ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal4h22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK103487.1| Oryza sativa (japonica cultivar-group) cDNA clon... 632 e-178
2dbj|AK059521.1| Oryza sativa (japonica cultivar-group) cDNA clon... 632 e-178
3dbj|AB026561.1| Oryza sativa (japonica cultivar-group) OsPAE1 mR... 632 e-178
4gb|BT017253.1| Zea mays clone EL01N0307H03.c mRNA sequence 539 e-150
5gb|BT019190.1| Zea mays clone Contig862.F mRNA sequence 446 e-122
6gb|BT017580.1| Zea mays clone EL01N0429D12.c mRNA sequence 248 2e-62
7ref|NM_104262.1| Arabidopsis thaliana PAE1; endopeptidase/ pepti... 246 8e-62
8gb|AY114616.1| Arabidopsis thaliana 20S proteasome subunit PAE1 ... 246 8e-62
9gb|AY072371.1| Arabidopsis thaliana 20S proteasome subunit PAE1 ... 246 8e-62
10gb|AY086045.1| Arabidopsis thaliana clone 20801 mRNA, complete s... 246 8e-62
11gb|AY110522.1| Zea mays CL4677_2 mRNA sequence 244 3e-61
12gb|AF255338.1|AF255338 Glycine max 20S proteasome subunit mRNA, ... 240 5e-60
13gb|AF043524.1|AF043524 Arabidopsis thaliana 20S proteasome subun... 238 2e-59
14gb|BT014224.1| Lycopersicon esculentum clone 133419F, mRNA sequence 236 7e-59
15ref|NM_112287.2| Arabidopsis thaliana PAE2; endopeptidase/ pepti... 228 2e-56
16gb|AY062970.1| Arabidopsis thaliana putative 20S proteasome subu... 228 2e-56
17gb|AF370245.1| Arabidopsis thaliana putative 20S proteasome subu... 228 2e-56
18emb|BX823159.1|CNS0A658 Arabidopsis thaliana Full-length cDNA Co... 228 2e-56
19emb|BX822992.1|CNS0A648 Arabidopsis thaliana Full-length cDNA Co... 228 2e-56
20gb|AF043525.1|AF043525 Arabidopsis thaliana 20S proteasome subun... 228 2e-56
21emb|BX822092.1|CNS0A644 Arabidopsis thaliana Full-length cDNA Co... 206 6e-50
22emb|BX822457.1|CNS0A63I Arabidopsis thaliana Full-length cDNA Co... 192 1e-45
23gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome... 155 2e-34
24dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
25gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 155 2e-34
26dbj|AK220949.1| Arabidopsis thaliana mRNA for hypothetical prote... 137 5e-29
27emb|AJ291735.1|NTA291735 Nicotiana tabacum partial mRNA for puta... 133 8e-28
28emb|BX824071.1|CNS0A5L7 Arabidopsis thaliana Full-length cDNA Co... 117 5e-23
29emb|AJ418041.1|PPA418041 Physcomitrella patens mRNA for 20S prot... 115 2e-22
30gb|DQ214008.1| Taeniopygia guttata clone 0064P0007F03 proteasome... 98 4e-17
31ref|NM_001031407.1| Gallus gallus proteasome (prosome, macropain... 96 2e-16
32emb|AJ720305.1| Gallus gallus mRNA for hypothetical protein, clo... 96 2e-16
33emb|CR386956.1| Gallus gallus finished cDNA, clone ChEST102f7 96 2e-16
34gb|DQ214009.1| Taeniopygia guttata clone 0061P0007F09 proteasome... 90 1e-14
35dbj|AB022220.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 88 4e-14
36gb|AY232148.1| Drosophila yakuba clone yak-ad_ProsMA5 mRNA sequence 78 4e-11
37ref|NM_166221.2| Drosophila melanogaster Proteasome subunit CG1... 76 2e-10
38ref|NM_057854.3| Drosophila melanogaster Proteasome subunit CG1... 76 2e-10
39gb|AY061404.1| Drosophila melanogaster LD33318 full length cDNA 76 2e-10
40gb|AC009535.9| Drosophila melanogaster, chromosome 2R, region 54... 76 2e-10
41gb|AC008004.5|AC008004 Drosophila melanogaster, chromosome 2R, r... 76 2e-10
42gb|AE003803.4| Drosophila melanogaster chromosome 2R, section 47... 76 2e-10
43gb|U64721.1|DMU64721 Drosophila melanogaster 20S proteasome alph... 76 2e-10
44emb|BX063332.1|CNS09L14 Single read from an extremity of a full-... 74 6e-10
45emb|BX062751.1|CNS09KKZ Single read from an extremity of a full-... 74 6e-10
46emb|BX056699.1|CNS09FWV Single read from an extremity of a full-... 74 6e-10
47emb|BX031436.1|CNS08WF4 Single read from an extremity of a full-... 74 6e-10
48emb|BX019821.1|CNS08NGH Single read from an extremity of a full-... 74 6e-10
49emb|BX017936.1|CNS08M04 Single read from an extremity of a full-... 74 6e-10
50emb|BX018241.1|CNS08M8L Single read from an extremity of a full-... 74 6e-10
51emb|BX015753.1|CNS08KBH Single read from an extremity of a full-... 74 6e-10
52emb|BX011882.1|CNS08HBY Single read from an extremity of a full-... 74 6e-10
53emb|BX011881.1|CNS08HBX Single read from an extremity of a full-... 74 6e-10
54emb|BX011202.1|CNS08GT2 Single read from an extremity of a full-... 74 6e-10
55emb|BX010636.1|CNS08GDC Single read from an extremity of a full-... 74 6e-10
56emb|BX009604.1|CNS08FKO Single read from an extremity of a full-... 74 6e-10
57dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 74 6e-10
58ref|XM_314945.2| Anopheles gambiae str. PEST ENSANGP00000019329 ... 74 6e-10
59gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 74 6e-10
60emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa... 74 6e-10
61emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa... 74 6e-10
62gb|AC009324.2| Arabidopsis thaliana chromosome I BAC T18A20 geno... 68 4e-08
63emb|BX066418.1|CNS09NEU Single read from an extremity of a full-... 66 2e-07
64gb|BT017945.1| Zea mays clone EL01N0521D09.c mRNA sequence 64 6e-07
65ref|XM_367205.1| Magnaporthe grisea 70-15 hypothetical protein (... 64 6e-07
66gb|AY104937.1| Zea mays PCO082324 mRNA sequence 64 6e-07
67ref|XM_464030.1| Oryza sativa (japonica cultivar-group), mRNA 62 2e-06
68dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
69dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
70dbj|AK109376.2| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
71dbj|AP004799.3| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
72dbj|AK103646.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
73dbj|D37886.1|RICPC2SA Rice mRNA for proteasome C2 subunit, compl... 62 2e-06
74gb|AF424643.1| Phytophthora infestans clone MY-03-E-06 proteasom... 58 4e-05
75ref|XM_956973.1| Neurospora crassa OR74A hypothetical protein (N... 56 1e-04
76ref|XM_324651.1| Neurospora crassa OR74A hypothetical protein (N... 56 1e-04
77dbj|AK099876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
78gb|BC060575.1| Rattus norvegicus proteasome (prosome, macropain)... 54 6e-04
79ref|XM_451224.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A05093g ... 54 6e-04
80emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 54 6e-04
81ref|NM_017282.1| Rattus norvegicus proteasome (prosome, macropai... 54 6e-04
82dbj|D10756.1|RATPRORZ Rat mRNA for proteasome subunit R-ZETA, co... 54 6e-04
83gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
84ref|XM_757288.1| Ustilago maydis 521 hypothetical protein (UM062... 52 0.002
85ref|XM_750383.1| Aspergillus fumigatus Af293 proteasome componen... 52 0.002
86gb|AY431444.1| Aedes aegypti ASAP ID: 43014 proteasome endopepti... 50 0.009
87gb|DQ440413.1| Aedes aegypti clone AET-5533 20S proteasome regul... 50 0.009
88ref|NM_185696.1| Oryza sativa (japonica cultivar-group), Ozsa804... 48 0.036
89ref|NM_185686.1| Oryza sativa (japonica cultivar-group), Ozsa803... 48 0.036
90ref|XM_525179.1| PREDICTED: Pan troglodytes LOC469795 (LOC469795... 48 0.036
91ref|NM_002790.2| Homo sapiens proteasome (prosome, macropain) su... 48 0.036
92gb|BT019717.1| Homo sapiens proteasome (prosome, macropain) subu... 48 0.036
93gb|BT019716.1| Synthetic construct Homo sapiens proteasome (pros... 48 0.036
94gb|BC102020.1| Homo sapiens proteasome (prosome, macropain) subu... 48 0.036
95gb|BC102019.1| Homo sapiens proteasome (prosome, macropain) subu... 48 0.036
96gb|BC102018.1| Homo sapiens proteasome (prosome, macropain) subu... 48 0.036
97gb|BC103751.1| Homo sapiens proteasome (prosome, macropain) subu... 48 0.036
98ref|NM_001015566.1| Bos taurus proteasome (prosome, macropain) s... 48 0.036
99ref|XR_002428.1| PREDICTED: Mus musculus similar to Proteasome s... 48 0.036
100ref|XM_386335.1| Gibberella zeae PH-1 chromosome 3 conserved hyp... 48 0.036
101gb|AC134331.2| Mus musculus BAC clone RP24-344O12 from chromosom... 48 0.036
102ref|XM_736381.1| Plasmodium chabaudi chabaudi proteasome subunit... 48 0.036
103emb|X61970.1|HSMPZE H.sapiens mRNA for macropain subunit zeta 48 0.036
104emb|X52319.1|DMPROS29 Fruit fly mRNA for proteosome subunit 48 0.036
105emb|CR456847.1| Homo sapiens full open reading frame cDNA clone ... 48 0.036
106emb|CR614020.1| full-length cDNA clone CS0DB008YN13 of Neuroblas... 48 0.036
107emb|CR602805.1| full-length cDNA clone CS0DC009YD16 of Neuroblas... 48 0.036
108emb|CR603065.1| full-length cDNA clone CS0DI073YD09 of Placenta ... 48 0.036
109emb|CR601200.1| full-length cDNA clone CS0DI075YM05 of Placenta ... 48 0.036
110emb|CR600422.1| full-length cDNA clone CS0DI075YA07 of Placenta ... 48 0.036
111emb|CR600385.1| full-length cDNA clone CS0DK008YL12 of HeLa cell... 48 0.036
112emb|CR595573.1| full-length cDNA clone CS0DD004YD15 of Neuroblas... 48 0.036
113ref|NM_057343.3| Drosophila melanogaster Proteasome 29kD subunit... 48 0.036
114gb|AY084140.1| Drosophila melanogaster RE23862 full insert cDNA 48 0.036
115dbj|AK141380.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 48 0.036
116gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.036
117gb|BC102343.1| Bos taurus proteasome (prosome, macropain) subuni... 48 0.036
118dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.036
119gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, r... 48 0.036
120dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.036
121gb|AY891040.1| Synthetic construct Homo sapiens clone FLH007207.... 48 0.036
122ref|NM_211639.1| Eremothecium gossypii AGL089Wp (AGL089W), mRNA 48 0.036
123dbj|AK059984.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.036
124gb|BT021033.1| Bos taurus proteasome (prosome, macropain) subuni... 48 0.036
125gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60... 48 0.036
126gb|AC005268.1|AC005268 Drosophila melanogaster DNA sequence (P1s... 48 0.036
127gb|AY650295.2| Macaca fascicularis proteasome subunit alpha-type... 48 0.036
128gb|BC018605.1| Homo sapiens proteasome (prosome, macropain) subu... 48 0.036
129dbj|AB026560.1| Oryza sativa (japonica cultivar-group) OsPAC1 mR... 48 0.036
130gb|BC108368.1| Mus musculus proteasome (prosome, macropain) subu... 46 0.14
131gb|BT016493.1| Zea mays clone Contig326 mRNA sequence 46 0.14
132gb|BC083342.1| Mus musculus proteasome (prosome, macropain) subu... 46 0.14
133gb|BC010709.1| Mus musculus proteasome (prosome, macropain) subu... 46 0.14
134ref|NM_011967.1| Mus musculus proteasome (prosome, macropain) su... 46 0.14
135ref|XM_001001974.1| PREDICTED: Mus musculus similar to Proteasom... 46 0.14
136ref|XM_001001965.1| PREDICTED: Mus musculus similar to Proteasom... 46 0.14
137ref|XM_987563.1| PREDICTED: Mus musculus similar to Proteasome s... 46 0.14
138ref|XM_001002751.1| PREDICTED: Mus musculus similar to Proteasom... 46 0.14
139ref|XM_001002745.1| PREDICTED: Mus musculus similar to Proteasom... 46 0.14
140ref|XM_817190.1| Trypanosoma brucei TREU927 proteasome subunit a... 46 0.14
141emb|AJ293343.1|ZMA293343 Zea mays mRNA for maize 20S proteasome ... 46 0.14
142gb|AC122419.4| Mus musculus BAC clone RP24-163H24 from chromosom... 46 0.14
143dbj|AK143468.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN ... 46 0.14
144dbj|AK161680.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 46 0.14
145dbj|AK160741.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 46 0.14
146dbj|AK160550.1| Mus musculus ES cells cDNA, RIKEN full-length en... 46 0.14
147dbj|AK160530.1| Mus musculus ES cells cDNA, RIKEN full-length en... 46 0.14
148dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
149dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
150dbj|AP006067.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
151gb|AF140353.1|AF140353 Trypanosoma brucei brucei 20S proteasome ... 46 0.14
152gb|AY107760.1| Zea mays PCO113667 mRNA sequence 46 0.14
153gb|AY104377.1| Zea mays PCO108605 mRNA sequence 46 0.14
154gb|AF019661.1|AF019661 Mus musculus zeta proteasome chain mRNA, ... 46 0.14
155gb|AC100386.29| Mus musculus chromosome 10, clone RP23-132J19, c... 46 0.14
156gb|BC007181.1| Mus musculus proteasome (prosome, macropain) subu... 46 0.14
157dbj|AB032061.1| Oryza sativa (japonica cultivar-group) OsPAD1 mR... 46 0.14
158ref|XM_463746.1| Oryza sativa (japonica cultivar-group), predic... 44 0.56
159ref|XM_860992.1| PREDICTED: Canis familiaris similar to Proteaso... 44 0.56
160ref|XM_547244.2| PREDICTED: Canis familiaris similar to Proteaso... 44 0.56
161emb|BX248230.21| Zebrafish DNA sequence from clone CH211-213O11 ... 44 0.56
162dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
163dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
164gb|AF210324.1|AF210324 Oryza sativa clone C26554 UMP synthase (U... 44 0.56
165gb|AF210323.1|AF210323 Oryza sativa clone C26785 UMP synthase (U... 44 0.56
166dbj|AK069565.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.56
167gb|AY462282.1| Sus scrofa proteasome subunit type alpha 5 gene, ... 44 0.56
168gb|AC132091.3| Mus musculus BAC clone RP24-465H15 from 18, compl... 44 0.56
169dbj|AB031395.1| Oryza sativa (japonica cultivar-group) mRNA for ... 44 0.56
170gb|AE010335.1| Methanopyrus kandleri AV19 section 34 of 157 of t... 42 2.2
171gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 2.2
172ref|XM_462564.1| Debaryomyces hansenii CBS767 hypothetical prote... 42 2.2
173gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, com... 42 2.2
174ref|XM_804684.1| Trypanosoma cruzi strain CL Brener proteasome a... 42 2.2
175ref|XM_797774.1| Trypanosoma cruzi strain CL Brener proteasome a... 42 2.2
176ref|XM_674640.1| Plasmodium berghei strain ANKA proteasome subun... 42 2.2
177gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 2.2
178emb|AL390252.9| Human DNA sequence from clone RP11-297O4 on chro... 42 2.2
179ref|XM_963562.1| PREDICTED: Tribolium castaneum similar to prote... 42 2.2
180emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 42 2.2
181emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... 42 2.2
182gb|AC183530.3| Pan troglodytes BAC clone CH251-653K11 from chrom... 42 2.2
183gb|AC092372.3| Homo sapiens chromosome 5 clone RP11-58M12, compl... 42 2.2
184gb|AC022121.6| Homo sapiens chromosome 5 clone CTD-2007H13, comp... 42 2.2
185gb|AC012624.6| Homo sapiens chromosome 5 clone CTD-2082I17, comp... 42 2.2
186gb|AC026778.4|AC026778 Homo sapiens chromosome 5 clone CTC-428I1... 42 2.2
187gb|AY184356.1| Gasterosteus aculeatus proteasome subunit alpha 3... 42 2.2
188gb|U75302.1|TCU75302 Trypanosoma cruzi 29 kDa proteasome subunit... 42 2.2
189gb|U73851.1|TCU73851 Trypanosoma cruzi 29 kDa proteasome subunit... 42 2.2
190emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chr... 42 2.2
191emb|AL831710.8| Mouse DNA sequence from clone RP23-29K19 on chro... 42 2.2
192ref|NM_103010.1| Arabidopsis thaliana electron transporter AT1G3... 40 8.7
193gb|BT020381.1| Arabidopsis thaliana At1g32760 mRNA, complete cds 40 8.7
194gb|AY398400.1| Danio rerio clone RK071A1A07 proteasome subunit, ... 40 8.7
195ref|NM_185665.2| Oryza sativa (japonica cultivar-group), mRNA 40 8.7
196gb|BT016358.1| Zea mays clone Contig191 mRNA sequence 40 8.7
197gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.7
198gb|AY288992.1| Newcastle disease virus chicken/USA(CA)/1083(Font... 40 8.7
199ref|XM_711383.1| Candida albicans SC5314 putative a-pheromone ma... 40 8.7
200gb|AY590469.1| Homo sapiens MCM3 minichromosome maintenance defi... 40 8.7
201gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger prote... 40 8.7
202gb|AC118561.10| Mus musculus chromosome 12, clone RP23-265N17, c... 40 8.7
203gb|AC147575.1| Homo sapiens chromosome 5 clone RP11-998B18, comp... 40 8.7
204ref|XM_572324.1| Cryptococcus neoformans var. neoformans JEC21 p... 40 8.7
205ref|XM_447358.1| Candida glabrata CBS138 hypothetical protein (C... 40 8.7
206ref|XM_538679.1| PREDICTED: Canis familiaris similar to Interfer... 40 8.7
207ref|XM_803137.1| Trypanosoma cruzi strain CL Brener proteasome a... 40 8.7
208gb|AC145146.2| Homo sapiens chromosome 5 clone RP11-241G9, compl... 40 8.7
209emb|CR727970.2|CNS0GONC Tetraodon nigroviridis full-length cDNA 40 8.7
210emb|CR727498.2|CNS0GOA8 Tetraodon nigroviridis full-length cDNA 40 8.7
211emb|CR727201.2|CNS0GO1Z Tetraodon nigroviridis full-length cDNA 40 8.7
212emb|CR725216.2|CNS0GMIU Tetraodon nigroviridis full-length cDNA 40 8.7
213emb|CR705071.2|CNS0G6ZF Tetraodon nigroviridis full-length cDNA 40 8.7
214emb|CR704698.2|CNS0G6P2 Tetraodon nigroviridis full-length cDNA 40 8.7
215emb|CR700470.2|CNS0G3FM Tetraodon nigroviridis full-length cDNA 40 8.7
216emb|CR699896.2|CNS0G2ZO Tetraodon nigroviridis full-length cDNA 40 8.7
217emb|CR698069.2|CNS0G1KX Tetraodon nigroviridis full-length cDNA 40 8.7
218emb|CR697897.1|CNS0G1G5 Tetraodon nigroviridis full-length cDNA 40 8.7
219emb|CR694814.2|CNS0FZ2I Tetraodon nigroviridis full-length cDNA 40 8.7
220emb|CR692623.2|CNS0FXDN Tetraodon nigroviridis full-length cDNA 40 8.7
221emb|CR685960.2|CNS0FS8K Tetraodon nigroviridis full-length cDNA 40 8.7
222emb|CR688259.2|CNS0FU0F Tetraodon nigroviridis full-length cDNA 40 8.7
223emb|CR688135.1|CNS0FTWZ Tetraodon nigroviridis full-length cDNA 40 8.7
224emb|CR681238.2|CNS0FOLE Tetraodon nigroviridis full-length cDNA 40 8.7
225emb|CR679103.2|CNS0FMY3 Tetraodon nigroviridis full-length cDNA 40 8.7
226emb|CR678237.2|CNS0FMA9 Tetraodon nigroviridis full-length cDNA 40 8.7
227emb|CR677793.2|CNS0FLY1 Tetraodon nigroviridis full-length cDNA 40 8.7
228emb|CR676703.2|CNS0FL3V Tetraodon nigroviridis full-length cDNA 40 8.7
229emb|CR675798.2|CNS0FKF0 Tetraodon nigroviridis full-length cDNA 40 8.7
230emb|CR673260.2|CNS0FIGI Tetraodon nigroviridis full-length cDNA 40 8.7
231emb|CR672112.2|CNS0FHKM Tetraodon nigroviridis full-length cDNA 40 8.7
232emb|CR672105.2|CNS0FHKF Tetraodon nigroviridis full-length cDNA 40 8.7
233emb|CR671749.2|CNS0FHAJ Tetraodon nigroviridis full-length cDNA 40 8.7
234emb|CR671990.2|CNS0FHH8 Tetraodon nigroviridis full-length cDNA 40 8.7
235emb|CR671579.2|CNS0FH5T Tetraodon nigroviridis full-length cDNA 40 8.7
236emb|CR670122.2|CNS0FG1C Tetraodon nigroviridis full-length cDNA 40 8.7
237gb|AC142525.2| Homo sapiens chromosome 5 clone RP11-1275J23, com... 40 8.7
238emb|CR668423.2|CNS0FEQ5 Tetraodon nigroviridis full-length cDNA 40 8.7
239emb|CR667949.2|CNS0FECZ Tetraodon nigroviridis full-length cDNA 40 8.7
240gb|AC144587.2| Homo sapiens chromosome 5 clone RP11-2H18, comple... 40 8.7
241emb|CR664328.2|CNS0FBKE Tetraodon nigroviridis full-length cDNA 40 8.7
242emb|CR661379.2|CNS0F9AH Tetraodon nigroviridis full-length cDNA 40 8.7
243emb|CR658674.1|CNS0F77C Tetraodon nigroviridis full-length cDNA 40 8.7
244emb|CR646148.2|CNS0EXJE Tetraodon nigroviridis full-length cDNA 40 8.7
245ref|XM_501939.1| Yarrowia lipolytica CLIB122, YALI0C17325g predi... 40 8.7
246emb|AL031767.13|HS135L22 Human DNA sequence from clone RP1-135L2... 40 8.7
247emb|BX063333.1|CNS09L15 Single read from an extremity of a full-... 40 8.7
248emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 40 8.7
249emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 i... 40 8.7
250gb|AC161369.3| Mus musculus BAC clone RP23-426C11 from chromosom... 40 8.7
251gb|BC071495.1| Danio rerio proteasome (prosome, macropain) subun... 40 8.7
252dbj|AK095181.1| Homo sapiens cDNA FLJ37862 fis, clone BRSSN20157... 40 8.7
253gb|AC010355.7| Homo sapiens chromosome 5 clone CTD-2027K22, comp... 40 8.7
254dbj|AB169279.1| Macaca fascicularis testis cDNA, clone: QtsA-186... 40 8.7
255gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 40 8.7
256dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
257gb|AC009211.5|AC009211 Drosophila melanogaster, chromosome 3R, r... 40 8.7
258ref|NM_205708.1| Danio rerio proteasome (prosome, macropain) sub... 40 8.7
259gb|AC017118.3|AC017118 Genomic sequence for Arabidopsis thaliana... 40 8.7
260gb|AC009062.8| Homo sapiens chromosome 16 clone RP11-298C15, com... 40 8.7
261dbj|AP002864.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
262dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
263dbj|AP003808.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
264dbj|BS000242.1| Pan troglodytes chromosome 22 clone:PTB-120M01, ... 40 8.7
265ref|NM_211393.1| Eremothecium gossypii AGL336Wp (AGL336W), mRNA 40 8.7
266dbj|AK067977.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.7
267gb|AC122531.4| Mus musculus BAC clone RP24-536C4 from 3, complet... 40 8.7
268gb|BT021135.1| Arabidopsis thaliana At1g32760 gene, complete cds 40 8.7
269gb|AY107786.1| Zea mays PCO106817 mRNA sequence 40 8.7
270gb|AE003698.3| Drosophila melanogaster chromosome 3R, section 36... 40 8.7
271dbj|AP001759.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.7
272gb|U12456.1|ACU12456 Amia calva immunoglobulin mu heavy chain (I... 40 8.7
273emb|AL807818.14| Zebrafish DNA sequence from clone CH211-225H24,... 40 8.7
274emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 8.7
275gb|U73850.1|TCU73850 Trypanosoma cruzi 29 kDa proteasome subunit... 40 8.7
276dbj|AP001469.1| Homo sapiens genomic DNA, chromosome 21q22.3, cl... 40 8.7

>dbj|AK103487.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033130M12, full
           insert sequence
          Length = 1188

 Score =  632 bits (319), Expect = e-178
 Identities = 490/547 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 194 atgttcctcacgaggacggagtacgaccgcggggtgaacaccttctccccggaggggcgg 253

                                                                       
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
            |||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 254 ttgttccaggtcgagtacgccattgaggccatcaagttggggtcaactgcgatcgggttg 313

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           ||||| |||||||| ||||| |||||||| |||||||||||||| || ||| ||||||||
Sbjct: 314 aagaccaaggatggtgttgtccttgctgtagagaaacgtgtgacctcgccactgctggaa 373

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           || |||||||| |||||||| ||||||||||| |||||  ||||||||||||||||||||
Sbjct: 374 ccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgagtggc 433

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
           |||||||||||||| |||||||||||||||||||||||||| || ||||| || ||||| 
Sbjct: 434 cttattgctgatgctagaacattggttgagcatgctcgtgttgaaacccagaatcatagg 493

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           |||||||||||||| ||  ||||||| || || || ||||||||||| || ||  |||||
Sbjct: 494 ttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgacttagct 553

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
           || || ||||| |||||||| |||||||| ||||||||||| ||||| || ||||| |||
Sbjct: 554 ctgcgttttggtgaaggtgatgaagagtcgatgtcacgaccatttggtgtctctctcctt 613

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 614 attgctggtcatgatgagaatggacccagcttgtactacactgacccatcaggaaccttt 673

                                                                       
Query: 553 tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttccttacag 612
           |||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||||||
Sbjct: 674 tggcagtgcaatgccaaggcaattggatcaggttctgaaggagctgatagctcattacag 733

                  
Query: 613 gagcagt 619
           |||||||
Sbjct: 734 gagcagt 740



to top

>dbj|AK059521.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C07, full
           insert sequence
          Length = 1056

 Score =  632 bits (319), Expect = e-178
 Identities = 490/547 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 89  atgttcctcacgaggacggagtacgaccgcggggtgaacaccttctccccggaggggcgg 148

                                                                       
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
            |||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 149 ttgttccaggtcgagtacgccattgaggccatcaagttggggtcaactgcgatcgggttg 208

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           ||||| |||||||| ||||| |||||||| |||||||||||||| || ||| ||||||||
Sbjct: 209 aagaccaaggatggtgttgtccttgctgtagagaaacgtgtgacctcgccactgctggaa 268

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           || |||||||| |||||||| ||||||||||| |||||  ||||||||||||||||||||
Sbjct: 269 ccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgagtggc 328

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
           |||||||||||||| |||||||||||||||||||||||||| || ||||| || ||||| 
Sbjct: 329 cttattgctgatgctagaacattggttgagcatgctcgtgttgaaacccagaatcatagg 388

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           |||||||||||||| ||  ||||||| || || || ||||||||||| || ||  |||||
Sbjct: 389 ttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgacttagct 448

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
           || || ||||| |||||||| |||||||| ||||||||||| ||||| || ||||| |||
Sbjct: 449 ctgcgttttggtgaaggtgatgaagagtcgatgtcacgaccatttggtgtctctctcctt 508

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 509 attgctggtcatgatgagaatggacccagcttgtactacactgacccatcaggaaccttt 568

                                                                       
Query: 553 tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttccttacag 612
           |||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||||||
Sbjct: 569 tggcagtgcaatgccaaggcaattggatcaggttctgaaggagctgatagctcattacag 628

                  
Query: 613 gagcagt 619
           |||||||
Sbjct: 629 gagcagt 635



to top

>dbj|AB026561.1| Oryza sativa (japonica cultivar-group) OsPAE1 mRNA for alpha 5
           subunit of 20S proteasome, complete cds
          Length = 1056

 Score =  632 bits (319), Expect = e-178
 Identities = 490/547 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 94  atgttcctcacgaggacggagtacgaccgcggggtgaacaccttctccccggaggggcgg 153

                                                                       
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
            |||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 154 ttgttccaggtcgagtacgccattgaggccatcaagttggggtcaactgcgatcgggttg 213

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           ||||| |||||||| ||||| |||||||| |||||||||||||| || ||| ||||||||
Sbjct: 214 aagaccaaggatggtgttgtccttgctgtagagaaacgtgtgacctcgccactgctggaa 273

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           || |||||||| |||||||| ||||||||||| |||||  ||||||||||||||||||||
Sbjct: 274 ccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgagtggc 333

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
           |||||||||||||| |||||||||||||||||||||||||| || ||||| || ||||| 
Sbjct: 334 cttattgctgatgctagaacattggttgagcatgctcgtgttgaaacccagaatcatagg 393

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           |||||||||||||| ||  ||||||| || || || ||||||||||| || ||  |||||
Sbjct: 394 ttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgacttagct 453

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
           || || ||||| |||||||| |||||||| ||||||||||| ||||| || ||||| |||
Sbjct: 454 ctgcgttttggtgaaggtgatgaagagtcgatgtcacgaccatttggtgtctctctcctt 513

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 514 attgctggtcatgatgagaatggacccagcttgtactacactgacccatcaggaaccttt 573

                                                                       
Query: 553 tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttccttacag 612
           |||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||||||
Sbjct: 574 tggcagtgcaatgccaaggcaattggatcaggttctgaaggagctgatagctcattacag 633

                  
Query: 613 gagcagt 619
           |||||||
Sbjct: 634 gagcagt 640



to top

>gb|BT017253.1| Zea mays clone EL01N0307H03.c mRNA sequence
          Length = 1104

 Score =  539 bits (272), Expect = e-150
 Identities = 491/564 (87%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           ||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 197 atgtttctcacgaggacggagtacgaccgcggggtgaacaccttctcgccggaggggcgg 256

                                                                       
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 257 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatccactgcgatcgggttg 316

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           || || |||||||| ||||| |||||||| |||||||||||||| || ||| ||||||||
Sbjct: 317 aaaacaaaggatggtgttgtccttgctgttgagaaacgtgtgacctcgccactgctggaa 376

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           || |||||||| || ||||| |||||||||||||||||  ||||||||||||||||||| 
Sbjct: 377 ccaagcagtgtggaaaaaatcatggaaattgatgagcacataggctgtgccatgagtggg 436

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
           |||||||||||||| |||||| | || |||||||||||||| || || || || ||||| 
Sbjct: 437 cttattgctgatgctagaacactagtcgagcatgctcgtgttgaaactcagaatcatagg 496

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           |||||||| ||||| ||  |||| || || ||  | |||||||||||||| ||  |||||
Sbjct: 497 ttctcatacggggagccaatgaccgtagaatcttcaacacaagctatttgtgacttagct 556

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
           || |||||||| |||||||| |||||||| |||||||| || |||||||| ||||| || 
Sbjct: 557 ctgcgctttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctctccta 616

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           |||||||| || ||||| ||||| || ||| |||||||||| ||||||||||| || |||
Sbjct: 617 attgctggacacgatgagaatggacctagcctgtactacaccgacccatctggtactttt 676

                                                                       
Query: 553 tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttccttacag 612
           ||||| ||||| || |||||||| || || ||||||||||| || ||||| ||||| |||
Sbjct: 677 tggcaatgcaacgcgaaggcaattggatctggctctgaaggagctgatagctccttgcag 736

                                   
Query: 613 gagcagtttaacaaggagctggcc 636
           |||||||  |||||||||||||||
Sbjct: 737 gagcagtacaacaaggagctggcc 760



to top

>gb|BT019190.1| Zea mays clone Contig862.F mRNA sequence
          Length = 1161

 Score =  446 bits (225), Expect = e-122
 Identities = 474/557 (85%)
 Strand = Plus / Minus

                                                                        
Query: 73   atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
            ||||| ||||||||||||||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 1055 atgtttctcacgaggacggagtacgaccgtggggtgaacaccttctctccggaggggcgg 996

                                                                        
Query: 133  ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
            ||||||| ||||||||||||| |||||||||||||||||||||| ||||| ||||| |||
Sbjct: 995  ctgttcccggtcgagtacgccctcgaggccatcaagttgggatccactgcgatcggtttg 936

                                                                        
Query: 193  aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
            ||||| |||||||| ||||| || || || |||||||||||||| || ||  ||||||||
Sbjct: 935  aagacaaaggatggtgttgtcctcgccgttgagaaacgtgtgacctcacccctgctggaa 876

                                                                        
Query: 253  cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
            || |||||||| || ||||| |||||||||||||||||  ||||||||||||||||||| 
Sbjct: 875  ccaagcagtgtggaaaaaataatggaaattgatgagcacataggctgtgccatgagtgga 816

                                                                        
Query: 313  cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
            |||||||||||||| |||||| | || || ||||||||||| || || || || ||||| 
Sbjct: 815  cttattgctgatgctagaacactagtggaacatgctcgtgttgaaactcagaatcatagg 756

                                                                        
Query: 373  ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
            |||||||| || || ||  |||| || || ||  | ||||||||||| || ||  |||||
Sbjct: 755  ttctcatacggagagccaatgactgtagaatcttcgacacaagctatctgtgacttagct 696

                                                                        
Query: 433  cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
            || || ||||| |||||||| |||||||| |||||||| || |||||||| ||||| || 
Sbjct: 695  ctgcgttttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctctccta 636

                                                                        
Query: 493  attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
            |||||||| |||||||| ||||| || ||| ||||||||||||| |||||||| || |||
Sbjct: 635  attgctggacatgatgagaatggacctagcctgtactacactgatccatctggtacattt 576

                                                                        
Query: 553  tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttccttacag 612
            ||||| ||||| || |||||||| || ||||| ||||| || || ||||||||||| |||
Sbjct: 575  tggcaatgcaacgcaaaggcaattggatcaggttctgagggagctgatagttccttgcag 516

                             
Query: 613  gagcagtttaacaagga 629
            || ||||  ||||||||
Sbjct: 515  gaacagtacaacaagga 499



to top

>gb|BT017580.1| Zea mays clone EL01N0429D12.c mRNA sequence
          Length = 1354

 Score =  248 bits (125), Expect = 2e-62
 Identities = 317/381 (83%)
 Strand = Plus / Plus

                                                                       
Query: 249 ggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgag 308
           |||||| |||||||| || ||||| |||||||||||||||||  ||||||||||||||||
Sbjct: 583 ggaaccaagcagtgtggaaaaaataatggaaattgatgagcacataggctgtgccatgag 642

                                                                       
Query: 309 tggccttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaacca 368
           ||| |||||||||||||| |||||| | || || ||||||||||| || || || || ||
Sbjct: 643 tggacttattgctgatgctagaacactagtggaacatgctcgtgttgaaactcagaatca 702

                                                                       
Query: 369 tagattctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatct 428
           ||| |||||||| || || ||  |||| || || ||  | ||||||||||| || ||  |
Sbjct: 703 taggttctcatacggagagccaatgactgtagaatcttcgacacaagctatctgtgactt 762

                                                                       
Query: 429 agctcttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctct 488
           |||||| || ||||| |||||||| |||||||| |||||||| || |||||||| |||||
Sbjct: 763 agctctgcgttttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctct 822

                                                                       
Query: 489 tcttattgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaac 548
            || |||||||| |||||||| ||||| || ||| ||||||||||||| |||||||| ||
Sbjct: 823 cctaattgctggacatgatgagaatggacctagcctgtactacactgatccatctggtac 882

                                                                       
Query: 549 cttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttcctt 608
            |||||||| ||||| || |||||||| || ||||| ||||| || || |||||||||||
Sbjct: 883 attttggcaatgcaacgcaaaggcaattggatcaggttctgagggagctgatagttcctt 942

                                
Query: 609 acaggagcagtttaacaagga 629
            ||||| ||||  ||||||||
Sbjct: 943 gcaggaacagtacaacaagga 963



to top

>ref|NM_104262.1| Arabidopsis thaliana PAE1; endopeptidase/ peptidase/ threonine
           endopeptidase AT1G53850 (PAE1) mRNA, complete cds
          Length = 1006

 Score =  246 bits (124), Expect = 8e-62
 Identities = 352/428 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 tctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaacgtgtg 234
           ||||||||||| ||  | ||||| || || || ||||| |||||||| ||||| ||| | 
Sbjct: 218 tctactgcaattggagtaaagacaaaagaaggagttgtgcttgctgtcgagaagcgtatc 277

                                                                       
Query: 235 acgtctccattgctggaacctagcagtgttgagaaaattatggaaattgatgagcatgta 294
           ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||| ||| | 
Sbjct: 278 acgtcgccattgctggaaccgagcagtgtggagaagattatggaaattgatgaccatatt 337

                                                                       
Query: 295 ggctgtgccatgagtggccttattgctgatgcaagaacattggttgagcatgctcgtgtg 354
           || ||||| ||||| ||  | |||||||| ||  | ||| | |||||||||||| | || 
Sbjct: 338 ggttgtgctatgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagtt 397

                                                                       
Query: 355 gagacccaaaaccatagattctcatatggggaaccgttgacagtcgagtccaccacacaa 414
           || || ||||||||||||||||| ||||| || ||| |||| || |||||||| ||||||
Sbjct: 398 gaaactcaaaaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaa 457

                                                                       
Query: 415 gctatttgcgatctagctcttcgctttggagaaggtgaagaagagtctatgtcacgacct 474
           ||  | || ||||| ||| | || ||||| ||||| || ||||| || ||||| || || 
Sbjct: 458 gcactgtgtgatctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccg 517

                                                                       
Query: 475 tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgtactacact 534
           |||||||| |||||||| |||||||| |||||||||||||| || |||||||||||||||
Sbjct: 518 tttggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgtactacact 577

                                                                       
Query: 535 gacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggt 594
           || || || ||||| || |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 578 gatccttcaggaacattctggcagtgcaatgcaaaggcaattggttcaggttctgaagga 637

                   
Query: 595 gccgatag 602
           || |||||
Sbjct: 638 gctgatag 645



to top

>gb|AY114616.1| Arabidopsis thaliana 20S proteasome subunit PAE1 (At1g53850) mRNA,
           complete cds
          Length = 869

 Score =  246 bits (124), Expect = 8e-62
 Identities = 352/428 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 tctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaacgtgtg 234
           ||||||||||| ||  | ||||| || || || ||||| |||||||| ||||| ||| | 
Sbjct: 103 tctactgcaattggagtaaagacaaaagaaggagttgtgcttgctgtcgagaagcgtatc 162

                                                                       
Query: 235 acgtctccattgctggaacctagcagtgttgagaaaattatggaaattgatgagcatgta 294
           ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||| ||| | 
Sbjct: 163 acgtcgccattgctggaaccgagcagtgtggagaagattatggaaattgatgaccatatt 222

                                                                       
Query: 295 ggctgtgccatgagtggccttattgctgatgcaagaacattggttgagcatgctcgtgtg 354
           || ||||| ||||| ||  | |||||||| ||  | ||| | |||||||||||| | || 
Sbjct: 223 ggttgtgctatgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagtt 282

                                                                       
Query: 355 gagacccaaaaccatagattctcatatggggaaccgttgacagtcgagtccaccacacaa 414
           || || ||||||||||||||||| ||||| || ||| |||| || |||||||| ||||||
Sbjct: 283 gaaactcaaaaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaa 342

                                                                       
Query: 415 gctatttgcgatctagctcttcgctttggagaaggtgaagaagagtctatgtcacgacct 474
           ||  | || ||||| ||| | || ||||| ||||| || ||||| || ||||| || || 
Sbjct: 343 gcactgtgtgatctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccg 402

                                                                       
Query: 475 tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgtactacact 534
           |||||||| |||||||| |||||||| |||||||||||||| || |||||||||||||||
Sbjct: 403 tttggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgtactacact 462

                                                                       
Query: 535 gacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggt 594
           || || || ||||| || |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 463 gatccttcaggaacattctggcagtgcaatgcaaaggcaattggttcaggttctgaagga 522

                   
Query: 595 gccgatag 602
           || |||||
Sbjct: 523 gctgatag 530



to top

>gb|AY072371.1| Arabidopsis thaliana 20S proteasome subunit PAE1 (At1g53850) mRNA,
           complete cds
          Length = 1003

 Score =  246 bits (124), Expect = 8e-62
 Identities = 352/428 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 tctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaacgtgtg 234
           ||||||||||| ||  | ||||| || || || ||||| |||||||| ||||| ||| | 
Sbjct: 216 tctactgcaattggagtaaagacaaaagaaggagttgtgcttgctgtcgagaagcgtatc 275

                                                                       
Query: 235 acgtctccattgctggaacctagcagtgttgagaaaattatggaaattgatgagcatgta 294
           ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||| ||| | 
Sbjct: 276 acgtcgccattgctggaaccgagcagtgtggagaagattatggaaattgatgaccatatt 335

                                                                       
Query: 295 ggctgtgccatgagtggccttattgctgatgcaagaacattggttgagcatgctcgtgtg 354
           || ||||| ||||| ||  | |||||||| ||  | ||| | |||||||||||| | || 
Sbjct: 336 ggttgtgctatgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagtt 395

                                                                       
Query: 355 gagacccaaaaccatagattctcatatggggaaccgttgacagtcgagtccaccacacaa 414
           || || ||||||||||||||||| ||||| || ||| |||| || |||||||| ||||||
Sbjct: 396 gaaactcaaaaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaa 455

                                                                       
Query: 415 gctatttgcgatctagctcttcgctttggagaaggtgaagaagagtctatgtcacgacct 474
           ||  | || ||||| ||| | || ||||| ||||| || ||||| || ||||| || || 
Sbjct: 456 gcactgtgtgatctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccg 515

                                                                       
Query: 475 tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgtactacact 534
           |||||||| |||||||| |||||||| |||||||||||||| || |||||||||||||||
Sbjct: 516 tttggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgtactacact 575

                                                                       
Query: 535 gacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggt 594
           || || || ||||| || |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 576 gatccttcaggaacattctggcagtgcaatgcaaaggcaattggttcaggttctgaagga 635

                   
Query: 595 gccgatag 602
           || |||||
Sbjct: 636 gctgatag 643



to top

>gb|AY086045.1| Arabidopsis thaliana clone 20801 mRNA, complete sequence
          Length = 1006

 Score =  246 bits (124), Expect = 8e-62
 Identities = 352/428 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 tctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaacgtgtg 234
           ||||||||||| ||  | ||||| || || || ||||| |||||||| ||||| ||| | 
Sbjct: 218 tctactgcaattggagtaaagacaaaagaaggagttgtgcttgctgtcgagaagcgtatc 277

                                                                       
Query: 235 acgtctccattgctggaacctagcagtgttgagaaaattatggaaattgatgagcatgta 294
           ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||| ||| | 
Sbjct: 278 acgtcgccattgctggaaccgagcagtgtggagaagattatggaaattgatgaccatatt 337

                                                                       
Query: 295 ggctgtgccatgagtggccttattgctgatgcaagaacattggttgagcatgctcgtgtg 354
           || ||||| ||||| ||  | |||||||| ||  | ||| | |||||||||||| | || 
Sbjct: 338 ggttgtgctatgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagtt 397

                                                                       
Query: 355 gagacccaaaaccatagattctcatatggggaaccgttgacagtcgagtccaccacacaa 414
           || || ||||||||||||||||| ||||| || ||| |||| || |||||||| ||||||
Sbjct: 398 gaaactcaaaaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaa 457

                                                                       
Query: 415 gctatttgcgatctagctcttcgctttggagaaggtgaagaagagtctatgtcacgacct 474
           ||  | || ||||| ||| | || ||||| ||||| || ||||| || ||||| || || 
Sbjct: 458 gcactgtgtgatctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccg 517

                                                                       
Query: 475 tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgtactacact 534
           |||||||| |||||||| |||||||| |||||||||||||| || |||||||||||||||
Sbjct: 518 tttggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgtactacact 577

                                                                       
Query: 535 gacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggt 594
           || || || ||||| || |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 578 gatccttcaggaacattctggcagtgcaatgcaaaggcaattggttcaggttctgaagga 637

                   
Query: 595 gccgatag 602
           || |||||
Sbjct: 638 gctgatag 645



to top

>gb|AY110522.1| Zea mays CL4677_2 mRNA sequence
          Length = 1304

 Score =  244 bits (123), Expect = 3e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           ||||| ||||||||||||||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 300 atgtttctcacgaggacggagtacgaccgtggggtgaacaccttctctccggaggggcgg 359

                                                                       
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
           |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 360 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatccactgcgatcggtttg 419

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           ||||| |||||||| ||||| || || || |||||||||||||| || ||| ||||||||
Sbjct: 420 aagacaaaggatggtgttgtcctcgccgttgagaaacgtgtgacctcaccactgctggaa 479

                      
Query: 253 cctagcagtgt 263
           || ||||||||
Sbjct: 480 ccaagcagtgt 490



 Score =  184 bits (93), Expect = 2e-43
 Identities = 261/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
           |||||||||||||| |||||| | || || ||||||||||| || || || || ||||| 
Sbjct: 540 cttattgctgatgctagaacactagtggaacatgctcgtgttgaaactcagaatcatagg 599

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           |||||||| || || ||  |||| || || ||  | ||||||||||| || ||  |||||
Sbjct: 600 ttctcatacggagagccaatgactgtagaatcttcgacacaagctatctgtgacttagct 659

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
           || || ||||| |||||||| |||||||| |||||||| || |||||||| ||||| || 
Sbjct: 660 ctgcgttttggcgaaggtgacgaagagtcaatgtcacggccatttggagtctctctccta 719

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           |||||||| |||||||| ||||| || ||| |||||||||||||||||||||| || |||
Sbjct: 720 attgctggacatgatgagaatggacctagcctgtactacactgacccatctggtacattt 779

                                                                       
Query: 553 tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttccttacag 612
           ||||| ||||| || |||||||| || ||||| ||||| || || ||||||||||| |||
Sbjct: 780 tggcaatgcaacgcaaaggcaattggatcaggttctgagggagctgatagttccttgcag 839

                            
Query: 613 gagcagtttaacaagga 629
           || ||||  ||||||||
Sbjct: 840 gaacagtacaacaagga 856



to top

>gb|AF255338.1|AF255338 Glycine max 20S proteasome subunit mRNA, complete cds
          Length = 966

 Score =  240 bits (121), Expect = 5e-60
 Identities = 400/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           ||||| ||||| ||||| ||||| ||||| || || |||||||| || || || || || 
Sbjct: 14  atgtttctcacaaggactgagtatgaccgaggagtcaacaccttttctcccgaaggccgt 73

                                                                       
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttg 192
            |||| ||||| ||||| || ||||| ||||||||| ||||||| ||||| || ||||||
Sbjct: 74  ttgtttcaggttgagtatgcaatcgaagccatcaagctgggatcaactgcgattgggttg 133

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           ||||| || || || ||||| ||||| || || || ||  | || || ||  | ||||| 
Sbjct: 134 aagaccaaagaaggagttgtccttgcagttgaaaagcgcatcacatcgccgctcctggag 193

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           ||||| ||||||||||||||||||||||||||||||||  | || ||||| |||||||| 
Sbjct: 194 cctagtagtgttgagaaaattatggaaattgatgagcacatcggttgtgcaatgagtggg 253

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
            | ||||| |||||  ||||| | ||||||||||| || ||||| || || || || || 
Sbjct: 254 ttgattgcagatgctcgaacacttgttgagcatgcacgggtggaaactcagaatcacagg 313

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           ||||| ||||| || ||  |||| || ||||||||||| |||||| |||| |||||||| 
Sbjct: 314 ttctcctatggtgagcctatgactgttgagtccaccacccaagctctttgtgatctagcc 373

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
            | || ||||| |||||||| |||||||| ||||| ||||| |||||||| ||||| || 
Sbjct: 374 ttgcgttttggtgaaggtgatgaagagtccatgtcccgaccatttggagtatctctcctc 433

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           ||||||||||||||||| ||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 434 attgctggtcatgatgagaatggacctagcttatactacactgatccatctggcacattt 493

                        
Query: 553 tggcagtgcaatg 565
           ||||| |||||||
Sbjct: 494 tggcaatgcaatg 506



to top

>gb|AF043524.1|AF043524 Arabidopsis thaliana 20S proteasome subunit PAE1 (PAE1) mRNA,
           complete cds
          Length = 1005

 Score =  238 bits (120), Expect = 2e-59
 Identities = 351/428 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 tctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaacgtgtg 234
           ||||||||||| ||  | ||||| || || || ||||| |||||||| ||||| ||| | 
Sbjct: 196 tctactgcaattggagtaaagacaaaagaaggagttgtgcttgctgtcgagaagcgtatc 255

                                                                       
Query: 235 acgtctccattgctggaacctagcagtgttgagaaaattatggaaattgatgagcatgta 294
           ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||| ||| | 
Sbjct: 256 acgtcgccattgctggaaccgagcagtgtggagaagattatggaaattgatgaccatatt 315

                                                                       
Query: 295 ggctgtgccatgagtggccttattgctgatgcaagaacattggttgagcatgctcgtgtg 354
           || ||||| ||||| ||  | |||||||| ||  | ||| | |||||||||||| | || 
Sbjct: 316 ggttgtgctatgagcggtttaattgctgacgcgcgcacacttgttgagcatgctagagtt 375

                                                                       
Query: 355 gagacccaaaaccatagattctcatatggggaaccgttgacagtcgagtccaccacacaa 414
           || || ||||||||||||||||| ||||| || ||| |||| || |||||||| ||||||
Sbjct: 376 gaaactcaaaaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaa 435

                                                                       
Query: 415 gctatttgcgatctagctcttcgctttggagaaggtgaagaagagtctatgtcacgacct 474
           ||  | || ||||| ||| | || ||||| ||||| || ||||| || ||||| || || 
Sbjct: 436 gcactgtgtgatctggctttacggtttggtgaaggagaggaagaatcaatgtctcggccg 495

                                                                       
Query: 475 tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgtactacact 534
           || ||||| |||||||| |||||||| |||||||||||||| || |||||||||||||||
Sbjct: 496 ttcggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgtactacact 555

                                                                       
Query: 535 gacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggt 594
           || || || ||||| || |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 556 gatccttcaggaacattctggcagtgcaatgcaaaggcaattggttcaggttctgaagga 615

                   
Query: 595 gccgatag 602
           || |||||
Sbjct: 616 gctgatag 623



to top

>gb|BT014224.1| Lycopersicon esculentum clone 133419F, mRNA sequence
          Length = 1119

 Score =  236 bits (119), Expect = 7e-59
 Identities = 380/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 163 atcaagttgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtg 222
           ||||||||||| || |||||||| || |||||||| ||||| || |||||||||||||||
Sbjct: 156 atcaagttgggttcaactgcaattggattgaagactaaggaaggagttgttcttgctgtg 215

                                                                       
Query: 223 gagaaacgtgtgacgtctccattgctggaacctagcagtgttgagaaaattatggaaatt 282
           ||||| ||  | || || ||| | ||||| || |||||||| ||||||||||||||||| 
Sbjct: 216 gagaagcgcattacttcaccacttctggagccaagcagtgtggagaaaattatggaaatc 275

                                                                       
Query: 283 gatgagcatgtaggctgtgccatgagtggccttattgctgatgcaagaacattggttgag 342
           || |||||| | |||||||| ||||||||  | || ||||||||| ||||| | || || 
Sbjct: 276 gacgagcatattggctgtgcaatgagtggattgatagctgatgcacgaacacttgtggaa 335

                                                                       
Query: 343 catgctcgtgtggagacccaaaaccatagattctcatatggggaaccgttgacagtcgag 402
           ||||| || || || || || |||||||||||||| ||||| || ||  |||| || |||
Sbjct: 336 catgcacgggttgaaactcagaaccatagattctcttatggcgagcccatgactgttgag 395

                                                                       
Query: 403 tccaccacacaagctatttgcgatctagctcttcgctttggagaaggtgaagaagagtct 462
           ||||| || |||||| | || ||| | ||  | || ||||| || || || ||||| |||
Sbjct: 396 tccactacccaagctctctgtgatttggcgttgcgatttggtgagggcgatgaagaatct 455

                                                                       
Query: 463 atgtcacgaccttttggagtttctcttcttattgctggtcatgatgaaaatgggccgagc 522
           |||||  | |||||||| || || ||||| ||||||||||||||||| ||||| || |||
Sbjct: 456 atgtccaggccttttggtgtgtcccttctcattgctggtcatgatgagaatggtcccagc 515

                                                                       
Query: 523 ttgtactacactgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtca 582
           |||||||| ||||| || ||||| || || ||||| ||||||||||| || || ||||||
Sbjct: 516 ttgtactatactgatccttctggtacattctggcaatgcaatgctaaagctattgggtca 575

                                                          
Query: 583 ggctctgaaggtgccgatagttccttacaggagcagtttaacaagga 629
           || ||||||||||| ||||| || || |||||||||| |||||||||
Sbjct: 576 ggttctgaaggtgctgatagctctttgcaggagcagtataacaagga 622



to top

>ref|NM_112287.2| Arabidopsis thaliana PAE2; endopeptidase/ peptidase/ threonine
           endopeptidase AT3G14290 (PAE2) mRNA, complete cds
          Length = 1023

 Score =  228 bits (115), Expect = 2e-56
 Identities = 379/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 171 caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 230

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| || ||||| ||| | || || || || ||||| || || 
Sbjct: 231 aaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggagccgagt 290

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 291 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 350

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagattctca 378
           ||||| ||  ||||| | ||||||||||| || || |||||||| ||||| || ||||| 
Sbjct: 351 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 410

                                                                       
Query: 379 tatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcgc 438
           ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | || 
Sbjct: 411 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 470

                                                                       
Query: 439 tttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgct 498
           ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 471 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 530

                                                                       
Query: 499 ggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggcag 558
           || |||||||||||||| |||||| |||||||||| || ||||| ||||| || ||||| 
Sbjct: 531 gggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggcaa 590

                                                          
Query: 559 tgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 591 tgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 637



to top

>gb|AY062970.1| Arabidopsis thaliana putative 20S proteasome subunit PAE2
           (At3g14290) mRNA, complete cds
          Length = 745

 Score =  228 bits (115), Expect = 2e-56
 Identities = 379/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 67  caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 126

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| || ||||| ||| | || || || || ||||| || || 
Sbjct: 127 aaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggagccgagt 186

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 187 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 246

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagattctca 378
           ||||| ||  ||||| | ||||||||||| || || |||||||| ||||| || ||||| 
Sbjct: 247 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 306

                                                                       
Query: 379 tatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcgc 438
           ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | || 
Sbjct: 307 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 366

                                                                       
Query: 439 tttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgct 498
           ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 367 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 426

                                                                       
Query: 499 ggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggcag 558
           || |||||||||||||| |||||| |||||||||| || ||||| ||||| || ||||| 
Sbjct: 427 gggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggcaa 486

                                                          
Query: 559 tgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 487 tgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 533



to top

>gb|AF370245.1| Arabidopsis thaliana putative 20S proteasome subunit PAE2
           (At3g14290) mRNA, complete cds
          Length = 987

 Score =  228 bits (115), Expect = 2e-56
 Identities = 379/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 170 caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 229

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| || ||||| ||| | || || || || ||||| || || 
Sbjct: 230 aaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggagccgagt 289

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 290 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 349

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagattctca 378
           ||||| ||  ||||| | ||||||||||| || || |||||||| ||||| || ||||| 
Sbjct: 350 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 409

                                                                       
Query: 379 tatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcgc 438
           ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | || 
Sbjct: 410 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 469

                                                                       
Query: 439 tttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgct 498
           ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 470 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 529

                                                                       
Query: 499 ggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggcag 558
           || |||||||||||||| |||||| |||||||||| || ||||| ||||| || ||||| 
Sbjct: 530 gggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggcaa 589

                                                          
Query: 559 tgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 590 tgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 636



to top

>emb|BX823159.1|CNS0A658 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB94ZC05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score =  228 bits (115), Expect = 2e-56
 Identities = 379/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 145 caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 204

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| || ||||| ||| | || || || || ||||| || || 
Sbjct: 205 aaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggagccgagt 264

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 265 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 324

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagattctca 378
           ||||| ||  ||||| | ||||||||||| || || |||||||| ||||| || ||||| 
Sbjct: 325 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 384

                                                                       
Query: 379 tatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcgc 438
           ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | || 
Sbjct: 385 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 444

                                                                       
Query: 439 tttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgct 498
           ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 445 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 504

                                                                       
Query: 499 ggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggcag 558
           || |||||||||||||| |||||| |||||||||| || ||||| ||||| || ||||| 
Sbjct: 505 gggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggcaa 564

                                                          
Query: 559 tgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 565 tgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 611



to top

>emb|BX822992.1|CNS0A648 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB79ZG11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 948

 Score =  228 bits (115), Expect = 2e-56
 Identities = 379/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 105 caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 164

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| || ||||| ||| | || || || || ||||| || || 
Sbjct: 165 aaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggagccgagt 224

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 225 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 284

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagattctca 378
           ||||| ||  ||||| | ||||||||||| || || |||||||| ||||| || ||||| 
Sbjct: 285 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 344

                                                                       
Query: 379 tatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcgc 438
           ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | || 
Sbjct: 345 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 404

                                                                       
Query: 439 tttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgct 498
           ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 405 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 464

                                                                       
Query: 499 ggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggcag 558
           || |||||||||||||| |||||| |||||||||| || ||||| ||||| || ||||| 
Sbjct: 465 gggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggcaa 524

                                                          
Query: 559 tgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 525 tgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 571



to top

>gb|AF043525.1|AF043525 Arabidopsis thaliana 20S proteasome subunit PAE2 (PAE2) mRNA,
           complete cds
          Length = 983

 Score =  228 bits (115), Expect = 2e-56
 Identities = 379/467 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 109 caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 168

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| || ||||| ||| | || || || || ||||| || || 
Sbjct: 169 aaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggagccgagt 228

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 229 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 288

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagattctca 378
           ||||| ||  ||||| | ||||||||||| || || |||||||| ||||| || ||||| 
Sbjct: 289 gctgacgcgcgaacacttgttgagcatgcacgagtagagacccagaaccacaggttctcg 348

                                                                       
Query: 379 tatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcgc 438
           ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | || 
Sbjct: 349 tatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacgg 408

                                                                       
Query: 439 tttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgct 498
           ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 409 tttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgct 468

                                                                       
Query: 499 ggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggcag 558
           || |||||||||||||| |||||| |||||||||| || ||||| ||||| || ||||| 
Sbjct: 469 gggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggcaa 528

                                                          
Query: 559 tgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 529 tgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 575



to top

>emb|BX822092.1|CNS0A644 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 844

 Score =  206 bits (104), Expect = 6e-50
 Identities = 378/468 (80%), Gaps = 1/468 (0%)
 Strand = Plus / Plus

                                                                       
Query: 139 caggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcgggttgaagacg 198
           ||||| ||||| ||||| || || |||||| | || |||||||| || ||  | ||||||
Sbjct: 90  caggttgagtatgccattgaagctatcaagcttggttctactgctattggtgtaaagacg 149

                                                                       
Query: 199 aaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacctagc 258
           || || || ||||||||||| ||  |||| ||| | || || || || ||||| || || 
Sbjct: 150 aaagagggagttgttcttgcagtccagaagcgtattacttcgcctttactggagccgagt 209

                                                                       
Query: 259 agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
           ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 210 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 269

                                                                       
Query: 319 gctgatgcaagaacattggttgagcatgctcgtgtggagacccaa-aaccatagattctc 377
           ||||| ||  ||||| | ||||||||||| || || ||||||| | ||||| || |||||
Sbjct: 270 gctgacgcgcgaacacttgttgagcatgcacgagtagagaccccagaaccacaggttctc 329

                                                                       
Query: 378 atatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctcttcg 437
            ||||| || ||  |||| || || || || ||||||||| | || ||||| ||| | ||
Sbjct: 330 gtatggtgagccaatgactgtagaatctacaacacaagctttgtgtgatcttgctttacg 389

                                                                       
Query: 438 ctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttattgc 497
            ||||| ||||| || |||||||| ||||| || || |||||||| || ||||| |||||
Sbjct: 390 gtttggtgaaggagaggaagagtcaatgtctcgtccatttggagtatcccttctcattgc 449

                                                                       
Query: 498 tggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttttggca 557
           ||| |||||||||||||| |||||| |||||||||| || ||||| ||||| || |||||
Sbjct: 450 tgggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattctggca 509

                                                           
Query: 558 gtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
            |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 510 atgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 557



to top

>emb|BX822457.1|CNS0A63I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB3ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 868

 Score =  192 bits (97), Expect = 1e-45
 Identities = 334/413 (80%)
 Strand = Plus / Plus

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           |||||||| || || ||||||||||| || ||||| ||| | || || || || ||||| 
Sbjct: 159 aagacgaaagagggagttgttcttgcagtagagaagcgtattacttcgcctttactggag 218

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           || || ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| 
Sbjct: 219 ccgagtagtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggt 278

                                                                       
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccataga 372
           || |||||||| ||  ||||| | || |||||||| || || |||||||| ||||| || 
Sbjct: 279 ctgattgctgacgcgcgaacacttgtagagcatgcacgagtagagacccagaaccacagg 338

                                                                       
Query: 373 ttctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagct 432
           ||||| ||||| || ||  | || || || || || ||||||||| | || | ||| |||
Sbjct: 339 ttctcgtatggtgagccaattactgtagaatctacaacacaagctttgtgtgttcttgct 398

                                                                       
Query: 433 cttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctt 492
            | || ||||| ||||| || |||||||  ||||| || || |||||||| || ||||| 
Sbjct: 399 ttacggtttggtgaaggagaggaagagttaatgtctcgtccatttggagtatcccttctc 458

                                                                       
Query: 493 attgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaaccttt 552
           |||||||| |||||||||||||| |||||| |||||||||| || ||||| ||||| || 
Sbjct: 459 attgctgggcatgatgaaaatggaccgagcctgtactacacagatccatcgggaacattc 518

                                                                
Query: 553 tggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatagttc 605
           ||||| |||||||| |||||||| ||||| ||||| ||||| || ||||||||
Sbjct: 519 tggcaatgcaatgcaaaggcaattgggtctggctcagaaggagctgatagttc 571



to top

>gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0042J05, complete sequence
          Length = 150295

 Score =  155 bits (78), Expect = 2e-34
 Identities = 105/114 (92%)
 Strand = Plus / Minus

                                                                          
Query: 249    ggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgag 308
              |||||| |||||||| |||||||| ||||||||||| |||||  ||||||||||||||||
Sbjct: 102718 ggaaccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgag 102659

                                                                    
Query: 309    tggccttattgctgatgcaagaacattggttgagcatgctcgtgtggagaccca 362
              |||||||||||||||||| |||||||||||||||||||||||||| || |||||
Sbjct: 102658 tggccttattgctgatgctagaacattggttgagcatgctcgtgttgaaaccca 102605



 Score =  143 bits (72), Expect = 8e-31
 Identities = 81/84 (96%)
 Strand = Plus / Minus

                                                                          
Query: 85     aggacggagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtc 144
              |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||
Sbjct: 104159 aggacggagtacgaccgcggggtgaacaccttctccccggaggggcggttgttccaggtc 104100

                                      
Query: 145    gagtacgccatcgaggccatcaag 168
              ||||||||||| ||||||||||||
Sbjct: 104099 gagtacgccattgaggccatcaag 104076



 Score =  117 bits (59), Expect = 5e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                          
Query: 525    gtactacactgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
              |||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 101239 gtactacactgacccatcaggaaccttttggcagtgcaatgccaaggcaattggatcagg 101180

                                                 
Query: 585    ctctgaaggtgccgatagttccttacaggagcagt 619
               |||||||| || ||||| || |||||||||||||
Sbjct: 101179 ttctgaaggagctgatagctcattacaggagcagt 101145



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                          
Query: 167    agttgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggaga 226
              ||||||| || ||||| |||||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 103751 agttggggtcaactgcgatcgggttgaagaccaaggatggtgttgtccttgctgtagaga 103692

                                      
Query: 227    aacgtgtgacgtctccattgctgg 250
              |||||||||| || ||| ||||||
Sbjct: 103691 aacgtgtgacctcgccactgctgg 103668



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                          
Query: 465    gtcacgaccttttggagtttctcttcttattgctggtcatgatgaaaatgggccgagctt 524
              ||||||||| ||||| || ||||| |||||||||||||||||||| ||||| || |||||
Sbjct: 101957 gtcacgaccatttggtgtctctctccttattgctggtcatgatgagaatggacccagctt 101898

                 
Query: 525    gta 527
              |||
Sbjct: 101897 gta 101895



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                          
Query: 367    catagattctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgat 426
              ||||| |||||||||||||| ||  ||||||| || || || ||||||||||| || || 
Sbjct: 102519 cataggttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgac 102460

                                                 
Query: 427    ctagctcttcgctttggagaaggtgaagaagagtc 461
               ||||||| || ||||| |||||||| ||||||||
Sbjct: 102459 ttagctctgcgttttggtgaaggtgatgaagagtc 102425



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 532   actgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
             ||||| |||||||||||||||||||| |||||||  |||||||| || |||||
Sbjct: 88767 actgatccatctggaaccttttggcaatgcaatgacaaggcaattggatcagg 88819



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  155 bits (78), Expect = 2e-34
 Identities = 105/114 (92%)
 Strand = Plus / Minus

                                                                            
Query: 249      ggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgag 308
                |||||| |||||||| |||||||| ||||||||||| |||||  ||||||||||||||||
Sbjct: 23086715 ggaaccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgag 23086656

                                                                      
Query: 309      tggccttattgctgatgcaagaacattggttgagcatgctcgtgtggagaccca 362
                |||||||||||||||||| |||||||||||||||||||||||||| || |||||
Sbjct: 23086655 tggccttattgctgatgctagaacattggttgagcatgctcgtgttgaaaccca 23086602



 Score =  143 bits (72), Expect = 8e-31
 Identities = 81/84 (96%)
 Strand = Plus / Minus

                                                                            
Query: 85       aggacggagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtc 144
                |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||
Sbjct: 23088156 aggacggagtacgaccgcggggtgaacaccttctccccggaggggcggttgttccaggtc 23088097

                                        
Query: 145      gagtacgccatcgaggccatcaag 168
                ||||||||||| ||||||||||||
Sbjct: 23088096 gagtacgccattgaggccatcaag 23088073



 Score =  117 bits (59), Expect = 5e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 525      gtactacactgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
                |||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 23085236 gtactacactgacccatcaggaaccttttggcagtgcaatgccaaggcaattggatcagg 23085177

                                                   
Query: 585      ctctgaaggtgccgatagttccttacaggagcagt 619
                 |||||||| || ||||| || |||||||||||||
Sbjct: 23085176 ttctgaaggagctgatagctcattacaggagcagt 23085142



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                            
Query: 167      agttgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggaga 226
                ||||||| || ||||| |||||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 23087748 agttggggtcaactgcgatcgggttgaagaccaaggatggtgttgtccttgctgtagaga 23087689

                                        
Query: 227      aacgtgtgacgtctccattgctgg 250
                |||||||||| || ||| ||||||
Sbjct: 23087688 aacgtgtgacctcgccactgctgg 23087665



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                            
Query: 465      gtcacgaccttttggagtttctcttcttattgctggtcatgatgaaaatgggccgagctt 524
                ||||||||| ||||| || ||||| |||||||||||||||||||| ||||| || |||||
Sbjct: 23085954 gtcacgaccatttggtgtctctctccttattgctggtcatgatgagaatggacccagctt 23085895

                   
Query: 525      gta 527
                |||
Sbjct: 23085894 gta 23085892



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                            
Query: 367      catagattctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgat 426
                ||||| |||||||||||||| ||  ||||||| || || || ||||||||||| || || 
Sbjct: 23086516 cataggttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgac 23086457

                                                   
Query: 427      ctagctcttcgctttggagaaggtgaagaagagtc 461
                 ||||||| || ||||| |||||||| ||||||||
Sbjct: 23086456 ttagctctgcgttttggtgaaggtgatgaagagtc 23086422



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                     
Query: 532      actgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
                ||||| |||||||||||||||||||| |||||||  |||||||| || |||||
Sbjct: 23072764 actgatccatctggaaccttttggcaatgcaatgacaaggcaattggatcagg 23072816



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 127      gggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
                ||||| ||||||||||||||||| ||||| |||| |||||||
Sbjct: 11307999 gggcgtctgttccaggtcgagtatgccattgaggtcatcaag 11308040



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  155 bits (78), Expect = 2e-34
 Identities = 105/114 (92%)
 Strand = Plus / Minus

                                                                            
Query: 249      ggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgag 308
                |||||| |||||||| |||||||| ||||||||||| |||||  ||||||||||||||||
Sbjct: 23396625 ggaaccaagcagtgtggagaaaatcatggaaattgacgagcacataggctgtgccatgag 23396566

                                                                      
Query: 309      tggccttattgctgatgcaagaacattggttgagcatgctcgtgtggagaccca 362
                |||||||||||||||||| |||||||||||||||||||||||||| || |||||
Sbjct: 23396565 tggccttattgctgatgctagaacattggttgagcatgctcgtgttgaaaccca 23396512



 Score =  143 bits (72), Expect = 8e-31
 Identities = 81/84 (96%)
 Strand = Plus / Minus

                                                                            
Query: 85       aggacggagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtc 144
                |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||
Sbjct: 23398066 aggacggagtacgaccgcggggtgaacaccttctccccggaggggcggttgttccaggtc 23398007

                                        
Query: 145      gagtacgccatcgaggccatcaag 168
                ||||||||||| ||||||||||||
Sbjct: 23398006 gagtacgccattgaggccatcaag 23397983



 Score =  117 bits (59), Expect = 5e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 525      gtactacactgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
                |||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 23395146 gtactacactgacccatcaggaaccttttggcagtgcaatgccaaggcaattggatcagg 23395087

                                                   
Query: 585      ctctgaaggtgccgatagttccttacaggagcagt 619
                 |||||||| || ||||| || |||||||||||||
Sbjct: 23395086 ttctgaaggagctgatagctcattacaggagcagt 23395052



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                            
Query: 167      agttgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggaga 226
                ||||||| || ||||| |||||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 23397658 agttggggtcaactgcgatcgggttgaagaccaaggatggtgttgtccttgctgtagaga 23397599

                                        
Query: 227      aacgtgtgacgtctccattgctgg 250
                |||||||||| || ||| ||||||
Sbjct: 23397598 aacgtgtgacctcgccactgctgg 23397575



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                            
Query: 465      gtcacgaccttttggagtttctcttcttattgctggtcatgatgaaaatgggccgagctt 524
                ||||||||| ||||| || ||||| |||||||||||||||||||| ||||| || |||||
Sbjct: 23395864 gtcacgaccatttggtgtctctctccttattgctggtcatgatgagaatggacccagctt 23395805

                   
Query: 525      gta 527
                |||
Sbjct: 23395804 gta 23395802



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                            
Query: 367      catagattctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgat 426
                ||||| |||||||||||||| ||  ||||||| || || || ||||||||||| || || 
Sbjct: 23396426 cataggttctcatatggggagccaatgacagtagaatctactacacaagctatctgtgac 23396367

                                                   
Query: 427      ctagctcttcgctttggagaaggtgaagaagagtc 461
                 ||||||| || ||||| |||||||| ||||||||
Sbjct: 23396366 ttagctctgcgttttggtgaaggtgatgaagagtc 23396332



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                     
Query: 532      actgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
                ||||| |||||||||||||||||||| |||||||  |||||||| || |||||
Sbjct: 23382674 actgatccatctggaaccttttggcaatgcaatgacaaggcaattggatcagg 23382726



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 127      gggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
                ||||| ||||||||||||||||| ||||| |||| |||||||
Sbjct: 11387188 gggcgtctgttccaggtcgagtatgccattgaggtcatcaag 11387229



to top

>dbj|AK220949.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-54-C04
          Length = 543

 Score =  137 bits (69), Expect = 5e-29
 Identities = 144/169 (85%)
 Strand = Plus / Plus

                                                                       
Query: 434 ttcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttctta 493
           |||| ||||| ||||| || ||||| || ||||| || || |||||||| |||||||| |
Sbjct: 4   ttcggtttggtgaaggagaggaagaatcaatgtctcggccgtttggagtatctcttctca 63

                                                                       
Query: 494 ttgctggtcatgatgaaaatgggccgagcttgtactacactgacccatctggaacctttt 553
           ||||||| |||||||||||||| || ||||||||||||||||| || || ||||| || |
Sbjct: 64  ttgctggccatgatgaaaatggaccaagcttgtactacactgatccttcaggaacattct 123

                                                            
Query: 554 ggcagtgcaatgctaaggcaatagggtcaggctctgaaggtgccgatag 602
           ||||||||||||| |||||||| || ||||| |||||||| || |||||
Sbjct: 124 ggcagtgcaatgcaaaggcaattggttcaggttctgaaggagctgatag 172



to top

>emb|AJ291735.1|NTA291735 Nicotiana tabacum partial mRNA for putative alpha5 proteasome
           subunit (a5 gene)
          Length = 315

 Score =  133 bits (67), Expect = 8e-28
 Identities = 253/315 (80%)
 Strand = Plus / Plus

                                                                       
Query: 195 gacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaacc 254
           |||||| || || ||||| ||||| || ||||| || || || |||||| | ||||| ||
Sbjct: 1   gacgaaagagggagttgtccttgcagttgagaagcgagttacctctccacttctggagcc 60

                                                                       
Query: 255 tagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggcct 314
            |||||||| ||||||||||||||||||||||||||| | |||||||| ||||||||  |
Sbjct: 61  aagcagtgtggagaaaattatggaaattgatgagcatattggctgtgcgatgagtggatt 120

                                                                       
Query: 315 tattgctgatgcaagaacattggttgagcatgctcgtgtggagacccaaaaccatagatt 374
            || ||||||||||| ||  | ||||| ||||| || || || || || ||||| || ||
Sbjct: 121 gatagctgatgcaaggactcttgttgaacatgcacgagttgaaactcagaaccacaggtt 180

                                                                       
Query: 375 ctcatatggggaaccgttgacagtcgagtccaccacacaagctatttgcgatctagctct 434
            || ||||| || ||  |||| || |||||||| ||||||||| | || ||| | || ||
Sbjct: 181 ttcttatggtgagcccatgactgttgagtccacaacacaagctctgtgtgatttggccct 240

                                                                       
Query: 435 tcgctttggagaaggtgaagaagagtctatgtcacgaccttttggagtttctcttcttat 494
            || ||||| || ||||| ||||||||||||||  |||||||||| || || ||||| ||
Sbjct: 241 gcgatttggggagggtgatgaagagtctatgtccagaccttttggtgtatcacttctcat 300

                          
Query: 495 tgctggtcatgatga 509
           |||||| ||||||||
Sbjct: 301 tgctggccatgatga 315



to top

>emb|BX824071.1|CNS0A5L7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH1ZD09 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1499

 Score =  117 bits (59), Expect = 5e-23
 Identities = 113/131 (86%)
 Strand = Plus / Plus

                                                                        
Query: 475  tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgtactacact 534
            |||||||| || ||||| |||||||| |||||||||||||| |||||| |||||||||| 
Sbjct: 1030 tttggagtatcccttctcattgctgggcatgatgaaaatggaccgagcctgtactacaca 1089

                                                                        
Query: 535  gacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcaggctctgaaggt 594
            || ||||| ||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| 
Sbjct: 1090 gatccatcgggaacattctggcaatgcaatgcaaaggcaattgggtctggctcagaagga 1149

                       
Query: 595  gccgatagttc 605
            || ||||||||
Sbjct: 1150 gctgatagttc 1160



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Plus

                                                                       
Query: 193 aagacgaaggatggggttgttcttgctgtggagaaacgtgtgacgtctccattgctggaa 252
           |||||||| || || ||||||||||| || ||||| ||| | || || || || ||||| 
Sbjct: 343 aagacgaaagagggagttgttcttgcagtcgagaagcgtattacttcgcctttactggag 402

                                                                       
Query: 253 cctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggc 312
           || || ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| 
Sbjct: 403 ccgagtagtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggt 462

                                                             
Query: 313 cttattgctgatgcaagaacattggttgagcatgctcgtgtggagaccca 362
           || |||||||| ||  ||||| | ||||||||||| || || ||||||||
Sbjct: 463 ctgattgctgacgcgcgaacacttgttgagcatgcacgagtagagaccca 512



to top

>emb|AJ418041.1|PPA418041 Physcomitrella patens mRNA for 20S proteasome subunit alpha V (zeta
           gene)
          Length = 952

 Score =  115 bits (58), Expect = 2e-22
 Identities = 145/174 (83%)
 Strand = Plus / Plus

                                                                       
Query: 454 gaagagtctatgtcacgaccttttggagtttctcttcttattgctggtcatgatgaaaat 513
           ||||| || |||||||| ||||| ||||||||||| || |||||||| |||||||| | |
Sbjct: 462 gaagaatcaatgtcacgtcctttcggagtttctctgctcattgctggccatgatgagagt 521

                                                                       
Query: 514 gggccgagcttgtactacactgacccatctggaaccttttggcagtgcaatgctaaggca 573
           || ||  |||||||| |||| || ||||||||||| |||||||| ||  |||||||||||
Sbjct: 522 ggaccatgcttgtaccacacagatccatctggaacattttggcaatgtgatgctaaggca 581

                                                                 
Query: 574 atagggtcaggctctgaaggtgccgatagttccttacaggagcagtttaacaag 627
           || || ||||| || ||||||||||||| |||| | ||||| || || ||||||
Sbjct: 582 attggttcaggatcagaaggtgccgatacttcccttcaggaacatttcaacaag 635



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           ||||||| | |||||| ||||| || |||||||| ||||| ||| | || ||||||||||
Sbjct: 256 tggaacccaccagtgtcgagaagatcatggaaatcgatgaacatattgggtgtgccatga 315

               
Query: 308 gtgg 311
           ||||
Sbjct: 316 gtgg 319



to top

>gb|DQ214008.1| Taeniopygia guttata clone 0064P0007F03 proteasome alpha 5 subunit
           variant 1-like mRNA, complete sequence
          Length = 1055

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 64  cgcgccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccg 123
           |||||| |||||||||||||| |  | ||||||||||| || |||||||| ||||| |||
Sbjct: 109 cgcgccgccatgttcctcacgcgctccgagtacgaccggggtgtgaacacgttctctccg 168

                                                        
Query: 124 gaggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           |||||| |||| |||||||| || || ||||||||||||||||||
Sbjct: 169 gaggggaggctcttccaggtggaatatgccatcgaggccatcaag 213



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 298 tgtgccatgagtggccttattgctgatgcaa 328
           ||||||||||||||||| || ||||||||||
Sbjct: 343 tgtgccatgagtggcctaatagctgatgcaa 373



to top

>ref|NM_001031407.1| Gallus gallus proteasome (prosome, macropain) subunit, alpha type,
           5 (PSMA5), mRNA
          Length = 1047

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                       
Query: 69  caccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggg 128
           ||||||||| |||||| |  | ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 101 caccatgtttctcacgcgctctgagtacgaccggggcgtgaacactttctctccggaggg 160

                                               
Query: 129 gcggctgttccaggtcgagtacgccatcgaggccat 164
           | |||||||||| || ||||| ||||||||||||||
Sbjct: 161 gaggctgttccaagtggagtatgccatcgaggccat 196



to top

>emb|AJ720305.1| Gallus gallus mRNA for hypothetical protein, clone 14i9
          Length = 1047

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                       
Query: 69  caccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggg 128
           ||||||||| |||||| |  | ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 101 caccatgtttctcacgcgctctgagtacgaccggggcgtgaacactttctctccggaggg 160

                                               
Query: 129 gcggctgttccaggtcgagtacgccatcgaggccat 164
           | |||||||||| || ||||| ||||||||||||||
Sbjct: 161 gaggctgttccaagtggagtatgccatcgaggccat 196



to top

>emb|CR386956.1| Gallus gallus finished cDNA, clone ChEST102f7
          Length = 769

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                       
Query: 69  caccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggg 128
           ||||||||| |||||| |  | ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 112 caccatgtttctcacgcgctctgagtacgaccggggcgtgaacactttctctccggaggg 171

                                               
Query: 129 gcggctgttccaggtcgagtacgccatcgaggccat 164
           | |||||||||| || ||||| ||||||||||||||
Sbjct: 172 gaggctgttccaagtggagtatgccatcgaggccat 207



to top

>gb|DQ214009.1| Taeniopygia guttata clone 0061P0007F09 proteasome alpha 5 subunit
           variant 1-like mRNA, complete sequence
          Length = 1034

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 64  cgcgccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccg 123
           |||||| |||||||||||||| |  | ||||||||||| || |||||||| ||||| |||
Sbjct: 89  cgcgccgccatgttcctcacgcgctccgagtacgaccggggtgtgaacacgttctctccg 148

                                                        
Query: 124 gaggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           |||||| | || |||||||| || || ||||||||||||||||||
Sbjct: 149 gaggggagactcttccaggtggaatatgccatcgaggccatcaag 193



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 298 tgtgccatgagtggccttattgctgatgcaa 328
           ||||||||||||||||| || ||||||||||
Sbjct: 324 tgtgccatgagtggcctaatagctgatgcaa 354



to top

>dbj|AB022220.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLN21
          Length = 83906

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                         
Query: 259   agtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttatt 318
             ||||||||||| ||||||||||||||||| ||| |||| ||||| |||||||| || |||
Sbjct: 29264 agtgttgagaagattatggaaattgatgaccatataggttgtgctatgagtggtctgatt 29323

                                                         
Query: 319   gctgatgcaagaacattggttgagcatgctcgtgtggagaccca 362
             ||||| ||  ||||| | ||||||||||| || || ||||||||
Sbjct: 29324 gctgacgcgcgaacacttgttgagcatgcacgagtagagaccca 29367



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 475   tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgta 527
             |||||||| || ||||| |||||||| |||||||||||||| |||||| ||||
Sbjct: 29885 tttggagtatcccttctcattgctgggcatgatgaaaatggaccgagcctgta 29937



to top

>gb|AY232148.1| Drosophila yakuba clone yak-ad_ProsMA5 mRNA sequence
          Length = 555

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           ||||||||| | ||||||||||||||||| |||||||| || || ||||| || || |||
Sbjct: 19  gagtacgacagaggcgtgaacaccttctcgccggagggccgcctcttccaagtggaatac 78

                                  
Query: 151 gccatcgaggccatcaagttggg 173
           ||||| ||||||||||| |||||
Sbjct: 79  gccattgaggccatcaaattggg 101



to top

>ref|NM_166221.2| Drosophila melanogaster Proteasome  subunit CG10938-RA, transcript
           variant A (ProsMA5), mRNA
          Length = 884

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 68  ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
           |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 72  ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 131

                                                         
Query: 128 ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
           | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 132 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 177



to top

>ref|NM_057854.3| Drosophila melanogaster Proteasome  subunit CG10938-RB, transcript
           variant B (ProsMA5), mRNA
          Length = 885

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 68  ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
           |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 68  ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 127

                                                         
Query: 128 ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
           | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 128 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 173



to top

>gb|AY061404.1| Drosophila melanogaster LD33318 full length cDNA
          Length = 888

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 68  ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
           |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 63  ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 122

                                                         
Query: 128 ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
           | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 123 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 168



to top

>gb|AC009535.9| Drosophila melanogaster, chromosome 2R, region 54B-54B, BAC clone
              BACR28O12, complete sequence
          Length = 161244

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                          
Query: 68     ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
              |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 127396 ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 127455

                                                            
Query: 128    ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
              | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 127456 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 127501



to top

>gb|AC008004.5|AC008004 Drosophila melanogaster, chromosome 2R, region 54B-54C, BAC clone
            BACR21A09, complete sequence
          Length = 175506

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                        
Query: 68   ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
            |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 4397 ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 4456

                                                          
Query: 128  ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
            | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 4457 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 4502



to top

>gb|AE003803.4| Drosophila melanogaster chromosome 2R, section 47 of 73 of the complete
              sequence
          Length = 290783

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                          
Query: 68     ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
              |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 147414 ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 147473

                                                            
Query: 128    ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
              | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 147474 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 147519



to top

>gb|U64721.1|DMU64721 Drosophila melanogaster 20S proteasome alpha subunit PSMA5 gene,
           complete cds
          Length = 1062

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 68  ccaccatgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggagg 127
           |||||||||| |||||| |  | ||||||||| | ||||||||||||||||| |||||||
Sbjct: 141 ccaccatgtttctcacgcgttccgagtacgacagaggcgtgaacaccttctcgccggagg 200

                                                         
Query: 128 ggcggctgttccaggtcgagtacgccatcgaggccatcaagttggg 173
           | || || ||||| || || || ||||| ||||||||||| |||||
Sbjct: 201 gccgcctcttccaagtggaatatgccattgaggccatcaaattggg 246



to top

>emb|BX063332.1|CNS09L14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 112 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 171

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 172 gccatcgaggcgatcaa 188



to top

>emb|BX062751.1|CNS09KKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 16  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 75

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 76  gccatcgaggcgatcaa 92



to top

>emb|BX056699.1|CNS09FWV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 100 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 159

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 160 gccatcgaggcgatcaa 176



to top

>emb|BX031436.1|CNS08WF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 90  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 149

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 150 gccatcgaggcgatcaa 166



to top

>emb|BX019821.1|CNS08NGH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 133 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 192

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 193 gccatcgaggcgatcaa 209



to top

>emb|BX017936.1|CNS08M04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 107 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 166

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 167 gccatcgaggcgatcaa 183



to top

>emb|BX018241.1|CNS08M8L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 110 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 169

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 170 gccatcgaggcgatcaa 186



to top

>emb|BX015753.1|CNS08KBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 94  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 153

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 154 gccatcgaggcgatcaa 170



to top

>emb|BX011882.1|CNS08HBY Single read from an extremity of a full-length cDNA clone made from
            Anopheles gambiae total adult females. 3-PRIME end of
            clone FK0AAA18DG09 of strain 6-9 of Anopheles gambiae
            (African malaria mosquito)
          Length = 1025

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                        
Query: 91   gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
            |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 1025 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 966

                             
Query: 151  gccatcgaggccatcaa 167
            ||||||||||| |||||
Sbjct: 965  gccatcgaggcgatcaa 949



to top

>emb|BX011881.1|CNS08HBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 77  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 136

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 137 gccatcgaggcgatcaa 153



to top

>emb|BX011202.1|CNS08GT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 123 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 182

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 183 gccatcgaggcgatcaa 199



to top

>emb|BX010636.1|CNS08GDC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 129 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 188

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 189 gccatcgaggcgatcaa 205



to top

>emb|BX009604.1|CNS08FKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 83  gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 142

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 143 gccatcgaggcgatcaa 159



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                            
Query: 170      tgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaac 229
                |||| ||||||||||| |||||||||||||  |||| ||| ||| ||| |||||||||||
Sbjct: 18913559 tgggctctactgcaattgggttgaagacgatagatgaggtggttattgttgtggagaaac 18913500

                                     
Query: 230      gtgtgacgtctccattgctgg 250
                |||| || || ||||||||||
Sbjct: 18913499 gtgtaacctcgccattgctgg 18913479



to top

>ref|XM_314945.2| Anopheles gambiae str. PEST ENSANGP00000019329
           (ENSANGG00000016840), mRNA
          Length = 1160

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 132 gagtacgatcgtggagtgaacaccttctcgcccgagggtcgtctgttccaggttgagtat 191

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 192 gccatcgaggcgatcaa 208



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                            
Query: 170      tgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaac 229
                |||| ||||||||||| |||||||||||||  |||| ||| ||| ||| |||||||||||
Sbjct: 18839786 tgggctctactgcaattgggttgaagacgatagatgaggtggttattgttgtggagaaac 18839727

                                     
Query: 230      gtgtgacgtctccattgctgg 250
                |||| || || ||||||||||
Sbjct: 18839726 gtgtaacctcgccattgctgg 18839706



to top

>emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa0028H02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 153064

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                         
Query: 170   tgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaac 229
             |||| ||||||||||| |||||||||||||  |||| ||| ||| ||| |||||||||||
Sbjct: 56820 tgggctctactgcaattgggttgaagacgatagatgaggtggttattgttgtggagaaac 56879

                                  
Query: 230   gtgtgacgtctccattgctgg 250
             |||| || || ||||||||||
Sbjct: 56880 gtgtaacctcgccattgctgg 56900



to top

>emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa0018L16 of library OSJNBa
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 151203

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                        
Query: 170  tgggatctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaac 229
            |||| ||||||||||| |||||||||||||  |||| ||| ||| ||| |||||||||||
Sbjct: 9676 tgggctctactgcaattgggttgaagacgatagatgaggtggttattgttgtggagaaac 9617

                                 
Query: 230  gtgtgacgtctccattgctgg 250
            |||| || || ||||||||||
Sbjct: 9616 gtgtaacctcgccattgctgg 9596



to top

>gb|AC009324.2| Arabidopsis thaliana chromosome I BAC T18A20 genomic sequence, complete
             sequence
          Length = 85413

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                         
Query: 525   gtactacactgacccatctggaaccttttggcagtgcaatgctaaggcaatagggtcagg 584
             |||||||||||| || || ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 39795 gtactacactgatccttcaggaacattctggcagtgcaatgcaaaggcaattggttcagg 39736

                               
Query: 585   ctctgaaggtgccgatag 602
              |||||||| || |||||
Sbjct: 39735 ttctgaaggagctgatag 39718



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 475   tttggagtttctcttcttattgctggtcatgatgaaaatgggccgagcttgta 527
             |||||||| |||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 39937 tttggagtatctcttctcattgctggccatgatgaaaatggaccaagcttgta 39885



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 249   ggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatgag 308
             |||||| |||||||| ||||| ||||||||||||||||| ||| | || ||||| |||||
Sbjct: 40361 ggaaccgagcagtgtggagaagattatggaaattgatgaccatattggttgtgctatgag 40302



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 364   aaccatagattctcatatggggaaccgttgacagtcgagtccaccacacaagc 416
             |||||||||||||| ||||| || ||| |||| || |||||||| ||||||||
Sbjct: 40161 aaccatagattctcgtatggtgagccgatgactgtagagtccacaacacaagc 40109



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                         
Query: 175   tctactgcaatcgggttgaagacgaaggatggggttgttcttgctgtggagaaacgtgtg 234
             ||||||||||| ||  | ||||| || || || ||||| |||||||| ||||| ||| | 
Sbjct: 40613 tctactgcaattggagtaaagacaaaagaaggagttgtgcttgctgtcgagaagcgtatc 40554

                             
Query: 235   acgtctccattgctgg 250
             ||||| ||||||||||
Sbjct: 40553 acgtcgccattgctgg 40538



to top

>emb|BX066418.1|CNS09NEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagtacgaccgcggcgtgaacaccttctccccggaggggcggctgttccaggtcgagtac 150
           |||||||| || || |||||||||||||| || || || || ||||||||||| ||||| 
Sbjct: 19  gagtacgatcgtggagtgaacaccttctcgcccgatggtcgtctgttccaggttgagtat 78

                            
Query: 151 gccatcgaggccatcaa 167
           ||||||||||| |||||
Sbjct: 79  gccatcgaggcgatcaa 95



to top

>gb|BT017945.1| Zea mays clone EL01N0521D09.c mRNA sequence
          Length = 1171

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 125 aggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           ||||||||||||||||||| ||||||||||| |||||| |||||
Sbjct: 160 aggggcggctgttccaggtggagtacgccatggaggccgtcaag 203



to top

>ref|XM_367205.1| Magnaporthe grisea 70-15 hypothetical protein (MG07130.4) partial
           mRNA
          Length = 738

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 109 aacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           ||||||||||||||||| || || || ||||||||||| ||| || ||||||||||||||
Sbjct: 37  aacaccttctccccggaaggtcgtctcttccaggtcgaatactccctcgaggccatcaag 96



to top

>gb|AY104937.1| Zea mays PCO082324 mRNA sequence
          Length = 1160

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 125 aggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           ||||||||||||||||||| ||||||||||| |||||| |||||
Sbjct: 190 aggggcggctgttccaggtggagtacgccatggaggccgtcaag 233



to top

>ref|XM_464030.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1079

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 120 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 136 cccggcggggcggctgttccaggtggagtacgccatggaggcc 178



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                          
Query: 120     cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
               ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 1784747 cccggcggggcggctgttccaggtggagtacgccatggaggcc 1784789



to top

>dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0030G11
          Length = 143943

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                         
Query: 120    cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
              ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 102759 cccggcggggcggctgttccaggtggagtacgccatggaggcc 102801



to top

>dbj|AK109376.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D06, full
           insert sequence
          Length = 1080

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 120 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 119 cccggcggggcggctgttccaggtggagtacgccatggaggcc 161



to top

>dbj|AP004799.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0585B01
          Length = 133231

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 120   cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
             ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 21391 cccggcggggcggctgttccaggtggagtacgccatggaggcc 21433



to top

>dbj|AK103646.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033135B19, full
           insert sequence
          Length = 1079

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 120 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 136 cccggcggggcggctgttccaggtggagtacgccatggaggcc 178



to top

>dbj|D37886.1|RICPC2SA Rice mRNA for proteasome C2 subunit, complete cds
          Length = 1045

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 120 cccggaggggcggctgttccaggtcgagtacgccatcgaggcc 162
           ||||| |||||||||||||||||| ||||||||||| ||||||
Sbjct: 121 cccggcggggcggctgttccaggtggagtacgccatggaggcc 163



to top

>gb|AF424643.1| Phytophthora infestans clone MY-03-E-06 proteasome subunit mRNA,
           complete cds
          Length = 911

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 111 caccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaa 167
           ||||||||||||||| || || || |||||||| || |||||||| |||||||||||
Sbjct: 58  caccttctccccggaaggccgactcttccaggtggaatacgccatggaggccatcaa 114



to top

>ref|XM_956973.1| Neurospora crassa OR74A hypothetical protein (NCU05295.1) partial
           mRNA
          Length = 738

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 109 aacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           |||||||||||||| || || || || ||||| ||||||||| || ||||||||||||||
Sbjct: 37  aacaccttctcccccgaaggccgcctcttccaagtcgagtactccctcgaggccatcaag 96



to top

>ref|XM_324651.1| Neurospora crassa OR74A hypothetical protein (NCU05295.1) partial
           mRNA
          Length = 738

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 109 aacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           |||||||||||||| || || || || ||||| ||||||||| || ||||||||||||||
Sbjct: 37  aacaccttctcccccgaaggccgcctcttccaagtcgagtactccctcgaggccatcaag 96



to top

>dbj|AK099876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111H14, full
           insert sequence
          Length = 1567

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           ||||| |||| ||||| |||||| ||||||||  | | ||  ||||| | ||| ||||| 
Sbjct: 715 atgtttctcatgaggatggagtaagaccgcgggttaaccattttctcactggacgggcgt 774

                                               
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaag 168
           ||||||||||||||||| ||||| |||| |||||||
Sbjct: 775 ctgttccaggtcgagtatgccattgaggtcatcaag 810



to top

>gb|BC060575.1| Rattus norvegicus proteasome (prosome, macropain) subunit, alpha
           type 5, mRNA (cDNA clone MGC:72877 IMAGE:6920479),
           complete cds
          Length = 1017

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||||||  | || |||||||  ||| |||| ||||||||||
Sbjct: 281 tggagcctagcagcattgagaaaatcgtagagattgatgctcatataggttgtgccatga 340

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 341 gtgggctaattgctgatgc 359



to top

>ref|XM_451224.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A05093g predicted mRNA
          Length = 789

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 562 aatgctaaggcaatagggtcaggctctgaaggtgc 596
           |||||||||||||| |||||||| |||||||||||
Sbjct: 502 aatgctaaggcaatcgggtcaggttctgaaggtgc 536



to top

>emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome A of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1062590

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 562    aatgctaaggcaatagggtcaggctctgaaggtgc 596
              |||||||||||||| |||||||| |||||||||||
Sbjct: 454924 aatgctaaggcaatcgggtcaggttctgaaggtgc 454958



to top

>ref|NM_017282.1| Rattus norvegicus proteasome (prosome, macropain) subunit, alpha
           type 5 (Psma5), mRNA
          Length = 970

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||||||  | || |||||||  ||| |||| ||||||||||
Sbjct: 260 tggagcctagcagcattgagaaaatcgtagagattgatgctcatataggttgtgccatga 319

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 320 gtgggctaattgctgatgc 338



to top

>dbj|D10756.1|RATPRORZ Rat mRNA for proteasome subunit R-ZETA, complete cds
          Length = 970

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||||||  | || |||||||  ||| |||| ||||||||||
Sbjct: 260 tggagcctagcagcattgagaaaatcgtagagattgatgctcatataggttgtgccatga 319

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 320 gtgggctaattgctgatgc 338



to top

>gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0015P05 map C53961S, complete sequence
          Length = 175121

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 127   gggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
             ||||| ||||||||||||||||| ||||| |||| |||||||
Sbjct: 94357 gggcgtctgttccaggtcgagtatgccattgaggtcatcaag 94398



to top

>ref|XM_757288.1| Ustilago maydis 521 hypothetical protein (UM06234.1) partial mRNA
          Length = 918

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaa 167
           |||||||||||| || ||||||| |||||||||||| ||| || |||| |||||
Sbjct: 36  cttctccccggacggacggctgtaccaggtcgagtatgccttcaaggcgatcaa 89



to top

>ref|XM_750383.1| Aspergillus fumigatus Af293 proteasome component Pup2 (Afu2g11440)
           partial mRNA
          Length = 753

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 109 aacaccttctccccggaggggcggctgttccaggtcga 146
           |||||||||||||| || ||||| ||||||||||||||
Sbjct: 49  aacaccttctcccccgaagggcgcctgttccaggtcga 86



to top

>gb|AY431444.1| Aedes aegypti ASAP ID: 43014 proteasome endopeptidase mRNA sequence
          Length = 745

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 94/117 (80%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           ||||||||||| ||  | || || ||||| || || ||||||||||| || ||||| || 
Sbjct: 54  atgttcctcaccagatccgaatatgaccgtggtgtcaacaccttctcgccagagggccga 113

                                                                    
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcggg 189
           || ||||| || || ||||||||||| ||||| ||| | |||||||| || ||||||
Sbjct: 114 ctcttccaagtagaatacgccatcgaagccataaagctcggatctacggccatcggg 170



to top

>gb|DQ440413.1| Aedes aegypti clone AET-5533 20S proteasome regulatory subunit
           alpha type  PSMA5/PUP2 mRNA, complete cds
          Length = 729

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 94/117 (80%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgttcctcacgaggacggagtacgaccgcggcgtgaacaccttctccccggaggggcgg 132
           ||||||||||| ||  | || || ||||| || || ||||||||||| || ||||| || 
Sbjct: 1   atgttcctcaccagatccgaatatgaccgtggtgtcaacaccttctcgccagagggccga 60

                                                                    
Query: 133 ctgttccaggtcgagtacgccatcgaggccatcaagttgggatctactgcaatcggg 189
           || ||||| || || ||||||||||| ||||| ||| | |||||||| || ||||||
Sbjct: 61  ctcttccaagtagaatacgccatcgaagccataaagctcggatctacggccatcggg 117



to top

>ref|NM_185696.1| Oryza sativa (japonica cultivar-group), Ozsa8047 predicted mRNA
          Length = 753

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 33  cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 80



to top

>ref|NM_185686.1| Oryza sativa (japonica cultivar-group), Ozsa8037 predicted mRNA
          Length = 753

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 33  cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 80



to top

>ref|XM_525179.1| PREDICTED: Pan troglodytes LOC469795 (LOC469795), mRNA
          Length = 534

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 263 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 322

               
Query: 323 atgc 326
           ||||
Sbjct: 323 atgc 326



to top

>ref|NM_002790.2| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5
           (PSMA5), mRNA
          Length = 1023

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 276 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 335

               
Query: 323 atgc 326
           ||||
Sbjct: 336 atgc 339



to top

>gb|BT019717.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5
           mRNA, complete cds
          Length = 726

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 191 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 250

               
Query: 323 atgc 326
           ||||
Sbjct: 251 atgc 254



to top

>gb|BT019716.1| Synthetic construct Homo sapiens proteasome (prosome, macropain)
           subunit, alpha type, 5 mRNA, partial cds
          Length = 726

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 191 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 250

               
Query: 323 atgc 326
           ||||
Sbjct: 251 atgc 254



to top

>gb|BC102020.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           5, mRNA (cDNA clone MGC:125804 IMAGE:40030394), complete
           cds
          Length = 881

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 261 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 320

               
Query: 323 atgc 326
           ||||
Sbjct: 321 atgc 324



to top

>gb|BC102019.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           5, mRNA (cDNA clone MGC:125803 IMAGE:40030392), complete
           cds
          Length = 881

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 261 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 320

               
Query: 323 atgc 326
           ||||
Sbjct: 321 atgc 324



to top

>gb|BC102018.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           5, mRNA (cDNA clone MGC:125802 IMAGE:40030391), complete
           cds
          Length = 881

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 261 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 320

               
Query: 323 atgc 326
           ||||
Sbjct: 321 atgc 324



to top

>gb|BC103751.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           5, mRNA (cDNA clone MGC:117302 IMAGE:6013212), complete
           cds
          Length = 1005

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 284 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 343

               
Query: 323 atgc 326
           ||||
Sbjct: 344 atgc 347



to top

>ref|NM_001015566.1| Bos taurus proteasome (prosome, macropain) subunit, alpha type, 5
           (PSMA5), mRNA
          Length = 970

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 291 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 350

               
Query: 323 atgc 326
           ||||
Sbjct: 351 atgc 354



to top

>ref|XR_002428.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 5
            (Proteasome zeta chain) (Macropain zeta chain)
            (Multicatalytic endopeptidase complex zeta chain)
            (LOC669202), mRNA
          Length = 4047

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                        
Query: 248  tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
            |||| ||||||||  ||||||||||| |||| |||||||  ||| |||| ||||||||||
Sbjct: 2746 tggagcctagcagcattgagaaaattgtggagattgatgctcatataggttgtgccatga 2805



to top

>ref|XM_386335.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG06159.1) partial mRNA
          Length = 732

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 109 aacaccttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaag 168
           |||||||||||||| || || || || ||||||||||| ||| |  ||||||||||||||
Sbjct: 31  aacaccttctcccccgaaggccgtctcttccaggtcgaatactctctcgaggccatcaag 90



to top

>gb|AC134331.2| Mus musculus BAC clone RP24-344O12 from chromosome 19, complete
             sequence
          Length = 155342

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                         
Query: 248   tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
             |||| ||||||||  ||||||||||| |||| |||||||  ||| |||| ||||||||||
Sbjct: 83910 tggagcctagcagcattgagaaaattgtggagattgatgctcatataggttgtgccatga 83969



to top

>ref|XM_736381.1| Plasmodium chabaudi chabaudi proteasome subunit alpha type 5,
           (PC000270.04.0) partial mRNA
          Length = 759

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 280 attgatgagcatgtaggctgtgccatgagtggccttattgctgatgcaagaacattggtt 339
           |||||||| ||| |||| ||||| ||||||||  | || || ||||||||||||||| ||
Sbjct: 196 attgatgatcatataggatgtgcaatgagtggattgatggcagatgcaagaacattgatt 255

                   
Query: 340 gagcatgc 347
           || |||||
Sbjct: 256 gatcatgc 263



to top

>emb|X61970.1|HSMPZE H.sapiens mRNA for macropain subunit zeta
          Length = 959

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 212 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 271

               
Query: 323 atgc 326
           ||||
Sbjct: 272 atgc 275



to top

>emb|X52319.1|DMPROS29 Fruit fly mRNA for proteosome subunit
          Length = 928

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 110 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 161



to top

>emb|CR456847.1| Homo sapiens full open reading frame cDNA clone RZPDo834E076D for
           gene PSMA5, proteasome (prosome, macropain) subunit,
           alpha type, 5; complete cds, incl. stopcodon
          Length = 726

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 191 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 250

               
Query: 323 atgc 326
           ||||
Sbjct: 251 atgc 254



to top

>emb|CR614020.1| full-length cDNA clone CS0DB008YN13 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 968

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 288 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 347

               
Query: 323 atgc 326
           ||||
Sbjct: 348 atgc 351



to top

>emb|CR602805.1| full-length cDNA clone CS0DC009YD16 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 285 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 344

               
Query: 323 atgc 326
           ||||
Sbjct: 345 atgc 348



to top

>emb|CR603065.1| full-length cDNA clone CS0DI073YD09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 954

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 258 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 317

               
Query: 323 atgc 326
           ||||
Sbjct: 318 atgc 321



to top

>emb|CR601200.1| full-length cDNA clone CS0DI075YM05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 984

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 286 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 345

               
Query: 323 atgc 326
           ||||
Sbjct: 346 atgc 349



to top

>emb|CR600422.1| full-length cDNA clone CS0DI075YA07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1001

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 305 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 364

               
Query: 323 atgc 326
           ||||
Sbjct: 365 atgc 368



to top

>emb|CR600385.1| full-length cDNA clone CS0DK008YL12 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 957

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 288 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 347

               
Query: 323 atgc 326
           ||||
Sbjct: 348 atgc 351



to top

>emb|CR595573.1| full-length cDNA clone CS0DD004YD15 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 949

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 270 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 329

               
Query: 323 atgc 326
           ||||
Sbjct: 330 atgc 333



to top

>ref|NM_057343.3| Drosophila melanogaster Proteasome 29kD subunit CG9327-RA (Pros29),
           mRNA
          Length = 971

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 122 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 173



to top

>gb|AY084140.1| Drosophila melanogaster RE23862 full insert cDNA
          Length = 988

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 123 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 174



to top

>dbj|AK141380.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430043C19
            product:unclassifiable, full insert sequence
          Length = 4049

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                        
Query: 248  tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
            |||| ||||||||  ||||||||||| |||| |||||||  ||| |||| ||||||||||
Sbjct: 1302 tggagcctagcagcattgagaaaattgtggagattgatgctcatataggttgtgccatga 1243



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 114    cttctccccggaggggcggctgttccaggtcgagta 149
              |||||| || ||||||||||||| ||||||||||||
Sbjct: 539434 cttctcgcccgaggggcggctgtaccaggtcgagta 539469



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 133   ctgttccaggtcgagtacgccatcgaggccatcaag 168
             ||||||||||| ||||||||  | ||||||||||||
Sbjct: 81784 ctgttccaggtggagtacgcgctagaggccatcaag 81819



to top

>gb|BC102343.1| Bos taurus proteasome (prosome, macropain) subunit, alpha type, 5,
           mRNA (cDNA clone MGC:127358 IMAGE:7946974), complete cds
          Length = 992

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 284 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 343

               
Query: 323 atgc 326
           ||||
Sbjct: 344 atgc 347



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                               
Query: 114     cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
               |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 3869188 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 3869235



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                               
Query: 114     cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
               |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 3831132 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 3831179



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                               
Query: 114     cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
               |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 3419617 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 3419664



to top

>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone
             BACR10P11, complete sequence
          Length = 164035

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 114   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
             |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 41009 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 40958



to top

>dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0015E04
          Length = 152046

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                              
Query: 114    cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
              |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 127142 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 127189



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 114   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
             |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 89086 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 89133



to top

>gb|AY891040.1| Synthetic construct Homo sapiens clone FLH007207.01L proteasome
           subunit alpha type 5 (PSMA5) mRNA, partial cds
          Length = 726

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 191 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 250

               
Query: 323 atgc 326
           ||||
Sbjct: 251 atgc 254



to top

>ref|NM_211639.1| Eremothecium gossypii AGL089Wp (AGL089W), mRNA
          Length = 741

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 114 cttctccccggaggggcggctgttccaggtcgagta 149
           |||||| || ||||||||||||| ||||||||||||
Sbjct: 36  cttctcgcccgaggggcggctgtaccaggtcgagta 71



to top

>dbj|AK059984.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-G05, full
           insert sequence
          Length = 1077

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 123 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 170



to top

>gb|BT021033.1| Bos taurus proteasome (prosome, macropain) subunit, alpha type, 5
           (PSMA5), mRNA, complete cds
          Length = 988

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 291 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 350

               
Query: 323 atgc 326
           ||||
Sbjct: 351 atgc 354



to top

>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete
              sequence
          Length = 303438

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 114    cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
              |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 210259 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 210310



to top

>gb|AC005268.1|AC005268 Drosophila melanogaster DNA sequence (P1s DS03550 (D225) and DS02397
             (D206)), complete sequence
          Length = 89791

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 114   cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
             |||||| |||||||| ||  ||| |||||| ||||||||||| |||||||||
Sbjct: 69470 cttctcgccggagggccgtttgtaccaggtggagtacgccatggaggccatc 69419



to top

>gb|AY650295.2| Macaca fascicularis proteasome subunit alpha-type 5 mRNA, partial
           cds
          Length = 631

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
           ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 143 ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 202

               
Query: 323 atgc 326
           ||||
Sbjct: 203 atgc 206



to top

>gb|BC018605.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5,
            mRNA (cDNA clone IMAGE:3925105)
          Length = 1682

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                        
Query: 263  ttgagaaaattatggaaattgatgagcatgtaggctgtgccatgagtggccttattgctg 322
            ||||||||||| | || |||||||  ||  |||| |||||||||||||| || |||||||
Sbjct: 969  ttgagaaaattgtagagattgatgctcacataggttgtgccatgagtgggctaattgctg 1028

                
Query: 323  atgc 326
            ||||
Sbjct: 1029 atgc 1032



to top

>dbj|AB026560.1| Oryza sativa (japonica cultivar-group) OsPAC1 mRNA for alpha 3
           subunit of 20S proteasome, complete cds
          Length = 999

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
           |||||| |||||||||||||| | |||||| |||||||| || |||||
Sbjct: 126 cttctcgccggaggggcggctctaccaggtggagtacgcgatggaggc 173



to top

>gb|BC108368.1| Mus musculus proteasome (prosome, macropain) subunit, alpha type 5,
           mRNA (cDNA clone MGC:118067 IMAGE:3596530), complete cds
          Length = 992

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 257 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 316

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 317 gtgggctaattgctgatgc 335



to top

>gb|BT016493.1| Zea mays clone Contig326 mRNA sequence
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 136 ttccaggtcgagtacgccatcgaggcc 162
           |||||||||||||||||| ||||||||
Sbjct: 107 ttccaggtcgagtacgccctcgaggcc 133



to top

>gb|BC083342.1| Mus musculus proteasome (prosome, macropain) subunit, alpha type 5,
           mRNA (cDNA clone MGC:102091 IMAGE:5700963), complete cds
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 260 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 319

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 320 gtgggctaattgctgatgc 338



to top

>gb|BC010709.1| Mus musculus proteasome (prosome, macropain) subunit, alpha type 5,
           mRNA (cDNA clone MGC:6815 IMAGE:2648635), complete cds
          Length = 988

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 263 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 322

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 323 gtgggctaattgctgatgc 341



to top

>ref|NM_011967.1| Mus musculus proteasome (prosome, macropain) subunit, alpha type 5
           (Psma5), mRNA
          Length = 953

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 242 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 301

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 302 gtgggctaattgctgatgc 320



to top

>ref|XM_001001974.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 5
           (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain),
           transcript variant 2 (LOC671726), mRNA
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 285 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 344

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 345 gtgggctaattgctgatgc 363



to top

>ref|XM_001001965.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 5
           (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain),
           transcript variant 1 (LOC671726), mRNA
          Length = 1018

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 289 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 348

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 349 gtgggctaattgctgatgc 367



to top

>ref|XM_987563.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 5
           (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain)
           (LOC676113), mRNA
          Length = 1006

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 285 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 344

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 345 gtgggctaattgctgatgc 363



to top

>ref|XM_001002751.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 5
           (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain),
           transcript variant 2 (LOC666974), mRNA
          Length = 1006

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 285 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 344

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 345 gtgggctaattgctgatgc 363



to top

>ref|XM_001002745.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 5
           (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain),
           transcript variant 1 (LOC666974), mRNA
          Length = 1010

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 289 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 348

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 349 gtgggctaattgctgatgc 367



to top

>ref|XM_817190.1| Trypanosoma brucei TREU927 proteasome subunit alpha 5
           (Tb10.100.0120) partial mRNA
          Length = 741

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 148 tacgccatcgaggccatcaagttggga 174
           |||||||||||||| ||||||||||||
Sbjct: 76  tacgccatcgaggcaatcaagttggga 102



to top

>emb|AJ293343.1|ZMA293343 Zea mays mRNA for maize 20S proteasome alpha subunit (paa gene)
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgc 152
           ||||||||||||||| || |||| ||| |||||||||||
Sbjct: 126 cttctccccggagggacgcctgtaccaagtcgagtacgc 164



to top

>gb|AC122419.4| Mus musculus BAC clone RP24-163H24 from chromosome 10, complete sequence
          Length = 131907

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                          
Query: 248    tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
              |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 127629 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 127570

                                 
Query: 308    gtggccttattgctgatgc 326
              |||| || |||||||||||
Sbjct: 127569 gtgggctaattgctgatgc 127551



to top

>dbj|AK143468.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN full-length
           enriched library, clone:E860006C15 product:proteasome
           (prosome, macropain) subunit, alpha type 5, full insert
           sequence
          Length = 1219

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 529 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 588

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 589 gtgggctaattgctgatgc 607



to top

>dbj|AK161680.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730524B02 product:proteasome
           (prosome, macropain) subunit, alpha type 5, full insert
           sequence
          Length = 980

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 275 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 334

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 335 gtgggctaattgctgatgc 353



to top

>dbj|AK160741.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3110003E13 product:proteasome (prosome,
           macropain) subunit, alpha type 5, full insert sequence
          Length = 996

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 290 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 349

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 350 gtgggctaattgctgatgc 368



to top

>dbj|AK160550.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410046B16 product:proteasome (prosome, macropain)
           subunit, alpha type 5, full insert sequence
          Length = 986

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 281 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 340

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 341 gtgggctaattgctgatgc 359



to top

>dbj|AK160530.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410002O12 product:proteasome (prosome, macropain)
           subunit, alpha type 5, full insert sequence
          Length = 1006

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 287 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 346

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 347 gtgggctaattgctgatgc 365



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 136      ttccaggtcgagtacgccatcgaggcc 162
                |||||||||||||||||| ||||||||
Sbjct: 20870397 ttccaggtcgagtacgccctcgaggcc 20870423



to top

>dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0229B10
          Length = 114509

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 136   ttccaggtcgagtacgccatcgaggcc 162
             |||||||||||||||||| ||||||||
Sbjct: 62623 ttccaggtcgagtacgccctcgaggcc 62649



to top

>dbj|AP006067.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0569E11
          Length = 157319

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 136    ttccaggtcgagtacgccatcgaggcc 162
              |||||||||||||||||| ||||||||
Sbjct: 145426 ttccaggtcgagtacgccctcgaggcc 145452



to top

>gb|AF140353.1|AF140353 Trypanosoma brucei brucei 20S proteasome alpha 5 subunit (alpha5)
           gene, complete cds
          Length = 741

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 148 tacgccatcgaggccatcaagttggga 174
           |||||||||||||| ||||||||||||
Sbjct: 76  tacgccatcgaggcaatcaagttggga 102



to top

>gb|AY107760.1| Zea mays PCO113667 mRNA sequence
          Length = 1128

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 136 ttccaggtcgagtacgccatcgaggcc 162
           |||||||||||||||||| ||||||||
Sbjct: 138 ttccaggtcgagtacgccctcgaggcc 164



to top

>gb|AY104377.1| Zea mays PCO108605 mRNA sequence
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgc 152
           ||||||||||||||| || |||| ||| |||||||||||
Sbjct: 135 cttctccccggagggacgcctgtaccaagtcgagtacgc 173



to top

>gb|AF019661.1|AF019661 Mus musculus zeta proteasome chain mRNA, complete cds
          Length = 953

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 242 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 301

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 302 gtgggctaattgctgatgc 320



to top

>gb|AC100386.29| Mus musculus chromosome 10, clone RP23-132J19, complete sequence
          Length = 216928

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                          
Query: 248    tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
              |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 185998 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 186057

                                 
Query: 308    gtggccttattgctgatgc 326
              |||| || |||||||||||
Sbjct: 186058 gtgggctaattgctgatgc 186076



to top

>gb|BC007181.1| Mus musculus proteasome (prosome, macropain) subunit, alpha type 5,
           mRNA (cDNA clone IMAGE:3590451)
          Length = 1003

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tggaacctagcagtgttgagaaaattatggaaattgatgagcatgtaggctgtgccatga 307
           |||| ||||||||  ||||||| ||| | || || ||||  ||| |||| ||||||||||
Sbjct: 274 tggagcctagcagcattgagaagattgtagagatcgatgctcatataggttgtgccatga 333

                              
Query: 308 gtggccttattgctgatgc 326
           |||| || |||||||||||
Sbjct: 334 gtgggctaattgctgatgc 352



to top

>dbj|AB032061.1| Oryza sativa (japonica cultivar-group) OsPAD1 mRNA for alpha 4
           subunit of 20S proteasome, complete cds
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 136 ttccaggtcgagtacgccatcgaggcc 162
           |||||||||||||||||| ||||||||
Sbjct: 94  ttccaggtcgagtacgccctcgaggcc 120



to top

>ref|XM_463746.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1434

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 149 acgccatcgaggccatcaagtt 170
           ||||||||||||||||||||||
Sbjct: 41  acgccatcgaggccatcaagtt 62



to top

>ref|XM_860992.1| PREDICTED: Canis familiaris similar to Proteasome subunit alpha
           type 5 (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain),
           transcript variant 2 (LOC490123), mRNA
          Length = 854

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 293 taggctgtgccatgagtggccttattgctgatgc 326
           |||| |||||||||||||| || |||||||||||
Sbjct: 182 taggttgtgccatgagtgggctaattgctgatgc 215



to top

>ref|XM_547244.2| PREDICTED: Canis familiaris similar to Proteasome subunit alpha
           type 5 (Proteasome zeta chain) (Macropain zeta chain)
           (Multicatalytic endopeptidase complex zeta chain),
           transcript variant 1 (LOC490123), mRNA
          Length = 989

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 293 taggctgtgccatgagtggccttattgctgatgc 326
           |||| |||||||||||||| || |||||||||||
Sbjct: 317 taggttgtgccatgagtgggctaattgctgatgc 350



to top

>emb|BX248230.21| Zebrafish DNA sequence from clone CH211-213O11 in linkage group 11,
             complete sequence
          Length = 217432

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 293   taggctgtgccatgagtggccttattgctgatgc 326
             |||||||||||||||||||| | || ||||||||
Sbjct: 80756 taggctgtgccatgagtggcttgatagctgatgc 80789



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 149      acgccatcgaggccatcaagtt 170
                ||||||||||||||||||||||
Sbjct: 41879565 acgccatcgaggccatcaagtt 41879586



to top

>dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1147A04
          Length = 150053

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 149    acgccatcgaggccatcaagtt 170
              ||||||||||||||||||||||
Sbjct: 122941 acgccatcgaggccatcaagtt 122962



to top

>gb|AF210324.1|AF210324 Oryza sativa clone C26554 UMP synthase (UMPS1) mRNA, complete cds
          Length = 1750

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 149 acgccatcgaggccatcaagtt 170
           ||||||||||||||||||||||
Sbjct: 135 acgccatcgaggccatcaagtt 156



to top

>gb|AF210323.1|AF210323 Oryza sativa clone C26785 UMP synthase (UMPS1) mRNA, complete cds
          Length = 1744

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 149 acgccatcgaggccatcaagtt 170
           ||||||||||||||||||||||
Sbjct: 125 acgccatcgaggccatcaagtt 146



to top

>dbj|AK069565.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023023L08, full
           insert sequence
          Length = 2085

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 149 acgccatcgaggccatcaagtt 170
           ||||||||||||||||||||||
Sbjct: 141 acgccatcgaggccatcaagtt 162



to top

>gb|AY462282.1| Sus scrofa proteasome subunit type alpha 5 gene, partial cds
          Length = 1084

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 293 taggctgtgccatgagtggccttattgctgatgc 326
           |||| |||||||||||||| || |||||||||||
Sbjct: 2   taggttgtgccatgagtgggctaattgctgatgc 35



to top

>gb|AC132091.3| Mus musculus BAC clone RP24-465H15 from 18, complete sequence
          Length = 140256

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 437   gctttggagaaggtgaagaaga 458
             ||||||||||||||||||||||
Sbjct: 42056 gctttggagaaggtgaagaaga 42035



to top

>dbj|AB031395.1| Oryza sativa (japonica cultivar-group) mRNA for UMP synthase 1,
           complete cds
          Length = 1743

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 149 acgccatcgaggccatcaagtt 170
           ||||||||||||||||||||||
Sbjct: 125 acgccatcgaggccatcaagtt 146



to top

>gb|AE010335.1| Methanopyrus kandleri AV19 section 34 of 157 of the complete genome
          Length = 12939

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 120  cccggaggggcggctgttccaggtcgagtacgc 152
            |||||| || || ||||||||||||||||||||
Sbjct: 6573 cccggacggtcgactgttccaggtcgagtacgc 6541



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 123     ggaggggcggctgttccaggtcgag 147
               |||||||||||||||| ||||||||
Sbjct: 1659033 ggaggggcggctgttcgaggtcgag 1659009



to top

>ref|XM_462564.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G24882g)
           partial mRNA
          Length = 774

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 157 gaggccatcaagttgggatctactgcaat 185
           ||||||||||| |||||||| ||||||||
Sbjct: 85  gaggccatcaaattgggatccactgcaat 113



to top

>gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, complete sequence
          Length = 236143

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 298   tgtgccatgagtggccttattgctgatgc 326
             |||||||||||||| || |||||||||||
Sbjct: 32907 tgtgccatgagtgggctaattgctgatgc 32935



to top

>ref|XM_804684.1| Trypanosoma cruzi strain CL Brener proteasome alpha 1 subunit
           (Tc00.1047053506167.40) partial mRNA
          Length = 798

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 130 cggctgttccaggtcgagtacgcca 154
           |||||||||||||| ||||||||||
Sbjct: 52  cggctgttccaggtagagtacgcca 76



to top

>ref|XM_797774.1| Trypanosoma cruzi strain CL Brener proteasome alpha 7 subunit
           (Tc00.1047053507785.20) partial mRNA
          Length = 148

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 130 cggctgttccaggtcgagtacgcca 154
           |||||||||||||| ||||||||||
Sbjct: 52  cggctgttccaggtagagtacgcca 76



to top

>ref|XM_674640.1| Plasmodium berghei strain ANKA proteasome subunit alpha type 5,
           (PB000705.00.0) partial mRNA
          Length = 759

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 279 aattgatgagcatgtaggctgtgccatgagtggccttattgctgatgcaagaacatt 335
           ||||||||| ||| |||| ||||| ||||||||  | || || ||||||||||||||
Sbjct: 195 aattgatgaccatataggatgtgcaatgagtgggttaatggcagatgcaagaacatt 251



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 151     gccatcgaggccatcaagttg 171
               |||||||||||||||||||||
Sbjct: 2637618 gccatcgaggccatcaagttg 2637598



to top

>emb|AL390252.9| Human DNA sequence from clone RP11-297O4 on chromosome 1 Contains the
              CELSR2 gene for cadherin, EGF LAG seven-pass G-type
              receptor 2 (flamingo homolog, Drosophila), the gene for
              differential display and activated by p53 (DDA3), the gene
              for novel protein similar to Myosin-binding protein H
              (MyBP-H) (H-protein) (LOC343263), the SORT1 gene for
              sortilin 1 and the 3' end of the PSMA5 gene for proteasome
              (prosome, macropain) subunit, alpha type, 5, complete
              sequence
          Length = 169241

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 298    tgtgccatgagtggccttattgctgatgc 326
              |||||||||||||| || |||||||||||
Sbjct: 166383 tgtgccatgagtgggctaattgctgatgc 166355



to top

>ref|XM_963562.1| PREDICTED: Tribolium castaneum similar to proteasome (prosome,
           macropain) subunit, alpha type 6 (LOC657082), mRNA
          Length = 815

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 115 ttctccccggaggggcggctgttccaggtcgagtacgccatcgaggccatcaa 167
           |||||||| ||||||||||| | ||| |||||||| ||| || | ||||||||
Sbjct: 46  ttctcccccgaggggcggctctaccaagtcgagtatgccttcaaagccatcaa 98



to top

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 157     gaggccatcaagttgggatctactgcaat 185
               ||||||||||| |||||||| ||||||||
Sbjct: 1905258 gaggccatcaaattgggatccactgcaat 1905230



to top

>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29
          Length = 283100

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 138   ccaggtcgagtacgccatcgaggcc 162
             ||||| |||||||||||||||||||
Sbjct: 60977 ccaggccgagtacgccatcgaggcc 60953



to top

>gb|AC183530.3| Pan troglodytes BAC clone CH251-653K11 from chromosome 1, complete
              sequence
          Length = 198127

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 298    tgtgccatgagtggccttattgctgatgc 326
              |||||||||||||| || |||||||||||
Sbjct: 110899 tgtgccatgagtgggctaattgctgatgc 110871



to top

>gb|AC092372.3| Homo sapiens chromosome 5 clone RP11-58M12, complete sequence
          Length = 101220

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 263    ttgagaaaattatggaaattgatga 287
              |||| ||||||||||||||||||||
Sbjct: 100147 ttgaaaaaattatggaaattgatga 100171



to top

>gb|AC022121.6| Homo sapiens chromosome 5 clone CTD-2007H13, complete sequence
          Length = 219258

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 263    ttgagaaaattatggaaattgatga 287
              |||| ||||||||||||||||||||
Sbjct: 162668 ttgaaaaaattatggaaattgatga 162692



to top

>gb|AC012624.6| Homo sapiens chromosome 5 clone CTD-2082I17, complete sequence
          Length = 134365

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 263   ttgagaaaattatggaaattgatga 287
             |||| ||||||||||||||||||||
Sbjct: 45034 ttgaaaaaattatggaaattgatga 45010



to top

>gb|AC026778.4|AC026778 Homo sapiens chromosome 5 clone CTC-428I11, complete sequence
          Length = 195433

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 263    ttgagaaaattatggaaattgatga 287
              |||| ||||||||||||||||||||
Sbjct: 102934 ttgaaaaaattatggaaattgatga 102958



to top

>gb|AY184356.1| Gasterosteus aculeatus proteasome subunit alpha 3 mRNA, partial cds
          Length = 283

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 111 caccttctccccggaggggcggctgttccaggtcgagtacgccat 155
           ||||||||| || || |||||  |||||||||| |||||||||||
Sbjct: 82  caccttctctccagatgggcgcgtgttccaggtggagtacgccat 126



to top

>gb|U75302.1|TCU75302 Trypanosoma cruzi 29 kDa proteasome subunit class II (tcpr29B)
           mRNA, complete cds
          Length = 1155

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 130 cggctgttccaggtcgagtacgcca 154
           |||||||||||||| ||||||||||
Sbjct: 70  cggctgttccaggtagagtacgcca 94



to top

>gb|U73851.1|TCU73851 Trypanosoma cruzi 29 kDa proteasome subunit TCPR29 (tcpr29) mRNA,
           complete cds
          Length = 1199

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 130 cggctgttccaggtcgagtacgcca 154
           |||||||||||||| ||||||||||
Sbjct: 98  cggctgttccaggtagagtacgcca 122



to top

>emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chromosome 3, complete
            sequence
          Length = 132775

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 298  tgtgccatgagtggccttattgctgatgc 326
            |||||||||||||| || |||||||||||
Sbjct: 4546 tgtgccatgagtgggctaattgctgatgc 4574



to top

>emb|AL831710.8| Mouse DNA sequence from clone RP23-29K19 on chromosome 4, complete
             sequence
          Length = 191635

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tgccatgagtggccttattgc 320
             |||||||||||||||||||||
Sbjct: 87074 tgccatgagtggccttattgc 87054



to top

>ref|NM_103010.1| Arabidopsis thaliana electron transporter AT1G32760 mRNA, complete
           cds
          Length = 945

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 ggagaaggtgaagaagagtc 461
           ||||||||||||||||||||
Sbjct: 149 ggagaaggtgaagaagagtc 130



to top

>gb|BT020381.1| Arabidopsis thaliana At1g32760 mRNA, complete cds
          Length = 1082

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 ggagaaggtgaagaagagtc 461
           ||||||||||||||||||||
Sbjct: 189 ggagaaggtgaagaagagtc 170



to top

>gb|AY398400.1| Danio rerio clone RK071A1A07 proteasome subunit, alpha type, 5
           (PSMA5) mRNA, complete cds
          Length = 1104

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 295 ggctgtgccatgagtggccttattgctgatgc 326
           |||||||||||||||||| | || ||||||||
Sbjct: 295 ggctgtgccatgagtggcttgatagctgatgc 326



to top

>ref|NM_185665.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 957

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
           |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 120 cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 167



to top

>gb|BT016358.1| Zea mays clone Contig191 mRNA sequence
          Length = 994

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 114 cttctccccggaggggcggctgttccaggtcgagtacgccatcgaggc 161
           |||||| ||||||||||| || | |||||| |||||||| || |||||
Sbjct: 68  cttctcgccggaggggcgtctctaccaggtggagtacgcgatggaggc 115



to top

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 91     gagtacgaccgcggcgtgaacaccttctcccc 122
              ||||||||||| || || ||||||||||||||
Sbjct: 788558 gagtacgaccggggtgtcaacaccttctcccc 788527



to top

>gb|AY288992.1| Newcastle disease virus chicken/USA(CA)/1083(Fontana)/72 fusion
            protein and hemagglutinin-neuraminidase bicistronic mRNA,
            complete cds
          Length = 3819

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 559  tgcaatgctaaggcaatagg 578
            ||||||||||||||||||||
Sbjct: 3552 tgcaatgctaaggcaatagg 3533



to top

>ref|XM_711383.1| Candida albicans SC5314 putative a-pheromone maturation protease
            (CaO19_7342), mRNA
          Length = 4113

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 268  aaaattatggaaattgatga 287
            ||||||||||||||||||||
Sbjct: 4106 aaaattatggaaattgatga 4087



to top

>gb|AY590469.1| Homo sapiens MCM3 minichromosome maintenance deficient 3 (S.
             cerevisiae) associated protein (MCM3AP) gene, complete cds
          Length = 54127

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 572   caatagggtcaggctctgaa 591
             ||||||||||||||||||||
Sbjct: 39037 caatagggtcaggctctgaa 39056



to top

>gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger protein 7 (zinc7) gene,
             partial cds; and zinc finger protein 8 (zinc8), heavy
             chain clathrin (claH), and alpha6 proteasome subunit
             (pr29A) genes, complete cds
          Length = 14737

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 131   ggctgttccaggtcgagtacgcca 154
             ||||||||||||| ||||||||||
Sbjct: 13636 ggctgttccaggtagagtacgcca 13659



to top

>gb|AC118561.10| Mus musculus chromosome 12, clone RP23-265N17, complete sequence
          Length = 227977

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    agaaaattatggaaattgat 285
              ||||||||||||||||||||
Sbjct: 107057 agaaaattatggaaattgat 107076



to top

>gb|AC147575.1| Homo sapiens chromosome 5 clone RP11-998B18, complete sequence
          Length = 190680

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 602   gttccttacaggagcagtttaacaagga 629
             |||||||| || ||||||||||||||||
Sbjct: 84304 gttccttatagtagcagtttaacaagga 84277



to top

>ref|XM_572324.1| Cryptococcus neoformans var. neoformans JEC21 proteasome subunit
           alpha type 5 (CNH01360) partial mRNA
          Length = 813

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 91  gagtacgaccgcggcgtgaacaccttctcccc 122
           ||||||||||| || || ||||||||||||||
Sbjct: 100 gagtacgaccggggtgtcaacaccttctcccc 131



to top

>ref|XM_447358.1| Candida glabrata CBS138 hypothetical protein (CAGL0I02442g) partial
           mRNA
          Length = 783

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 565 gctaaggcaatagggtcaggctctgaaggtgc 596
           |||||||| |||||||| || |||||||||||
Sbjct: 505 gctaaggccatagggtctggttctgaaggtgc 536



to top

>ref|XM_538679.1| PREDICTED: Canis familiaris similar to Interferon beta precursor
           (IFN-beta) (Fibroblast interferon) (LOC481558), mRNA
          Length = 594

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 497 ctggtcatgatgaaaatggg 516
           ||||||||||||||||||||
Sbjct: 41  ctggtcatgatgaaaatggg 22



to top

>ref|XM_803137.1| Trypanosoma cruzi strain CL Brener proteasome alpha 5 subunit
           (Tc00.1047053511145.43) partial mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 470 gaccttttggagtttctcttcttattgc 497
           |||| ||||| |||||||||||||||||
Sbjct: 404 gaccatttggcgtttctcttcttattgc 431



to top

>gb|AC145146.2| Homo sapiens chromosome 5 clone RP11-241G9, complete sequence
          Length = 177191

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 602   gttccttacaggagcagtttaacaagga 629
             |||||||| || ||||||||||||||||
Sbjct: 28415 gttccttatagtagcagtttaacaagga 28388



to top

>emb|CR727970.2|CNS0GONC Tetraodon nigroviridis full-length cDNA
          Length = 989

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 165 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 212



to top

>emb|CR727498.2|CNS0GOA8 Tetraodon nigroviridis full-length cDNA
          Length = 989

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 165 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 212



to top

>emb|CR727201.2|CNS0GO1Z Tetraodon nigroviridis full-length cDNA
          Length = 973

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 150 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 197



to top

>emb|CR725216.2|CNS0GMIU Tetraodon nigroviridis full-length cDNA
          Length = 959

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 135 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 182



to top

>emb|CR705071.2|CNS0G6ZF Tetraodon nigroviridis full-length cDNA
          Length = 906

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 86  tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 133



to top

>emb|CR704698.2|CNS0G6P2 Tetraodon nigroviridis full-length cDNA
          Length = 993

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 171 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 218



to top

>emb|CR700470.2|CNS0G3FM Tetraodon nigroviridis full-length cDNA
          Length = 970

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 148 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 195



to top

>emb|CR699896.2|CNS0G2ZO Tetraodon nigroviridis full-length cDNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 171 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 218



to top

>emb|CR698069.2|CNS0G1KX Tetraodon nigroviridis full-length cDNA
          Length = 968

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 146 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 193



to top

>emb|CR697897.1|CNS0G1G5 Tetraodon nigroviridis full-length cDNA
          Length = 953

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 134 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 181



to top

>emb|CR694814.2|CNS0FZ2I Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 157 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 204



to top

>emb|CR692623.2|CNS0FXDN Tetraodon nigroviridis full-length cDNA
          Length = 972

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 158 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 205



to top

>emb|CR685960.2|CNS0FS8K Tetraodon nigroviridis full-length cDNA
          Length = 993

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 171 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 218



to top

>emb|CR688259.2|CNS0FU0F Tetraodon nigroviridis full-length cDNA
          Length = 967

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 143 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 190



to top

>emb|CR688135.1|CNS0FTWZ Tetraodon nigroviridis full-length cDNA
          Length = 935

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 126 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 173



to top

>emb|CR681238.2|CNS0FOLE Tetraodon nigroviridis full-length cDNA
          Length = 977

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 152 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 199



to top

>emb|CR679103.2|CNS0FMY3 Tetraodon nigroviridis full-length cDNA
          Length = 1128

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 316 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 363



to top

>emb|CR678237.2|CNS0FMA9 Tetraodon nigroviridis full-length cDNA
          Length = 997

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 170 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 217



to top

>emb|CR677793.2|CNS0FLY1 Tetraodon nigroviridis full-length cDNA
          Length = 926

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 166 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 213



to top

>emb|CR676703.2|CNS0FL3V Tetraodon nigroviridis full-length cDNA
          Length = 973

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 145 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 192



to top

>emb|CR675798.2|CNS0FKF0 Tetraodon nigroviridis full-length cDNA
          Length = 1137

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 315 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 362



to top

>emb|CR673260.2|CNS0FIGI Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 199 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 246



to top

>emb|CR672112.2|CNS0FHKM Tetraodon nigroviridis full-length cDNA
          Length = 982

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 157 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 204



to top

>emb|CR672105.2|CNS0FHKF Tetraodon nigroviridis full-length cDNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 178 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 225



to top

>emb|CR671749.2|CNS0FHAJ Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 167 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 214



to top

>emb|CR671990.2|CNS0FHH8 Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 329 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 376



to top

>emb|CR671579.2|CNS0FH5T Tetraodon nigroviridis full-length cDNA
          Length = 1009

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 188 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 235



to top

>emb|CR670122.2|CNS0FG1C Tetraodon nigroviridis full-length cDNA
          Length = 983

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 161 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 208



to top

>gb|AC142525.2| Homo sapiens chromosome 5 clone RP11-1275J23, complete sequence
          Length = 183459

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 602    gttccttacaggagcagtttaacaagga 629
              |||||||| || ||||||||||||||||
Sbjct: 154604 gttccttatagtagcagtttaacaagga 154577



to top

>emb|CR668423.2|CNS0FEQ5 Tetraodon nigroviridis full-length cDNA
          Length = 994

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 167 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 214



to top

>emb|CR667949.2|CNS0FECZ Tetraodon nigroviridis full-length cDNA
          Length = 986

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 159 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 206



to top

>gb|AC144587.2| Homo sapiens chromosome 5 clone RP11-2H18, complete sequence
          Length = 156757

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 602   gttccttacaggagcagtttaacaagga 629
             |||||||| || ||||||||||||||||
Sbjct: 12040 gttccttatagtagcagtttaacaagga 12013



to top

>emb|CR664328.2|CNS0FBKE Tetraodon nigroviridis full-length cDNA
          Length = 1099

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 277 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 324



to top

>emb|CR661379.2|CNS0F9AH Tetraodon nigroviridis full-length cDNA
          Length = 983

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 170 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 217



to top

>emb|CR658674.1|CNS0F77C Tetraodon nigroviridis full-length cDNA
          Length = 1019

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 238 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 285



to top

>emb|CR646148.2|CNS0EXJE Tetraodon nigroviridis full-length cDNA
          Length = 966

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 118 tccccggaggggcggctgttccaggtcgagtacgccatcgaggccatc 165
           ||||| ||||| |||||||  ||||| ||||||||||| || ||||||
Sbjct: 146 tccccagagggacggctgtatcaggtggagtacgccatggaagccatc 193



to top

>ref|XM_501939.1| Yarrowia lipolytica CLIB122, YALI0C17325g predicted mRNA
          Length = 870

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 136 ttccaggtcgagtacgccatcgaggccatcaa 167
           |||||||| ||||||||| | |||||||||||
Sbjct: 55  ttccaggtggagtacgcccttgaggccatcaa 86



to top

>emb|AL031767.13|HS135L22 Human DNA sequence from clone RP1-135L22 on chromosome 6p22.2-22.3
             Contains part of a novel gene, complete sequence
          Length = 121212

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 280   attgatgagcatgtaggctg 299
             ||||||||||||||||||||
Sbjct: 27860 attgatgagcatgtaggctg 27841



to top

>emb|BX063333.1|CNS09L15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 136 ttccaggtcgagtacgccatcgaggccatcaa 167
           |||||||| ||||| ||||||||||| |||||
Sbjct: 982 ttccaggttgagtatgccatcgaggcgatcaa 951



to top

>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 565    gctaaggcaatagggtcaggctctgaaggtgc 596
              |||||||| |||||||| || |||||||||||
Sbjct: 216398 gctaaggccatagggtctggttctgaaggtgc 216367



to top

>emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 in linkage group 23,
             complete sequence
          Length = 163114

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tgagtggccttattgctgat 324
             ||||||||||||||||||||
Sbjct: 79554 tgagtggccttattgctgat 79535



to top

>gb|AC161369.3| Mus musculus BAC clone RP23-426C11 from chromosome 3, complete sequence
          Length = 202655

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   gagaaaattatggaaattga 284
             ||||||||||||||||||||
Sbjct: 45633 gagaaaattatggaaattga 45652


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,063,195
Number of Sequences: 3902068
Number of extensions: 5063195
Number of successful extensions: 100548
Number of sequences better than 10.0: 276
Number of HSP's better than 10.0 without gapping: 278
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99680
Number of HSP's gapped (non-prelim): 858
length of query: 636
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 613
effective length of database: 17,143,297,704
effective search space: 10508841492552
effective search space used: 10508841492552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top