||||
Sbjct: 516 ttgtactatactgatccttctggta-cattctggcaatgcaatgctaaagctattgggtc 574

                    
Query: 631 gggctctga 639
            || |||||
Sbjct: 575 aggttctga 583



to top

>emb|BX822457.1|CNS0A63I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB3ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 868

 Score =  218 bits (110), Expect = 2e-53
 Identities = 276/330 (83%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 225 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 284

                                                                       
Query: 367 gctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctca 426
           ||||||||  |||||||||| |||||||| || || ||||| ||||| || |||||||| 
Sbjct: 285 gctgacgcgcgaacacttgtagagcatgcacgagtagagacccagaaccacaggttctcg 344

                                                                       
Query: 427 tatggggagccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgc 486
           ||||| |||||||| || ||||||||||| ||||||||| | ||||   | ||||| || 
Sbjct: 345 tatggtgagccaattactgtagaatctacaacacaagctttgtgtgttcttgctttacgg 404

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || ||||| | |||||| || || |||||||| || || || ||||||
Sbjct: 405 tttggtgaaggagaggaagagttaatgtctcgtccatttggagtatcccttctcattgct 464

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| ||| |||||||||| || ||||| |||| | ||||||||
Sbjct: 465 gggcatgatgaaaatggaccgagcctgtactacacagatccatc-gggaacattctggca 523

                                         
Query: 607 gtgcaatgccaaggcaattgggtcgggctc 636
            |||||||| |||||||||||||| |||||
Sbjct: 524 atgcaatgcaaaggcaattgggtctggctc 553



to top

>gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0042J05, complete sequence
          Length = 150295

 Score =  165 bits (83), Expect = 2e-37
 Identities = 95/99 (95%)
 Strand = Plus / Minus

                                                                          
Query: 408    tcagaatcataggttctcatatggggagccaatgacagtagaatctaccacacaagctat 467
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 102526 tcagaatcataggttctcatatggggagccaatgacagtagaatctactacacaagctat 102467

                                                     
Query: 468    ctgtgacttggctttgcgctttggtgaaggtgatgaaga 506
              ||||||||| ||| |||| ||||||||||||||||||||
Sbjct: 102466 ctgtgacttagctctgcgttttggtgaaggtgatgaaga 102428



 Score =  135 bits (68), Expect = 2e-28
 Identities = 80/84 (95%)
 Strand = Plus / Minus

                                                                          
Query: 133    aggacggagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtc 192
              ||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 104159 aggacggagtacgaccgcggggtgaacaccttctccccggaggggcggttgttccaggtc 104100

                                      
Query: 193    gagtacgccatcgaggccatcaag 216
              ||||||||||| ||||||||||||
Sbjct: 104099 gagtacgccattgaggccatcaag 104076



 Score =  129 bits (65), Expect = 1e-26
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                          
Query: 297    ggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgag 356
              |||||| ||||||||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 102718 ggaaccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgag 102659

                                                           
Query: 357    tggccttattgctgacgccagaacacttgttgagcatgctcgtgt 401
              ||||||||||||||| || |||||| | |||||||||||||||||
Sbjct: 102658 tggccttattgctgatgctagaacattggttgagcatgctcgtgt 102614



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                          
Query: 513    gtcacggccgtttggagtctctctccttattgctggtcatgatgaaaatggacccagctt 572
              |||||| || ||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 101957 gtcacgaccatttggtgtctctctccttattgctggtcatgatgagaatggacccagctt 101898

                 
Query: 573    gta 575
              |||
Sbjct: 101897 gta 101895



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                          
Query: 215    agttgggctccactgccatcggcttgatgactaagtatggtgttgtcctggctgttgaga 274
              ||||||| || ||||| ||||| |||| ||| ||| ||||||||||||| ||||| ||||
Sbjct: 103751 agttggggtcaactgcgatcgggttgaagaccaaggatggtgttgtccttgctgtagaga 103692

                                      
Query: 275    aacgcgtcacctcaccgctgctgg 298
              |||| || ||||| || |||||||
Sbjct: 103691 aacgtgtgacctcgccactgctgg 103668



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 50/55 (90%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                     
Query: 573    gtactacacggacccatctgggacccttctggcagtgcaatgccaaggcaattgg 627
              ||||||||| |||||||| || ||| || ||||||||||||||||||||||||||
Sbjct: 101239 gtactacactgacccatcaggaaccttt-tggcagtgcaatgccaaggcaattgg 101186



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  165 bits (83), Expect = 2e-37
 Identities = 95/99 (95%)
 Strand = Plus / Minus

                                                                            
Query: 408      tcagaatcataggttctcatatggggagccaatgacagtagaatctaccacacaagctat 467
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 23086523 tcagaatcataggttctcatatggggagccaatgacagtagaatctactacacaagctat 23086464

                                                       
Query: 468      ctgtgacttggctttgcgctttggtgaaggtgatgaaga 506
                ||||||||| ||| |||| ||||||||||||||||||||
Sbjct: 23086463 ctgtgacttagctctgcgttttggtgaaggtgatgaaga 23086425



 Score =  135 bits (68), Expect = 2e-28
 Identities = 80/84 (95%)
 Strand = Plus / Minus

                                                                            
Query: 133      aggacggagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtc 192
                ||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 23088156 aggacggagtacgaccgcggggtgaacaccttctccccggaggggcggttgttccaggtc 23088097

                                        
Query: 193      gagtacgccatcgaggccatcaag 216
                ||||||||||| ||||||||||||
Sbjct: 23088096 gagtacgccattgaggccatcaag 23088073



 Score =  129 bits (65), Expect = 1e-26
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                            
Query: 297      ggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgag 356
                |||||| ||||||||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 23086715 ggaaccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgag 23086656

                                                             
Query: 357      tggccttattgctgacgccagaacacttgttgagcatgctcgtgt 401
                ||||||||||||||| || |||||| | |||||||||||||||||
Sbjct: 23086655 tggccttattgctgatgctagaacattggttgagcatgctcgtgt 23086611



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                            
Query: 513      gtcacggccgtttggagtctctctccttattgctggtcatgatgaaaatggacccagctt 572
                |||||| || ||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 23085954 gtcacgaccatttggtgtctctctccttattgctggtcatgatgagaatggacccagctt 23085895

                   
Query: 573      gta 575
                |||
Sbjct: 23085894 gta 23085892



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                            
Query: 215      agttgggctccactgccatcggcttgatgactaagtatggtgttgtcctggctgttgaga 274
                ||||||| || ||||| ||||| |||| ||| ||| ||||||||||||| ||||| ||||
Sbjct: 23087748 agttggggtcaactgcgatcgggttgaagaccaaggatggtgttgtccttgctgtagaga 23087689

                                        
Query: 275      aacgcgtcacctcaccgctgctgg 298
                |||| || ||||| || |||||||
Sbjct: 23087688 aacgtgtgacctcgccactgctgg 23087665



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 50/55 (90%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                       
Query: 573      gtactacacggacccatctgggacccttctggcagtgcaatgccaaggcaattgg 627
                ||||||||| |||||||| || ||| || ||||||||||||||||||||||||||
Sbjct: 23085236 gtactacactgacccatcaggaaccttt-tggcagtgcaatgccaaggcaattgg 23085183



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 175      gggcggctgttccaggtcgagtacgccatcgaggccatcaag 216
                ||||| ||||||||||||||||| ||||| |||| |||||||
Sbjct: 11307999 gggcgtctgttccaggtcgagtatgccattgaggtcatcaag 11308040



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  165 bits (83), Expect = 2e-37
 Identities = 95/99 (95%)
 Strand = Plus / Minus

                                                                            
Query: 408      tcagaatcataggttctcatatggggagccaatgacagtagaatctaccacacaagctat 467
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 23396433 tcagaatcataggttctcatatggggagccaatgacagtagaatctactacacaagctat 23396374

                                                       
Query: 468      ctgtgacttggctttgcgctttggtgaaggtgatgaaga 506
                ||||||||| ||| |||| ||||||||||||||||||||
Sbjct: 23396373 ctgtgacttagctctgcgttttggtgaaggtgatgaaga 23396335



 Score =  135 bits (68), Expect = 2e-28
 Identities = 80/84 (95%)
 Strand = Plus / Minus

                                                                            
Query: 133      aggacggagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtc 192
                ||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 23398066 aggacggagtacgaccgcggggtgaacaccttctccccggaggggcggttgttccaggtc 23398007

                                        
Query: 193      gagtacgccatcgaggccatcaag 216
                ||||||||||| ||||||||||||
Sbjct: 23398006 gagtacgccattgaggccatcaag 23397983



 Score =  129 bits (65), Expect = 1e-26
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                            
Query: 297      ggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgag 356
                |||||| ||||||||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 23396625 ggaaccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgag 23396566

                                                             
Query: 357      tggccttattgctgacgccagaacacttgttgagcatgctcgtgt 401
                ||||||||||||||| || |||||| | |||||||||||||||||
Sbjct: 23396565 tggccttattgctgatgctagaacattggttgagcatgctcgtgt 23396521



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                            
Query: 513      gtcacggccgtttggagtctctctccttattgctggtcatgatgaaaatggacccagctt 572
                |||||| || ||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 23395864 gtcacgaccatttggtgtctctctccttattgctggtcatgatgagaatggacccagctt 23395805

                   
Query: 573      gta 575
                |||
Sbjct: 23395804 gta 23395802



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                            
Query: 215      agttgggctccactgccatcggcttgatgactaagtatggtgttgtcctggctgttgaga 274
                ||||||| || ||||| ||||| |||| ||| ||| ||||||||||||| ||||| ||||
Sbjct: 23397658 agttggggtcaactgcgatcgggttgaagaccaaggatggtgttgtccttgctgtagaga 23397599

                                        
Query: 275      aacgcgtcacctcaccgctgctgg 298
                |||| || ||||| || |||||||
Sbjct: 23397598 aacgtgtgacctcgccactgctgg 23397575



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 50/55 (90%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                       
Query: 573      gtactacacggacccatctgggacccttctggcagtgcaatgccaaggcaattgg 627
                ||||||||| |||||||| || ||| || ||||||||||||||||||||||||||
Sbjct: 23395146 gtactacactgacccatcaggaaccttt-tggcagtgcaatgccaaggcaattgg 23395093



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 175      gggcggctgttccaggtcgagtacgccatcgaggccatcaag 216
                ||||| ||||||||||||||||| ||||| |||| |||||||
Sbjct: 11387188 gggcgtctgttccaggtcgagtatgccattgaggtcatcaag 11387229



to top

>emb|AJ291735.1|NTA291735 Nicotiana tabacum partial mRNA for putative alpha5 proteasome
           subunit (a5 gene)
          Length = 315

 Score =  147 bits (74), Expect = 5e-32
 Identities = 245/302 (81%)
 Strand = Plus / Plus

                                                                       
Query: 256 gttgtcctggctgttgagaaacgcgtcacctcaccgctgctggaacctagcagtgtggag 315
           |||||||| || |||||||| || || ||||| || || ||||| || ||||||||||||
Sbjct: 14  gttgtccttgcagttgagaagcgagttacctctccacttctggagccaagcagtgtggag 73

                                                                       
Query: 316 aaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttattgctgacgcc 375
           ||||| |||||||||||||||||| |||||||||| ||||||||  | || ||||| || 
Sbjct: 74  aaaattatggaaattgatgagcatattggctgtgcgatgagtggattgatagctgatgca 133

                                                                       
Query: 376 agaacacttgttgagcatgctcgtgtcgagactcagaatcataggttctcatatggggag 435
           || || |||||||| ||||| || || || |||||||| || ||||| || ||||| |||
Sbjct: 134 aggactcttgttgaacatgcacgagttgaaactcagaaccacaggttttcttatggtgag 193

                                                                       
Query: 436 ccaatgacagtagaatctaccacacaagctatctgtgacttggctttgcgctttggtgaa 495
           || ||||| || || || || ||||||||| | ||||| |||||  |||| ||||| || 
Sbjct: 194 cccatgactgttgagtccacaacacaagctctgtgtgatttggccctgcgatttggggag 253

                                                                       
Query: 496 ggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgctggtcatgat 555
           ||||||||||| || |||||  | || ||||| || || || || |||||||| ||||||
Sbjct: 254 ggtgatgaagagtctatgtccagaccttttggtgtatcacttctcattgctggccatgat 313

             
Query: 556 ga 557
           ||
Sbjct: 314 ga 315



to top

>dbj|AK220949.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-54-C04
          Length = 543

 Score =  145 bits (73), Expect = 2e-31
 Identities = 125/141 (88%), Gaps = 1/141 (0%)
 Strand = Plus / Plus

                                                                       
Query: 487 tttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctctccttattgct 546
           ||||||||||| || |||||||||||||| |||||||||||||| ||||| || ||||||
Sbjct: 9   tttggtgaaggagaggaagaatcaatgtctcggccgtttggagtatctcttctcattgct 68

                                                                       
Query: 547 ggtcatgatgaaaatggacccagcttgtactacacggacccatctgggacccttctggca 606
           || ||||||||||||||||| |||||||||||||| || || ||  ||| | ||||||||
Sbjct: 69  ggccatgatgaaaatggaccaagcttgtactacactgatccttc-aggaacattctggca 127

                                
Query: 607 gtgcaatgccaaggcaattgg 627
           ||||||||| |||||||||||
Sbjct: 128 gtgcaatgcaaaggcaattgg 148



to top

>emb|AJ418041.1|PPA418041 Physcomitrella patens mRNA for 20S proteasome subunit alpha V (zeta
           gene)
          Length = 952

 Score =  131 bits (66), Expect = 3e-27
 Identities = 240/298 (80%)
 Strand = Plus / Plus

                                                                       
Query: 296 tggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatga 355
           ||||||| | |||||| ||||| ||||||||||| ||||| ||| |||| ||||| ||||
Sbjct: 256 tggaacccaccagtgtcgagaagatcatggaaatcgatgaacatattgggtgtgccatga 315

                                                                       
Query: 356 gtggccttattgctgacgccagaacacttgttgagcatgctcgtgtcgagactcagaatc 415
           |||| || | ||| || ||  | ||||||||||| ||||  ||||| || ||||||||||
Sbjct: 316 gtggtctcactgcggatgctcgcacacttgttgaacatggccgtgtggaaactcagaatc 375

                                                                       
Query: 416 ataggttctcatatggggagccaatgacagtagaatctaccacacaagctatctgtgact 475
           |||||||||| |||   ||||| ||||  || || ||||| ||||||||  | |||||  
Sbjct: 376 ataggttctcgtataatgagcctatgagtgtggagtctactacacaagccctgtgtgatc 435

                                                                       
Query: 476 tggctttgcgctttggtgaaggtgatgaagaatcaatgtcacggccgtttggagtctctc 535
           ||||||| || ||||| |||   || ||||||||||||||||| || || ||||| ||||
Sbjct: 436 tggctttacgttttggggaattcgacgaagaatcaatgtcacgtcctttcggagtttctc 495

                                                                     
Query: 536 tccttattgctggtcatgatgaaaatggacccagcttgtactacacggacccatctgg 593
           | || |||||||| |||||||| | ||||||  |||||||| |||| || ||||||||
Sbjct: 496 tgctcattgctggccatgatgagagtggaccatgcttgtaccacacagatccatctgg 553



to top

>emb|BX824071.1|CNS0A5L7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH1ZD09 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1499

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 99/114 (86%), Gaps = 1/114 (0%)
 Strand = Plus / Plus

                                                                        
Query: 523  tttggagtctctctccttattgctggtcatgatgaaaatggacccagcttgtactacacg 582
            |||||||| || || || |||||||| ||||||||||||||||| ||| |||||||||| 
Sbjct: 1030 tttggagtatcccttctcattgctgggcatgatgaaaatggaccgagcctgtactacaca 1089

                                                                  
Query: 583  gacccatctgggacccttctggcagtgcaatgccaaggcaattgggtcgggctc 636
            || ||||| |||| | |||||||| |||||||| |||||||||||||| |||||
Sbjct: 1090 gatccatc-gggaacattctggcaatgcaatgcaaaggcaattgggtctggctc 1142



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 409 cagaatcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatc 468
           ||||| || |||||||| ||||| ||||||||||| ||||||||||| ||||||||| | 
Sbjct: 605 cagaaccacaggttctcgtatggtgagccaatgactgtagaatctacaacacaagctttg 664

                                                        
Query: 469 tgtgacttggctttgcgctttggtgaaggtgatgaagaatcaatg 513
           |||||  | ||||| || ||||||||||| || ||||| ||||||
Sbjct: 665 tgtgatcttgctttacggtttggtgaaggagaggaagagtcaatg 709



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 307 agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
           ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 409 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 468

                                        
Query: 367 gctgacgccagaacacttgttgagcatgc 395
           ||||||||  |||||||||||||||||||
Sbjct: 469 gctgacgcgcgaacacttgttgagcatgc 497



to top

>emb|BX063332.1|CNS09L14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 112 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 171

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 172 gccatcgaggcgatcaaatttggctccaccgccatcggc 210



to top

>emb|BX062751.1|CNS09KKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 16  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 75

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 76  gccatcgaggcgatcaaatttggctccaccgccatcggc 114



to top

>emb|BX056699.1|CNS09FWV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 100 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 159

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 160 gccatcgaggcgatcaaatttggctccaccgccatcggc 198



to top

>emb|BX031436.1|CNS08WF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 90  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 149

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 150 gccatcgaggcgatcaaatttggctccaccgccatcggc 188



to top

>emb|BX019821.1|CNS08NGH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 133 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 192

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 193 gccatcgaggcgatcaaatttggctccaccgccatcggc 231



to top

>emb|BX017936.1|CNS08M04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 107 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 166

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 167 gccatcgaggcgatcaaatttggctccaccgccatcggc 205



to top

>emb|BX018241.1|CNS08M8L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 110 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 169

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 170 gccatcgaggcgatcaaatttggctccaccgccatcggc 208



to top

>emb|BX015753.1|CNS08KBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 94  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 153

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 154 gccatcgaggcgatcaaatttggctccaccgccatcggc 192



to top

>emb|BX011882.1|CNS08HBY Single read from an extremity of a full-length cDNA clone made from
            Anopheles gambiae total adult females. 3-PRIME end of
            clone FK0AAA18DG09 of strain 6-9 of Anopheles gambiae
            (African malaria mosquito)
          Length = 1025

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 139  gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
            |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 1025 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 966

                                                   
Query: 199  gccatcgaggccatcaagttgggctccactgccatcggc 237
            ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 965  gccatcgaggcgatcaaatttggctccaccgccatcggc 927



to top

>emb|BX011202.1|CNS08GT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 123 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 182

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 183 gccatcgaggcgatcaaatttggctccaccgccatcggc 221



to top

>emb|BX010636.1|CNS08GDC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 129 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 188

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 189 gccatcgaggcgatcaaatttggctccaccgccatcggc 227



to top

>emb|BX009604.1|CNS08FKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 83  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 142

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 143 gccatcgaggcgatcaaatttggctccaccgccatcggc 181



to top

>ref|XM_314945.2| Anopheles gambiae str. PEST ENSANGP00000019329
           (ENSANGG00000016840), mRNA
          Length = 1160

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 132 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 191

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 192 gccatcgaggcgatcaaatttggctccaccgccatcggc 230



to top

>gb|DQ214008.1| Taeniopygia guttata clone 0064P0007F03 proteasome alpha 5 subunit
           variant 1-like mRNA, complete sequence
          Length = 1055

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||||| || || ||||| ||||| ||||||||| |||| |||||||| || || 
Sbjct: 136 gagtacgaccggggtgtgaacacgttctctccggaggggaggctcttccaggtggaatat 195

                                                 
Query: 199 gccatcgaggccatcaagttgggctccactgccatcgg 236
           |||||||||||||||||| | |||||||| ||||||||
Sbjct: 196 gccatcgaggccatcaagcttggctccacagccatcgg 233



to top

>gb|AC009324.2| Arabidopsis thaliana chromosome I BAC T18A20 genomic sequence, complete
             sequence
          Length = 85413

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                         
Query: 297   ggaacctagcagtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgag 356
             |||||| |||||||||||||| || |||||||||||||| ||| |||| ||||| |||||
Sbjct: 40361 ggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgctatgag 40302

                                                     
Query: 357   tggccttattgctgacgccagaacacttgttgagcatgct 396
              ||  | |||||||||||  | ||||||||||||||||||
Sbjct: 40301 cggtttaattgctgacgcgcgcacacttgttgagcatgct 40262



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                        
Query: 517   cggccgtttggagtctctctccttattgctggtcatgatgaaaatggacccagcttgta 575
             |||||||||||||| ||||| || |||||||| ||||||||||||||||| ||||||||
Sbjct: 39943 cggccgtttggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgta 39885



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                         
Query: 409   cagaatcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatc 468
             ||||| ||||| ||||| ||||| ||||| ||||| ||||| || || ||||||||  | 
Sbjct: 40164 cagaaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaagcactg 40105

                                                          
Query: 469   tgtgacttggctttgcgctttggtgaaggtgatgaagaatcaatg 513
             |||||  ||||||| || ||||||||||| || ||||||||||||
Sbjct: 40104 tgtgatctggctttacggtttggtgaaggagaggaagaatcaatg 40060



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 599   ttctggcagtgcaatgccaaggcaattgg 627
             ||||||||||||||||| |||||||||||
Sbjct: 39770 ttctggcagtgcaatgcaaaggcaattgg 39742



to top

>ref|NM_001031407.1| Gallus gallus proteasome (prosome, macropain) subunit, alpha type,
           5 (PSMA5), mRNA
          Length = 1047

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||||| || || ||||| ||||| ||||||||| |||||||||| || ||||| 
Sbjct: 123 gagtacgaccggggcgtgaacactttctctccggaggggaggctgttccaagtggagtat 182

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           |||||||||||||| ||| | ||||| || |||||||||
Sbjct: 183 gccatcgaggccattaagctcggctctacggccatcggc 221



to top

>emb|BX066418.1|CNS09NEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || || || || ||||||||||| ||||| 
Sbjct: 19  gagtacgatcgtggagtgaacaccttctcgcccgatggtcgtctgttccaggttgagtat 78

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 79  gccatcgaggcgatcaaatttggctccaccgccatcggc 117



to top

>emb|AJ720305.1| Gallus gallus mRNA for hypothetical protein, clone 14i9
          Length = 1047

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||||| || || ||||| ||||| ||||||||| |||||||||| || ||||| 
Sbjct: 123 gagtacgaccggggcgtgaacactttctctccggaggggaggctgttccaagtggagtat 182

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           |||||||||||||| ||| | ||||| || |||||||||
Sbjct: 183 gccatcgaggccattaagctcggctctacggccatcggc 221



to top

>emb|CR386956.1| Gallus gallus finished cDNA, clone ChEST102f7
          Length = 769

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||||| || || ||||| ||||| ||||||||| |||||||||| || ||||| 
Sbjct: 134 gagtacgaccggggcgtgaacactttctctccggaggggaggctgttccaagtggagtat 193

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           |||||||||||||| ||| | ||||| || |||||||||
Sbjct: 194 gccatcgaggccattaagctcggctctacggccatcggc 232



to top

>gb|DQ214009.1| Taeniopygia guttata clone 0061P0007F09 proteasome alpha 5 subunit
           variant 1-like mRNA, complete sequence
          Length = 1034

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||||| || || ||||| ||||| ||||||||| | || |||||||| || || 
Sbjct: 116 gagtacgaccggggtgtgaacacgttctctccggaggggagactcttccaggtggaatat 175

                                                 
Query: 199 gccatcgaggccatcaagttgggctccactgccatcgg 236
           |||||||||||||||||| | |||||||| ||||||||
Sbjct: 176 gccatcgaggccatcaagcttggctccacagccatcgg 213



to top

>emb|BX011881.1|CNS08HBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           |||||||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 77  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 136

                                        
Query: 199 gccatcgaggccatcaagttgggctccac 227
           ||||||||||| ||||| || ||||||||
Sbjct: 137 gccatcgaggcgatcaaatttggctccac 165



to top

>dbj|AB022220.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLN21
          Length = 83906

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                         
Query: 409   cagaatcataggttctcatatggggagccaatgacagtagaatctaccacacaagctatc 468
             ||||| || |||||||| ||||| ||||||||||| ||||||||||| ||||||||| | 
Sbjct: 29460 cagaaccacaggttctcgtatggtgagccaatgactgtagaatctacaacacaagctttg 29519

                                                          
Query: 469   tgtgacttggctttgcgctttggtgaaggtgatgaagaatcaatg 513
             |||||  | ||||| || ||||||||||| || ||||| ||||||
Sbjct: 29520 tgtgatcttgctttacggtttggtgaaggagaggaagagtcaatg 29564



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                         
Query: 307   agtgtggagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggccttatt 366
             ||||| ||||| || |||||||||||||| ||| | || ||||| |||||||| || |||
Sbjct: 29264 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 29323

                                          
Query: 367   gctgacgccagaacacttgttgagcatgc 395
             ||||||||  |||||||||||||||||||
Sbjct: 29324 gctgacgcgcgaacacttgttgagcatgc 29352



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                         
Query: 573   gtactacacggacccatctgggacccttctggcagtgcaatgccaaggcaattgggtcgg 632
             ||||||||| || ||||| |||| | |||||||| |||||||| |||||||||||||| |
Sbjct: 30031 gtactacacagatccatc-gggaacattctggcaatgcaatgcaaaggcaattgggtctg 30089

                 
Query: 633   gctc 636
             ||||
Sbjct: 30090 gctc 30093



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 523   tttggagtctctctccttattgctggtcatgatgaaaatggacccagcttgta 575
             |||||||| || || || |||||||| ||||||||||||||||| ||| ||||
Sbjct: 29885 tttggagtatcccttctcattgctgggcatgatgaaaatggaccgagcctgta 29937



to top

>ref|XM_956973.1| Neurospora crassa OR74A hypothetical protein (NCU05295.1) partial
           mRNA
          Length = 738

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 155 tcaacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatca 214
           |||||||||||||||| || || || || ||||| ||||||||| || ||||||||||||
Sbjct: 35  tcaacaccttctcccccgaaggccgcctcttccaagtcgagtactccctcgaggccatca 94

                                  
Query: 215 agttgggctccactgccatcggc 237
           || | |||||||| |||||||||
Sbjct: 95  agctcggctccaccgccatcggc 117



to top

>ref|XM_324651.1| Neurospora crassa OR74A hypothetical protein (NCU05295.1) partial
           mRNA
          Length = 738

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 155 tcaacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatca 214
           |||||||||||||||| || || || || ||||| ||||||||| || ||||||||||||
Sbjct: 35  tcaacaccttctcccccgaaggccgcctcttccaagtcgagtactccctcgaggccatca 94

                                  
Query: 215 agttgggctccactgccatcggc 237
           || | |||||||| |||||||||
Sbjct: 95  agctcggctccaccgccatcggc 117



to top

>gb|AY232148.1| Drosophila yakuba clone yak-ad_ProsMA5 mRNA sequence
          Length = 555

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||| | || || ||||||||||| |||||||| || || ||||| || || |||
Sbjct: 19  gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatac 78

                                        
Query: 199 gccatcgaggccatcaagttgggctccac 227
           ||||| ||||||||||| |||||||||||
Sbjct: 79  gccattgaggccatcaaattgggctccac 107



to top

>ref|XM_367205.1| Magnaporthe grisea 70-15 hypothetical protein (MG07130.4) partial
           mRNA
          Length = 738

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                       
Query: 142 tacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtacgcc 201
           |||||||| ||  ||||||||||||||||||| || || || ||||||||||| ||| ||
Sbjct: 22  tacgaccggggtatcaacaccttctccccggaaggtcgtctcttccaggtcgaatactcc 81

                          
Query: 202 atcgaggccatcaag 216
            ||||||||||||||
Sbjct: 82  ctcgaggccatcaag 96



to top

>ref|XM_386335.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG06159.1) partial mRNA
          Length = 732

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 155 tcaacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatca 214
           |||||||||||||||| || || || || ||||||||||| ||| |  ||||||||||||
Sbjct: 29  tcaacaccttctcccccgaaggccgtctcttccaggtcgaatactctctcgaggccatca 88

                                  
Query: 215 agttgggctccactgccatcggc 237
           || | |||||||| |||||||||
Sbjct: 89  agctcggctccacggccatcggc 111



to top

>ref|NM_166221.2| Drosophila melanogaster Proteasome  subunit CG10938-RA, transcript
           variant A (ProsMA5), mRNA
          Length = 884

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 95  gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 154

                                        
Query: 199 gccatcgaggccatcaagttgggctccac 227
           ||||| ||||||||||| |||||||||||
Sbjct: 155 gccattgaggccatcaaattgggctccac 183



to top

>ref|NM_057854.3| Drosophila melanogaster Proteasome  subunit CG10938-RB, transcript
           variant B (ProsMA5), mRNA
          Length = 885

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 91  gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 150

                                        
Query: 199 gccatcgaggccatcaagttgggctccac 227
           ||||| ||||||||||| |||||||||||
Sbjct: 151 gccattgaggccatcaaattgggctccac 179



to top

>gb|AY061404.1| Drosophila melanogaster LD33318 full length cDNA
          Length = 888

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 86  gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 145

                                        
Query: 199 gccatcgaggccatcaagttgggctccac 227
           ||||| ||||||||||| |||||||||||
Sbjct: 146 gccattgaggccatcaaattgggctccac 174



to top

>gb|AC009535.9| Drosophila melanogaster, chromosome 2R, region 54B-54B, BAC clone
              BACR28O12, complete sequence
          Length = 161244

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                          
Query: 139    gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
              ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 127419 gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 127478

                                           
Query: 199    gccatcgaggccatcaagttgggctccac 227
              ||||| ||||||||||| |||||||||||
Sbjct: 127479 gccattgaggccatcaaattgggctccac 127507



to top

>gb|AC008004.5|AC008004 Drosophila melanogaster, chromosome 2R, region 54B-54C, BAC clone
            BACR21A09, complete sequence
          Length = 175506

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                        
Query: 139  gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
            ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 4420 gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 4479

                                         
Query: 199  gccatcgaggccatcaagttgggctccac 227
            ||||| ||||||||||| |||||||||||
Sbjct: 4480 gccattgaggccatcaaattgggctccac 4508



to top

>gb|AY104937.1| Zea mays PCO082324 mRNA sequence
          Length = 1160

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 aggggcggctgttccaggtcgagtacgccatcgaggccatcaagttgggctcc 225
           ||||||||||||||||||| ||||||||||| |||||| |||||  |||||||
Sbjct: 190 aggggcggctgttccaggtggagtacgccatggaggccgtcaagcagggctcc 242



to top

>gb|AE003803.4| Drosophila melanogaster chromosome 2R, section 47 of 73 of the complete
              sequence
          Length = 290783

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                          
Query: 139    gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
              ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 147437 gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 147496

                                           
Query: 199    gccatcgaggccatcaagttgggctccac 227
              ||||| ||||||||||| |||||||||||
Sbjct: 147497 gccattgaggccatcaaattgggctccac 147525



to top

>gb|U64721.1|DMU64721 Drosophila melanogaster 20S proteasome alpha subunit PSMA5 gene,
           complete cds
          Length = 1062

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||||||| | || || ||||||||||| |||||||| || || ||||| || || || 
Sbjct: 164 gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatat 223

                                        
Query: 199 gccatcgaggccatcaagttgggctccac 227
           ||||| ||||||||||| |||||||||||
Sbjct: 224 gccattgaggccatcaaattgggctccac 252



to top

>gb|BT017945.1| Zea mays clone EL01N0521D09.c mRNA sequence
          Length = 1171

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 173 aggggcggctgttccaggtcgagtacgccatcgaggccatcaag 216
           ||||||||||||||||||| ||||||||||| |||||| |||||
Sbjct: 160 aggggcggctgttccaggtggagtacgccatggaggccgtcaag 203



to top

>ref|XM_464030.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1079

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 168 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 136 cccggcggggcggctgttccaggtggagtacgccatggaggcc 178



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                          
Query: 168     cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
               ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 1784747 cccggcggggcggctgttccaggtggagtacgccatggaggcc 1784789



to top

>dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0030G11
          Length = 143943

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                         
Query: 168    cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
              ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 102759 cccggcggggcggctgttccaggtggagtacgccatggaggcc 102801



to top

>dbj|AK109376.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D06, full
           insert sequence
          Length = 1080

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 168 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 119 cccggcggggcggctgttccaggtggagtacgccatggaggcc 161



to top

>dbj|AP004799.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0585B01
          Length = 133231

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 168   cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
             ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 21391 cccggcggggcggctgttccaggtggagtacgccatggaggcc 21433



to top

>dbj|AK103646.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033135B19, full
           insert sequence
          Length = 1079

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 168 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 136 cccggcggggcggctgttccaggtggagtacgccatggaggcc 178



to top

>dbj|D37886.1|RICPC2SA Rice mRNA for proteasome C2 subunit, complete cds
          Length = 1045

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 168 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 210
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 121 cccggcggggcggctgttccaggtggagtacgccatggaggcc 163



to top

>ref|XM_750383.1| Aspergillus fumigatus Af293 proteasome component Pup2 (Afu2g11440)
           partial mRNA
          Length = 753

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 145 gaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcga 194
           ||||||||  |||||||||||||||| || ||||| ||||||||||||||
Sbjct: 37  gaccgtggaatcaacaccttctcccccgaagggcgcctgttccaggtcga 86



to top

>emb|BX063333.1|CNS09L15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 184 ttccaggtcgagtacgccatcgaggccatcaagttgggctccactgccatcggc 237
           |||||||| ||||| ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 982 ttccaggttgagtatgccatcgaggcgatcaaatttggctccaccgccatcggc 929



to top

>dbj|AK099876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111H14, full
           insert sequence
          Length = 1567

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                       
Query: 120 gatgttnctcacgaggacggagtacgaccgtggggtcaacaccttctccccggaggggcg 179
           |||||| |||| ||||| |||||| ||||| ||| | | ||  ||||| | ||| |||||
Sbjct: 714 gatgtttctcatgaggatggagtaagaccgcgggttaaccattttctcactggacgggcg 773

                                                
Query: 180 gctgttccaggtcgagtacgccatcgaggccatcaag 216
            ||||||||||||||||| ||||| |||| |||||||
Sbjct: 774 tctgttccaggtcgagtatgccattgaggtcatcaag 810



to top

>gb|AF424643.1| Phytophthora infestans clone MY-03-E-06 proteasome subunit mRNA,
           complete cds
          Length = 911

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 159 caccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaa 215
           ||||||||||||||| || || || |||||||| || |||||||| |||||||||||
Sbjct: 58  caccttctccccggaaggccgactcttccaggtggaatacgccatggaggccatcaa 114



to top

>gb|AY431444.1| Aedes aegypti ASAP ID: 43014 proteasome endopeptidase mRNA sequence
          Length = 745

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 145 gaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtacgccatc 204
           |||||||| |||||||||||||| || ||||| || || ||||| || || |||||||||
Sbjct: 78  gaccgtggtgtcaacaccttctcgccagagggccgactcttccaagtagaatacgccatc 137

                   
Query: 205 gaggccat 212
           || |||||
Sbjct: 138 gaagccat 145



to top

>gb|DQ440413.1| Aedes aegypti clone AET-5533 20S proteasome regulatory subunit
           alpha type  PSMA5/PUP2 mRNA, complete cds
          Length = 729

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 145 gaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtacgccatc 204
           |||||||| |||||||||||||| || ||||| || || ||||| || || |||||||||
Sbjct: 25  gaccgtggtgtcaacaccttctcgccagagggccgactcttccaagtagaatacgccatc 84

                   
Query: 205 gaggccat 212
           || |||||
Sbjct: 85  gaagccat 92



to top

>gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0015P05 map C53961S, complete sequence
          Length = 175121

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 175   gggcggctgttccaggtcgagtacgccatcgaggccatcaag 216
             ||||| ||||||||||||||||| ||||| |||| |||||||
Sbjct: 94357 gggcgtctgttccaggtcgagtatgccattgaggtcatcaag 94398



to top

>ref|XM_757040.1| Ustilago maydis 521 hypothetical protein (UM05986.1) partial mRNA
          Length = 753

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 gagtacgaccgtggggtcaacaccttctccccggaggggcggctgttccaggtcgagtac 198
           ||||| |||||||| |||||||| ||||| || ||||| || || || ||||||||||||
Sbjct: 19  gagtatgaccgtggtgtcaacacattctcgcccgagggtcgtctctttcaggtcgagtac 78

             
Query: 199 gc 200
           ||
Sbjct: 79  gc 80



to top

>ref|XM_757288.1| Ustilago maydis 521 hypothetical protein (UM06234.1) partial mRNA
          Length = 918

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaa 215
           |||||||||||| || ||||||| |||||||||||| ||| || |||| |||||
Sbjct: 36  cttctccccggacggacggctgtaccaggtcgagtatgccttcaaggcgatcaa 89



to top

>emb|BX017937.1|CNS08M05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 193 gagtacgccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||| ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 974 gagtatgccatcgaggcgatcaaatttggctccaccgccatcggc 930



to top

>ref|NM_185696.1| Oryza sativa (japonica cultivar-group), Ozsa8047 predicted mRNA
          Length = 753

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 33  cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 80



to top

>ref|NM_185686.1| Oryza sativa (japonica cultivar-group), Ozsa8037 predicted mRNA
          Length = 753

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 33  cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 80



to top

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 139    gagtacgaccgtggggtcaacaccttctcccc 170
              ||||||||||| || |||||||||||||||||
Sbjct: 788558 gagtacgaccggggtgtcaacaccttctcccc 788527



to top

>ref|XM_572324.1| Cryptococcus neoformans var. neoformans JEC21 proteasome subunit
           alpha type 5 (CNH01360) partial mRNA
          Length = 813

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 139 gagtacgaccgtggggtcaacaccttctcccc 170
           ||||||||||| || |||||||||||||||||
Sbjct: 100 gagtacgaccggggtgtcaacaccttctcccc 131



to top

>emb|X52319.1|DMPROS29 Fruit fly mRNA for proteosome subunit
          Length = 928

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 110 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 161



to top

>ref|NM_057343.3| Drosophila melanogaster Proteasome 29kD subunit CG9327-RA (Pros29),
           mRNA
          Length = 971

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 122 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 173



to top

>gb|AY084140.1| Drosophila melanogaster RE23862 full insert cDNA
          Length = 988

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 123 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 174



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 162    cttctccccggaggggcggctgttccaggtcgagta 197
              |||||| || ||||||||||||| ||||||||||||
Sbjct: 539434 cttctcgcccgaggggcggctgtaccaggtcgagta 539469



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 181   ctgttccaggtcgagtacgccatcgaggccatcaag 216
             ||||||||||| ||||||||  | ||||||||||||
Sbjct: 81784 ctgttccaggtggagtacgcgctagaggccatcaag 81819



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                               
Query: 162     cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
               |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 3869188 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 3869235



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                               
Query: 162     cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
               |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 3831132 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 3831179



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                               
Query: 162     cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
               |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 3419617 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 3419664



to top

>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone
             BACR10P11, complete sequence
          Length = 164035

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 162   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
             |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 41009 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 40958



to top

>dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0015E04
          Length = 152046

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                              
Query: 162    cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
              |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 127142 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 127189



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 162   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
             |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 89086 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 89133



to top

>ref|NM_211639.1| Eremothecium gossypii AGL089Wp (AGL089W), mRNA
          Length = 741

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 162 cttctccccggaggggcggctgttccaggtcgagta 197
           |||||| || ||||||||||||| ||||||||||||
Sbjct: 36  cttctcgcccgaggggcggctgtaccaggtcgagta 71



to top

>dbj|AK059984.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-G05, full
           insert sequence
          Length = 1077

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 123 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 170



to top

>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete
              sequence
          Length = 303438

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 162    cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
              |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 210259 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 210310



to top

>gb|AC005268.1|AC005268 Drosophila melanogaster DNA sequence (P1s DS03550 (D225) and DS02397
             (D206)), complete sequence
          Length = 89791

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 162   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
             |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 69470 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 69419



to top

>dbj|AB026560.1| Oryza sativa (japonica cultivar-group) OsPAC1 mRNA for alpha 3
           subunit of 20S proteasome, complete cds
          Length = 999

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 126 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 173



to top

>gb|BT016493.1| Zea mays clone Contig326 mRNA sequence
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 184 ttccaggtcgagtacgccatcgaggcc 210
           |||||||||||||||||| ||||||||
Sbjct: 107 ttccaggtcgagtacgccctcgaggcc 133



to top

>emb|AJ293343.1|ZMA293343 Zea mays mRNA for maize 20S proteasome alpha subunit (paa gene)
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgc 200
           ||||||||||||||| || |||| ||| |||||||||||
Sbjct: 126 cttctccccggagggacgcctgtaccaagtcgagtacgc 164



to top

>emb|BX062752.1|CNS09KL0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 199 gccatcgaggccatcaagttgggctccactgccatcggc 237
           ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 969 gccatcgaggcgatcaaatttggctccaccgccatcggc 931



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 184      ttccaggtcgagtacgccatcgaggcc 210
                |||||||||||||||||| ||||||||
Sbjct: 20870397 ttccaggtcgagtacgccctcgaggcc 20870423



to top

>dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0229B10
          Length = 114509

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 184   ttccaggtcgagtacgccatcgaggcc 210
             |||||||||||||||||| ||||||||
Sbjct: 62623 ttccaggtcgagtacgccctcgaggcc 62649



to top

>dbj|AP006067.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0569E11
          Length = 157319

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 184    ttccaggtcgagtacgccatcgaggcc 210
              |||||||||||||||||| ||||||||
Sbjct: 145426 ttccaggtcgagtacgccctcgaggcc 145452



to top

>gb|AY107760.1| Zea mays PCO113667 mRNA sequence
          Length = 1128

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 184 ttccaggtcgagtacgccatcgaggcc 210
           |||||||||||||||||| ||||||||
Sbjct: 138 ttccaggtcgagtacgccctcgaggcc 164



to top

>gb|AY104377.1| Zea mays PCO108605 mRNA sequence
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgc 200
           ||||||||||||||| || |||| ||| |||||||||||
Sbjct: 135 cttctccccggagggacgcctgtaccaagtcgagtacgc 173



to top

>dbj|AB032061.1| Oryza sativa (japonica cultivar-group) OsPAD1 mRNA for alpha 4
           subunit of 20S proteasome, complete cds
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 184 ttccaggtcgagtacgccatcgaggcc 210
           |||||||||||||||||| ||||||||
Sbjct: 94  ttccaggtcgagtacgccctcgaggcc 120



to top

>ref|XM_463746.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1434

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 acgccatcgaggccatcaagtt 218
           ||||||||||||||||||||||
Sbjct: 41  acgccatcgaggccatcaagtt 62



to top

>ref|XM_817190.1| Trypanosoma brucei TREU927 proteasome subunit alpha 5
           (Tb10.100.0120) partial mRNA
          Length = 741

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 196 tacgccatcgaggccatcaagttggg 221
           |||||||||||||| |||||||||||
Sbjct: 76  tacgccatcgaggcaatcaagttggg 101



to top

>gb|AC135114.4| Mus musculus BAC clone RP24-69H7 from chromosome 14, complete sequence
          Length = 181062

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 75    aaatagaaacaagggcttcaaa 96
             ||||||||||||||||||||||
Sbjct: 63081 aaatagaaacaagggcttcaaa 63102



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 197      acgccatcgaggccatcaagtt 218
                ||||||||||||||||||||||
Sbjct: 41879565 acgccatcgaggccatcaagtt 41879586



to top

>dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1147A04
          Length = 150053

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 197    acgccatcgaggccatcaagtt 218
              ||||||||||||||||||||||
Sbjct: 122941 acgccatcgaggccatcaagtt 122962



to top

>gb|AF210324.1|AF210324 Oryza sativa clone C26554 UMP synthase (UMPS1) mRNA, complete cds
          Length = 1750

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 acgccatcgaggccatcaagtt 218
           ||||||||||||||||||||||
Sbjct: 135 acgccatcgaggccatcaagtt 156



to top

>gb|AF210323.1|AF210323 Oryza sativa clone C26785 UMP synthase (UMPS1) mRNA, complete cds
          Length = 1744

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 acgccatcgaggccatcaagtt 218
           ||||||||||||||||||||||
Sbjct: 125 acgccatcgaggccatcaagtt 146



to top

>gb|AF140353.1|AF140353 Trypanosoma brucei brucei 20S proteasome alpha 5 subunit (alpha5)
           gene, complete cds
          Length = 741

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 196 tacgccatcgaggccatcaagttggg 221
           |||||||||||||| |||||||||||
Sbjct: 76  tacgccatcgaggcaatcaagttggg 101



to top

>dbj|AK069565.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023023L08, full
           insert sequence
          Length = 2085

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 acgccatcgaggccatcaagtt 218
           ||||||||||||||||||||||
Sbjct: 141 acgccatcgaggccatcaagtt 162



to top

>dbj|AB031395.1| Oryza sativa (japonica cultivar-group) mRNA for UMP synthase 1,
           complete cds
          Length = 1743

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 acgccatcgaggccatcaagtt 218
           ||||||||||||||||||||||
Sbjct: 125 acgccatcgaggccatcaagtt 146



to top

>gb|AE010335.1| Methanopyrus kandleri AV19 section 34 of 157 of the complete genome
          Length = 12939

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 168  cccggaggggcggctgttccaggtcgagtacgc 200
            |||||| || || ||||||||||||||||||||
Sbjct: 6573 cccggacggtcgactgttccaggtcgagtacgc 6541



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 171     ggaggggcggctgttccaggtcgag 195
               |||||||||||||||| ||||||||
Sbjct: 1659033 ggaggggcggctgttcgaggtcgag 1659009



to top

>ref|XM_658384.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5872.2), mRNA
          Length = 741

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 137 cggagtacgaccgtggggtcaacaccttctccccgga 173
           |||| |||||||||||  ||||||||||||| |||||
Sbjct: 17  cggaatacgaccgtggaatcaacaccttctctccgga 53



to top

>ref|XM_804684.1| Trypanosoma cruzi strain CL Brener proteasome alpha 1 subunit
           (Tc00.1047053506167.40) partial mRNA
          Length = 798

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 178 cggctgttccaggtcgagtacgcca 202
           |||||||||||||| ||||||||||
Sbjct: 52  cggctgttccaggtagagtacgcca 76



to top

>ref|XM_797774.1| Trypanosoma cruzi strain CL Brener proteasome alpha 7 subunit
           (Tc00.1047053507785.20) partial mRNA
          Length = 148

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 178 cggctgttccaggtcgagtacgcca 202
           |||||||||||||| ||||||||||
Sbjct: 52  cggctgttccaggtagagtacgcca 76



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 199     gccatcgaggccatcaagttg 219
               |||||||||||||||||||||
Sbjct: 2637618 gccatcgaggccatcaagttg 2637598



to top

>emb|AL160290.15| Human DNA sequence from clone RP11-338O1 on chromosome 10 Contains a
              novel gene and the 5' end of a novel gene, complete
              sequence
          Length = 201397

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 306    cagtgtggagaaaatcatgga 326
              |||||||||||||||||||||
Sbjct: 115538 cagtgtggagaaaatcatgga 115558



to top

>ref|XM_963562.1| PREDICTED: Tribolium castaneum similar to proteasome (prosome,
           macropain) subunit, alpha type 6 (LOC657082), mRNA
          Length = 815

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 163 ttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaa 215
           |||||||| ||||||||||| | ||| |||||||| ||| || | ||||||||
Sbjct: 46  ttctcccccgaggggcggctctaccaagtcgagtatgccttcaaagccatcaa 98



to top

>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29
          Length = 283100

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 186   ccaggtcgagtacgccatcgaggcc 210
             ||||| |||||||||||||||||||
Sbjct: 60977 ccaggccgagtacgccatcgaggcc 60953



to top

>dbj|AB225066.1| Aspergillus oryzae cDNA, contig sequence: AoEST1917
          Length = 1047

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  ttcggcacgaggctcctctct 21
          |||||||||||||||||||||
Sbjct: 3  ttcggcacgaggctcctctct 23



to top

>gb|AY184356.1| Gasterosteus aculeatus proteasome subunit alpha 3 mRNA, partial cds
          Length = 283

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 159 caccttctccccggaggggcggctgttccaggtcgagtacgccat 203
           ||||||||| || || |||||  |||||||||| |||||||||||
Sbjct: 82  caccttctctccagatgggcgcgtgttccaggtggagtacgccat 126



to top

>gb|AC112259.4| Mus musculus BAC clone RP23-179F7 from 12, complete sequence
          Length = 190525

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 464   ctatctgtgacttggctttgc 484
             |||||||||||||||||||||
Sbjct: 78008 ctatctgtgacttggctttgc 77988



to top

>gb|U75302.1|TCU75302 Trypanosoma cruzi 29 kDa proteasome subunit class II (tcpr29B)
           mRNA, complete cds
          Length = 1155

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 178 cggctgttccaggtcgagtacgcca 202
           |||||||||||||| ||||||||||
Sbjct: 70  cggctgttccaggtagagtacgcca 94



to top

>gb|U73851.1|TCU73851 Trypanosoma cruzi 29 kDa proteasome subunit TCPR29 (tcpr29) mRNA,
           complete cds
          Length = 1199

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 178 cggctgttccaggtcgagtacgcca 202
           |||||||||||||| ||||||||||
Sbjct: 98  cggctgttccaggtagagtacgcca 122



to top

>dbj|AB045320.1| Homo sapiens genomic DNA, chromosome 10q25-q26, clone:423L12, complete
             sequence
          Length = 91826

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 306   cagtgtggagaaaatcatgga 326
             |||||||||||||||||||||
Sbjct: 77264 cagtgtggagaaaatcatgga 77244



to top

>ref|NM_105712.1| Arabidopsis thaliana SRO3 AT1G70440 (SRO3) mRNA, complete cds
          Length = 918

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 488 ttggtgaaggtgatgaagaa 507
           ||||||||||||||||||||
Sbjct: 473 ttggtgaaggtgatgaagaa 492



to top

>gb|DQ088635.1| Tramitichromis intermedius putative green sensitive pigment gene,
           complete cds
          Length = 1626

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 528 tgttgtcctggctgttgaga 547



to top

>gb|DQ088632.1| Tramitichromis intermedius putative green sensitive visual pigment
           gene, complete cds
          Length = 1576

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 498 tgttgtcctggctgttgaga 517



to top

>gb|DQ088631.1| Melanochromis vermivorus putative green sensitive visual pigment
           gene, complete cds
          Length = 1579

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 501 tgttgtcctggctgttgaga 520



to top

>gb|DQ088630.1| Pseudotropheus acei putative green sensitive visual pigment gene,
           complete cds
          Length = 1579

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 501 tgttgtcctggctgttgaga 520



to top

>gb|DQ088651.1| Synthetic construct green sensitive visual pigment RH2Aalpha gene,
           complete cds
          Length = 1104

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 408 tgttgtcctggctgttgaga 427



to top

>ref|NM_185665.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 957

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 120 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 167



to top

>ref|XM_514406.1| PREDICTED: Pan troglodytes similar to vacuolar protein sorting 13D
            (LOC457969), mRNA
          Length = 13179

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 7440 agtgtggagaaaatcatgga 7421



to top

>gb|BT016358.1| Zea mays clone Contig191 mRNA sequence
          Length = 994

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 68  cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 115



to top

>gb|AF030453.1| Homo sapiens chromosome 7 clone PAC 76h2 map 7q22, complete sequence
          Length = 125108

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 219  gggctccactgccatcggct 238
            ||||||||||||||||||||
Sbjct: 1480 gggctccactgccatcggct 1461



to top

>gb|AF024533.1| Homo sapiens cosmid 123E15, complete sequence
          Length = 84912

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  gggctccactgccatcggct 238
            ||||||||||||||||||||
Sbjct: 8880 gggctccactgccatcggct 8899



to top

>gb|AC105169.9| Mus musculus chromosome 10, clone RP24-124K4, complete sequence
          Length = 167310

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 320   tcatggaaattgatgagcat 339
             ||||||||||||||||||||
Sbjct: 62144 tcatggaaattgatgagcat 62125



to top

>ref|NM_148976.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1
           (PSMA1), transcript variant 1, mRNA
          Length = 1480

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 738 tctccttattgctggttatgatga 761



to top

>ref|NM_002786.2| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1
           (PSMA1), transcript variant 2, mRNA
          Length = 1238

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 496 tctccttattgctggttatgatga 519



to top

>gb|AY558511.1| Saccharomyces cerevisiae clone FLH003175.01X YGR253C gene, complete
           cds
          Length = 783

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 313 gagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggcctta 364
           ||||||||| |||| ||||||   ||| |||| |||||||||||||| ||||
Sbjct: 193 gagaaaatcgtggagattgatcgtcatattggttgtgcaatgagtgggctta 244



to top

>gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger protein 7 (zinc7) gene,
             partial cds; and zinc finger protein 8 (zinc8), heavy
             chain clathrin (claH), and alpha6 proteasome subunit
             (pr29A) genes, complete cds
          Length = 14737

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 179   ggctgttccaggtcgagtacgcca 202
             ||||||||||||| ||||||||||
Sbjct: 13636 ggctgttccaggtagagtacgcca 13659



to top

>emb|CR727970.2|CNS0GONC Tetraodon nigroviridis full-length cDNA
          Length = 989

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 165 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 212



to top

>emb|CR727498.2|CNS0GOA8 Tetraodon nigroviridis full-length cDNA
          Length = 989

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 165 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 212



to top

>emb|CR727201.2|CNS0GO1Z Tetraodon nigroviridis full-length cDNA
          Length = 973

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 150 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 197



to top

>emb|CR725216.2|CNS0GMIU Tetraodon nigroviridis full-length cDNA
          Length = 959

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 135 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 182



to top

>emb|CR705071.2|CNS0G6ZF Tetraodon nigroviridis full-length cDNA
          Length = 906

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 86  tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 133



to top

>emb|CR704698.2|CNS0G6P2 Tetraodon nigroviridis full-length cDNA
          Length = 993

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 171 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 218



to top

>emb|CR700470.2|CNS0G3FM Tetraodon nigroviridis full-length cDNA
          Length = 970

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 148 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 195



to top

>emb|CR699896.2|CNS0G2ZO Tetraodon nigroviridis full-length cDNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 171 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 218



to top

>emb|CR698069.2|CNS0G1KX Tetraodon nigroviridis full-length cDNA
          Length = 968

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 146 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 193



to top

>emb|CR697897.1|CNS0G1G5 Tetraodon nigroviridis full-length cDNA
          Length = 953

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 134 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 181



to top

>emb|CR694814.2|CNS0FZ2I Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 157 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 204



to top

>emb|CR692623.2|CNS0FXDN Tetraodon nigroviridis full-length cDNA
          Length = 972

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 158 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 205



to top

>emb|CR685960.2|CNS0FS8K Tetraodon nigroviridis full-length cDNA
          Length = 993

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 171 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 218



to top

>emb|CR688259.2|CNS0FU0F Tetraodon nigroviridis full-length cDNA
          Length = 967

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 143 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 190



to top

>emb|CR688135.1|CNS0FTWZ Tetraodon nigroviridis full-length cDNA
          Length = 935

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 126 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 173



to top

>emb|CR681238.2|CNS0FOLE Tetraodon nigroviridis full-length cDNA
          Length = 977

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 152 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 199



to top

>emb|CR679103.2|CNS0FMY3 Tetraodon nigroviridis full-length cDNA
          Length = 1128

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 316 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 363



to top

>emb|CR678237.2|CNS0FMA9 Tetraodon nigroviridis full-length cDNA
          Length = 997

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 170 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 217



to top

>emb|CR677793.2|CNS0FLY1 Tetraodon nigroviridis full-length cDNA
          Length = 926

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 166 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 213



to top

>emb|CR676703.2|CNS0FL3V Tetraodon nigroviridis full-length cDNA
          Length = 973

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 145 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 192



to top

>emb|CR675798.2|CNS0FKF0 Tetraodon nigroviridis full-length cDNA
          Length = 1137

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 315 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 362



to top

>emb|CR673260.2|CNS0FIGI Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 199 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 246



to top

>emb|CR672112.2|CNS0FHKM Tetraodon nigroviridis full-length cDNA
          Length = 982

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 157 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 204



to top

>emb|CR672105.2|CNS0FHKF Tetraodon nigroviridis full-length cDNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 178 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 225



to top

>emb|CR671749.2|CNS0FHAJ Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 167 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 214



to top

>emb|CR671990.2|CNS0FHH8 Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 329 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 376



to top

>emb|CR671579.2|CNS0FH5T Tetraodon nigroviridis full-length cDNA
          Length = 1009

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 188 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 235



to top

>emb|CR670122.2|CNS0FG1C Tetraodon nigroviridis full-length cDNA
          Length = 983

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 161 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 208



to top

>emb|CR668423.2|CNS0FEQ5 Tetraodon nigroviridis full-length cDNA
          Length = 994

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 167 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 214



to top

>emb|CR667949.2|CNS0FECZ Tetraodon nigroviridis full-length cDNA
          Length = 986

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 159 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 206



to top

>emb|CR664328.2|CNS0FBKE Tetraodon nigroviridis full-length cDNA
          Length = 1099

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 277 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 324



to top

>emb|CR661379.2|CNS0F9AH Tetraodon nigroviridis full-length cDNA
          Length = 983

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 170 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 217



to top

>emb|CR658674.1|CNS0F77C Tetraodon nigroviridis full-length cDNA
          Length = 1019

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 238 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 285



to top

>emb|CR646148.2|CNS0EXJE Tetraodon nigroviridis full-length cDNA
          Length = 966

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 166 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 213
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 146 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 193



to top

>gb|U40413.2| Caenorhabditis elegans cosmid C18B2, complete sequence
          Length = 30903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 246  taagtatggtgttgtcctggctgttgag 273
            |||| ||||| |||||||||||||||||
Sbjct: 2956 taaggatggtattgtcctggctgttgag 2983



to top

>gb|AC144389.22| Medicago truncatula clone mth2-25e14, complete sequence
          Length = 127170

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 546    tggtcatgatgaaaatggac 565
              ||||||||||||||||||||
Sbjct: 109958 tggtcatgatgaaaatggac 109939



to top

>gb|DQ124327.1| Tribalister striatellus isolate extract MSC132 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 661

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 318 aatcatggaaattgatgagc 337
           ||||||||||||||||||||
Sbjct: 504 aatcatggaaattgatgagc 485



to top

>emb|BX682532.4| Human DNA sequence from clone WI2-801539E12 on chromosome 1 Contains
            part of the VPS13D gene for vacuolar protein sorting 13D
            (yeast), complete sequence
          Length = 41821

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 6198 agtgtggagaaaatcatgga 6179



to top

>ref|XM_501939.1| Yarrowia lipolytica CLIB122, YALI0C17325g predicted mRNA
          Length = 870

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 184 ttccaggtcgagtacgccatcgaggccatcaa 215
           |||||||| ||||||||| | |||||||||||
Sbjct: 55  ttccaggtggagtacgcccttgaggccatcaa 86



to top

>ref|NM_015378.2| Homo sapiens vacuolar protein sorting 13 homolog D (S. cerevisiae)
            (VPS13D), transcript variant 1, mRNA
          Length = 16341

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 7389 agtgtggagaaaatcatgga 7370



to top

>ref|NM_018156.2| Homo sapiens vacuolar protein sorting 13 homolog D (S. cerevisiae)
            (VPS13D), transcript variant 2, mRNA
          Length = 16266

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 7389 agtgtggagaaaatcatgga 7370



to top

>ref|XM_961880.1| PREDICTED: Tribolium castaneum similar to proteasome (prosome,
           macropain) subunit, alpha type 1 (LOC655339), mRNA
          Length = 912

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 186 ccaggtcgagtacgccatcgaggccatcaagttgggctcc 225
           |||||| ||||||||||| |||||| | || |||||||||
Sbjct: 138 ccaggtggagtacgccatggaggccgtaaatttgggctcc 177



to top

>emb|X99228.1|SCCHRVII S.cerevisiae genomic sequence from chromosome VII
          Length = 10534

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 313  gagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggcctta 364
            ||||||||| |||| ||||||   ||| |||| |||||||||||||| ||||
Sbjct: 1573 gagaaaatcgtggagattgatcgtcatattggttgtgcaatgagtgggctta 1522



to top

>emb|X73293.1|MVRPO M.vannielii genes rpoH, rpoB and rpoA
          Length = 7960

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 488 ttggtgaaggtgatgaagaa 507
           ||||||||||||||||||||
Sbjct: 946 ttggtgaaggtgatgaagaa 965



to top

>emb|X61969.1|HSMPNU H.sapiens mRNA for macropain subunit nu
          Length = 1244

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 498 tctccttattgctggttatgatga 521



to top

>gb|AY993505.1| Uncultured bacterium clone C19_C20 16S ribosomal RNA gene, partial
            sequence
          Length = 1291

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 87   gggcttcaaactccgatccg 106
            ||||||||||||||||||||
Sbjct: 1261 gggcttcaaactccgatccg 1242



to top

>gb|AY990789.1| Uncultured bacterium clone C4_G011 16S ribosomal RNA gene, partial
            sequence
          Length = 1291

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 87   gggcttcaaactccgatccg 106
            ||||||||||||||||||||
Sbjct: 1262 gggcttcaaactccgatccg 1243



to top

>gb|BC022372.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:23915
           IMAGE:4770620), complete cds
          Length = 1167

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 426 tctccttattgctggttatgatga 449



to top

>gb|BC009576.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:14575
           IMAGE:4105838), complete cds
          Length = 958

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 447 tctccttattgctggttatgatga 470



to top

>gb|BC015105.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:22853
           IMAGE:3950568), complete cds
          Length = 1218

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 473 tctccttattgctggttatgatga 496



to top

>gb|BC015356.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:21459
           IMAGE:3452219), complete cds
          Length = 1169

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 442 tctccttattgctggttatgatga 465



to top

>gb|BC002577.2| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:1667
           IMAGE:3140784), complete cds
          Length = 1219

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 458 tctccttattgctggttatgatga 481



to top

>gb|BC008472.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:14751
           IMAGE:4282076), complete cds
          Length = 1174

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 439 tctccttattgctggttatgatga 462



to top

>gb|BC005932.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:14542
           IMAGE:4078894), complete cds
          Length = 1215

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 474 tctccttattgctggttatgatga 497



to top

>gb|BT008064.1| Synthetic construct Homo sapiens proteasome (prosome, macropain)
           subunit, alpha type, 1 mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 393 tctccttattgctggttatgatga 416



to top

>gb|BT006647.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1
           mRNA, complete cds
          Length = 792

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 393 tctccttattgctggttatgatga 416



to top

>emb|X64918.1|SCPUP2A S.cerevisiae PUP2 gene
          Length = 1174

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 313 gagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggcctta 364
           ||||||||| |||| ||||||   ||| |||| |||||||||||||| ||||
Sbjct: 427 gagaaaatcgtggagattgatcgtcatattggttgtgcaatgagtgggctta 478



to top

>emb|AJ608775.1| Homo sapiens mRNA for VPS13D protein, transcript variant 2A (VPS13D
            gene)
          Length = 14559

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 7378 agtgtggagaaaatcatgga 7359



to top

>emb|AJ608774.1| Homo sapiens mRNA for VPS13D protein, transcript variant 1A (VPS13D
            gene)
          Length = 14634

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 7378 agtgtggagaaaatcatgga 7359



to top

>emb|CR623849.1| full-length cDNA clone CS0DA006YP22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 468 tctccttattgctggttatgatga 491



to top

>dbj|AK125118.1| Homo sapiens cDNA FLJ43128 fis, clone CTONG3005325
          Length = 4910

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 1136 agtgtggagaaaatcatgga 1117



to top

>emb|CR620774.1| full-length cDNA clone CS0DI030YJ03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1146

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 431 tctccttattgctggttatgatga 454



to top

>emb|CR617103.1| full-length cDNA clone CS0DI052YO22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1129

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 450 tctccttattgctggttatgatga 473



to top

>emb|CR612800.1| full-length cDNA clone CS0DA012YD16 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1218

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 528 tctccttattgctggttatgatga 551



to top

>emb|CR610121.1| full-length cDNA clone CS0DI083YG05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1144

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 434 tctccttattgctggttatgatga 457



to top

>emb|CR607472.1| full-length cDNA clone CS0DB001YP20 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1527

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 849 tctccttattgctggttatgatga 872



to top

>emb|CR607412.1| full-length cDNA clone CS0DE014YI10 of Placenta of Homo sapiens
           (human)
          Length = 1165

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 457 tctccttattgctggttatgatga 480



to top

>emb|CR599736.1| full-length cDNA clone CS0DK007YL19 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1105

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 391 tctccttattgctggttatgatga 414



to top

>emb|CR599649.1| full-length cDNA clone CS0DI069YC24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1133

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 436 tctccttattgctggttatgatga 459



to top

>emb|CR598938.1| full-length cDNA clone CS0DI075YJ10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1090

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 391 tctccttattgctggttatgatga 414



to top

>emb|CR597642.1| full-length cDNA clone CL0BB027ZF05 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1143

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 431 tctccttattgctggttatgatga 454



to top

>dbj|AK001481.1| Homo sapiens cDNA FLJ10619 fis, clone NT2RP2005472
          Length = 3989

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 307 agtgtggagaaaatcatgga 326
           ||||||||||||||||||||
Sbjct: 526 agtgtggagaaaatcatgga 507



to top

>gb|AF155766.1| Pisum sativum clone Psat27-29 repetitive sequence
          Length = 2089

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 487  tttggtgaaggtgatgaaga 506
            ||||||||||||||||||||
Sbjct: 2085 tttggtgaaggtgatgaaga 2066



to top

>gb|DQ311211.1| Bombyx mori proteasome zeta subunit mRNA, complete cds
          Length = 1827

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 179 ggctgttccaggtcgagtacgccatcgaggccatcaagttgggctccactgc 230
           ||||||||||||| || |||||||| || || |||||  | |||||||||||
Sbjct: 189 ggctgttccaggtggaatacgccatagaagctatcaaacttggctccactgc 240



to top

>gb|AC150443.2| Medicago truncatula chromosome 7 BAC clone mth2-71o19, complete
            sequence
          Length = 132097

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 546  tggtcatgatgaaaatggac 565
            ||||||||||||||||||||
Sbjct: 4105 tggtcatgatgaaaatggac 4086



to top

>gb|AF247124.1|AF247124 Oreochromis niloticus putative green sensitive opsin RH2 gene,
           complete cds
          Length = 1606

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 521 tgttgtcctggctgttgaga 540



to top

>ref|NM_076219.3| Caenorhabditis elegans C18B2.4 (C18B2.4) mRNA, complete cds
          Length = 1037

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 246 taagtatggtgttgtcctggctgttgag 273
           |||| ||||| |||||||||||||||||
Sbjct: 726 taaggatggtattgtcctggctgttgag 699



to top

>emb|AL113369.1|CNS01ATD Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 460 caagctatctgtgacttggctttgcgctttggtgaaggtg 499
           ||||| |||||||| ||||| ||| | |||||||||||||
Sbjct: 514 caagccatctgtgatttggccttgagatttggtgaaggtg 553



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                                
Query: 162      cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
                |||||| |||||||||||||| | ||||||  ||||||| || |||||
Sbjct: 16677279 cttctcgccggaggggcggctctaccaggtgcagtacgcgatggaggc 16677326



to top

>gb|AY775092.1| Lethrinops parvidens cone opsin (RH2) gene, complete cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 515 tgttgtcctggctgttgaga 534



to top

>gb|AY775090.1| Aulonocara hueseri cone opsin (RH2) gene, complete cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 515 tgttgtcctggctgttgaga 534



to top

>gb|AY775089.1| Tropheus duboisi cone opsin (RH2) gene, complete cds
          Length = 1569

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 515 tgttgtcctggctgttgaga 534



to top

>gb|AY775070.1| Stigmatochromis modestus cone opsin (RH2) mRNA, complete cds
          Length = 1059

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 408 tgttgtcctggctgttgaga 427



to top

>gb|AY775068.1| Neolamprologus brichardi cone opsin (RH2) mRNA, complete cds
          Length = 1169

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 428 tgttgtcctggctgttgaga 447



to top

>gb|AY775067.1| Ophthalmotilapia ventralis cone opsin (RH2) mRNA, complete cds
          Length = 1171

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 tgttgtcctggctgttgaga 274
           ||||||||||||||||||||
Sbjct: 430 tgttgtcctggctgttgaga 449



to top

>gb|AC010967.3| Homo sapiens BAC clone RP11-7H13 from 2, complete sequence
          Length = 197328

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 68   cgtgtagaaatagaaacaag 87
            ||||||||||||||||||||
Sbjct: 7410 cgtgtagaaatagaaacaag 7391



to top

>dbj|AP002864.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0033B09
          Length = 143545

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                             
Query: 162   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
             |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 36321 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 36368



to top

>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone
              P0680A03
          Length = 156054

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 162    cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
              |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 111171 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 111218



to top

>dbj|AP003808.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1115_C05
          Length = 146585

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                             
Query: 162   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
             |||||| |||||||||||||| | ||||||  ||||||| || |||||
Sbjct: 17191 cttctcgccggaggggcggctctaccaggtgcagtacgcgatggaggc 17238



to top

>gb|AY892634.1| Synthetic construct Homo sapiens clone FLH015536.01L proteasome
           alpha type subunit 1 (PSMA1) mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 393 tctccttattgctggttatgatga 416



to top

>gb|AY890152.1| Synthetic construct Homo sapiens clone FLH015541.01X proteasome
           subunit alpha type 1 (PSMA1) mRNA, complete cds
          Length = 792

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 393 tctccttattgctggttatgatga 416



to top

>gb|AY890151.1| Synthetic construct Homo sapiens clone FLH015540.01X proteasome
           subunit alpha type 1 (PSMA1) mRNA, complete cds
          Length = 792

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 393 tctccttattgctggttatgatga 416



to top

>emb|BX641035.1|HSM806688 Homo sapiens mRNA; cDNA DKFZp686D20110 (from clone DKFZp686D20110)
          Length = 8167

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 307 agtgtggagaaaatcatgga 326
           ||||||||||||||||||||
Sbjct: 970 agtgtggagaaaatcatgga 951



to top

>dbj|AB007922.3| Homo sapiens mRNA for KIAA0453 protein, partial cds
          Length = 10969

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  agtgtggagaaaatcatgga 326
            ||||||||||||||||||||
Sbjct: 3716 agtgtggagaaaatcatgga 3697



to top

>ref|NM_211393.1| Eremothecium gossypii AGL336Wp (AGL336W), mRNA
          Length = 921

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 181 ctgttccaggtcgagtacgccatcgaggccatcaag 216
           ||||||||||| ||||||||  | ||||||||||||
Sbjct: 274 ctgttccaggtggagtacgcgctagaggccatcaag 309



to top

>dbj|AK067977.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123K20, full
           insert sequence
          Length = 957

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 120 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 167



to top

>gb|AY107786.1| Zea mays PCO106817 mRNA sequence
          Length = 1163

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 162 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 209
           |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 206 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 253



to top

>emb|Z73038.1|SCYGR253C S.cerevisiae chromosome VII reading frame ORF YGR253c
          Length = 2738

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 313 gagaaaatcatggaaattgatgagcatgttggctgtgcaatgagtggcctta 364
           ||||||||| |||| ||||||   ||| |||| |||||||||||||| ||||
Sbjct: 760 gagaaaatcgtggagattgatcgtcatattggttgtgcaatgagtgggctta 709



to top

>dbj|D00759.1|HUMPSC2 Homo sapiens mRNA for proteasome subunit C2, complete cds
          Length = 1105

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 534 tctccttattgctggtcatgatga 557
           |||||||||||||||| |||||||
Sbjct: 434 tctccttattgctggttatgatga 457



to top

>emb|AL589986.15| Human DNA sequence from clone RP11-107M16 on chromosome 1 Contains the
              THH gene for trichohyalin, two novel genes, a family with
              sequence similarity 16 member A  X-linked (FAM16AX)
              pseudogene, the 5' end of a variant of a novel gene and the
              gene for a novel S-100/ICaBP type calcium binding domain EF
              hand domain and Filaggrin domain containing protein,
              complete sequence
          Length = 151578

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    aaaatcatggaaattgatga 335
              ||||||||||||||||||||
Sbjct: 128808 aaaatcatggaaattgatga 128827



to top

>gb|AC003671.1|F17O7 Arabidopsis thaliana chromosome 1 BAC F17O7 complete sequence
          Length = 92128

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 488  ttggtgaaggtgatgaagaa 507
            ||||||||||||||||||||
Sbjct: 4653 ttggtgaaggtgatgaagaa 4672



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 184     ttccaggtcgagtacgccatcgaggccatcaa 215
               |||||||| ||||||||| | |||||||||||
Sbjct: 2435712 ttccaggtggagtacgcccttgaggccatcaa 2435743


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,632,727
Number of Sequences: 3902068
Number of extensions: 4632727
Number of successful extensions: 86390
Number of sequences better than 10.0: 254
Number of HSP's better than 10.0 without gapping: 256
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85763
Number of HSP's gapped (non-prelim): 601
length of query: 639
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 616
effective length of database: 17,143,297,704
effective search space: 10560271385664
effective search space used: 10560271385664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top