ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal3o04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470104.1| Oryza sativa (japonica cultivar-group), mRNA 76 1e-10
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 1e-10
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
4gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genom... 76 1e-10
5dbj|AK104998.2| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
6gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence 44 0.39
7gb|AE009642.1| Brucella melitensis 16M chromosome II, section 4 ... 44 0.39
8gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 44 0.39
9emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II... 44 0.39
10emb|AL390375.11| Human DNA sequence from clone RP11-505I19 on ch... 42 1.6
11emb|AL365437.14| Human DNA sequence from clone RP11-343K13 on ch... 42 1.6
12gb|AY973195.1| Anopheles gambiae defensin 2 mRNA, complete cds 42 1.6
13gb|DQ370035.1| Anopheles gambiae defensin mRNA, complete cds 42 1.6
14gb|AC026234.4|F14O10 Sequence of BAC F14O10 from Arabidopsis tha... 42 1.6
15ref|XM_557449.1| Anopheles gambiae str. PEST ENSANGP00000026023 ... 42 1.6
16gb|AE016830.1| Enterococcus faecalis V583, complete genome 42 1.6
17emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on ch... 42 1.6
18ref|XM_363862.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.1
19gb|BC052074.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cD... 40 6.1
20gb|AC133946.3| Mus musculus BAC clone RP24-188D7 from chromosome... 40 6.1
21gb|BC043324.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cD... 40 6.1
22gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Ho... 40 6.1
23emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 o... 40 6.1
24emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 40 6.1
25emb|AL806529.6| Mouse DNA sequence from clone RP23-234M1 on chro... 40 6.1
26dbj|AB091589.1| Crassostrea gigas DNA, microsatellite locus TNFR... 40 6.1
27gb|AC093909.2| Homo sapiens BAC clone RP11-756P10 from 4, comple... 40 6.1
28dbj|AK155870.1| Mus musculus B6-derived CD11 +ve dendritic cells... 40 6.1
29dbj|AK152130.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 6.1
30ref|NM_181397.1| Mus musculus RIKEN cDNA 2310015N21 gene (231001... 40 6.1
31dbj|AK153288.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 6.1
32emb|AL929261.27| Zebrafish DNA sequence from clone CH211-245H5 i... 40 6.1
33dbj|AK088466.1| Mus musculus 2 days neonate thymus thymic cells ... 40 6.1
34dbj|AK087803.1| Mus musculus 2 days pregnant adult female ovary ... 40 6.1
35dbj|AK049045.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 6.1
36dbj|AK082517.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 6.1
37dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 6.1
38dbj|AK172884.1| Mus musculus mRNA for mKIAA0084 protein 40 6.1
39emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chr... 40 6.1
40emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chr... 40 6.1 
>ref|XM_470104.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 6690

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                        
Query: 319  tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 378
            |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 5895 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 5954

                              
Query: 379  gatgcttcatcctaatta 396
            |||||||||||| |||||
Sbjct: 5955 gatgcttcatccaaatta 5972
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                            
Query: 319      tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 378
                |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 33961946 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 33962005

                                  
Query: 379      gatgcttcatcctaatta 396
                |||||||||||| |||||
Sbjct: 33962006 gatgcttcatccaaatta 33962023
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                            
Query: 319      tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 378
                |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 34052418 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 34052477

                                  
Query: 379      gatgcttcatcctaatta 396
                |||||||||||| |||||
Sbjct: 34052478 gatgcttcatccaaatta 34052495
to top
>gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genomic sequence, complete
             sequence
          Length = 172337

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                         
Query: 319   tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 378
             |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 95745 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 95686

                               
Query: 379   gatgcttcatcctaatta 396
             |||||||||||| |||||
Sbjct: 95685 gatgcttcatccaaatta 95668
to top
>dbj|AK104998.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-E05, full
           insert sequence
          Length = 1630

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 319 tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 378
           |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 860 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 919

                             
Query: 379 gatgcttcatcctaatta 396
           |||||||||||| |||||
Sbjct: 920 gatgcttcatccaaatta 937
to top
>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence
          Length = 1207381

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 307   tgatgaccttggtgaaggcggc 328
             ||||||||||||||||||||||
Sbjct: 55272 tgatgaccttggtgaaggcggc 55293
to top
>gb|AE009642.1| Brucella melitensis 16M chromosome II, section 4 of 107 of the
            complete sequence
          Length = 14439

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 307  tgatgaccttggtgaaggcggc 328
            ||||||||||||||||||||||
Sbjct: 5610 tgatgaccttggtgaaggcggc 5589
to top
>gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome II, complete sequence
          Length = 1162204

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 307   tgatgaccttggtgaaggcggc 328
             ||||||||||||||||||||||
Sbjct: 55071 tgatgaccttggtgaaggcggc 55092
to top
>emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II, complete sequence,
             strain 2308
          Length = 1156948

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 307   tgatgaccttggtgaaggcggc 328
             ||||||||||||||||||||||
Sbjct: 55120 tgatgaccttggtgaaggcggc 55141
to top
>emb|AL390375.11| Human DNA sequence from clone RP11-505I19 on chromosome 13, complete
            sequence
          Length = 71118

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 294  taagtaaatatcttgatgaccttgg 318
            |||||||||||||| ||||||||||
Sbjct: 6117 taagtaaatatctttatgaccttgg 6141
to top
>emb|AL365437.14| Human DNA sequence from clone RP11-343K13 on chromosome 6, complete
             sequence
          Length = 39186

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   agcaatataagtaaatatctt 307
             |||||||||||||||||||||
Sbjct: 32857 agcaatataagtaaatatctt 32877
to top
>gb|AY973195.1| Anopheles gambiae defensin 2 mRNA, complete cds
          Length = 292

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 326 ggctatgcacatgccgagcag 346
           |||||||||||||||||||||
Sbjct: 214 ggctatgcacatgccgagcag 234
to top
>gb|DQ370035.1| Anopheles gambiae defensin mRNA, complete cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 326 ggctatgcacatgccgagcag 346
           |||||||||||||||||||||
Sbjct: 218 ggctatgcacatgccgagcag 238
to top
>gb|AC026234.4|F14O10 Sequence of BAC F14O10 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 53889

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    cttcagacacaacagaacata 92
             |||||||||||||||||||||
Sbjct: 33388 cttcagacacaacagaacata 33368
to top
>ref|XM_557449.1| Anopheles gambiae str. PEST ENSANGP00000026023
           (ENSANGG00000022229), partial mRNA
          Length = 165

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 326 ggctatgcacatgccgagcag 346
           |||||||||||||||||||||
Sbjct: 101 ggctatgcacatgccgagcag 121
to top
>gb|AE016830.1| Enterococcus faecalis V583, complete genome
          Length = 3218031

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 426    aacctgaggtcacagattatc 446
              |||||||||||||||||||||
Sbjct: 714619 aacctgaggtcacagattatc 714639
to top
>emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on chromosome 4, complete
              sequence
          Length = 173351

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 216    ctgaagattatcctcatggtg 236
              |||||||||||||||||||||
Sbjct: 158159 ctgaagattatcctcatggtg 158139
to top
>ref|XM_363862.1| Magnaporthe grisea 70-15 hypothetical protein (MG01788.4) partial
           mRNA
          Length = 2715

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 236 gatcataacttggacacaga 255
           ||||||||||||||||||||
Sbjct: 679 gatcataacttggacacaga 698
to top
>gb|BC052074.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cDNA clone MGC:62488
            IMAGE:6401192), complete cds
          Length = 2832

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1725 atgagaagaatctggaagaccagt 1748
to top
>gb|AC133946.3| Mus musculus BAC clone RP24-188D7 from chromosome 17, complete sequence
          Length = 170090

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 30    atgagaagaatctgaaagaccagt 53
             |||||||||||||| |||||||||
Sbjct: 82223 atgagaagaatctggaagaccagt 82246
to top
>gb|BC043324.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cDNA clone
           IMAGE:5371547), partial cds
          Length = 1923

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 30  atgagaagaatctgaaagaccagt 53
           |||||||||||||| |||||||||
Sbjct: 782 atgagaagaatctggaagaccagt 805
to top
>gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 293757

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     gatgagaagaatctgaaaga 48
              ||||||||||||||||||||
Sbjct: 238725 gatgagaagaatctgaaaga 238744
to top
>emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 on chromosome 6q24 Contains the
             3' end of a variant of the EPM2A gene for progressive
             myoclonus type 2 epilepsy (Lafora disease) protein
             (laforin) and a BTB/POZ domain zinc finger protein
             pseudogene, complete sequence
          Length = 115835

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 295   aagtaaatatcttgatgacc 314
             ||||||||||||||||||||
Sbjct: 70178 aagtaaatatcttgatgacc 70159
to top
>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 54      caatcataagtgggttaccttcag 77
               |||| |||||||||||||||||||
Sbjct: 4478234 caataataagtgggttaccttcag 4478211
to top
>emb|AL806529.6| Mouse DNA sequence from clone RP23-234M1 on chromosome 11 Contains the
             3' end of the Nxn gene for nucleoredoxin, complete
             sequence
          Length = 74841

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 64    tgggttaccttcagacacaacaga 87
             |||| |||||||||||||||||||
Sbjct: 37947 tgggataccttcagacacaacaga 37970
to top
>dbj|AB091589.1| Crassostrea gigas DNA, microsatellite locus TNFRI-Crgi46
          Length = 709

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 106 agtgttagaagaaggcaata 125
           ||||||||||||||||||||
Sbjct: 280 agtgttagaagaaggcaata 261
to top
>gb|AC093909.2| Homo sapiens BAC clone RP11-756P10 from 4, complete sequence
          Length = 181886

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     gaagaatctgaaagaccagt 53
              ||||||||||||||||||||
Sbjct: 121586 gaagaatctgaaagaccagt 121605
to top
>dbj|AK155870.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F730311H15
            product:weakly similar to Raftlin [Gallus gallus], full
            insert sequence
          Length = 2813

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1689 atgagaagaatctggaagaccagt 1712
to top
>dbj|AK152130.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830048L08 product:weakly similar to
            Raftlin [Gallus gallus], full insert sequence
          Length = 2771

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1647 atgagaagaatctggaagaccagt 1670
to top
>ref|NM_181397.1| Mus musculus RIKEN cDNA 2310015N21 gene (2310015N21Rik), mRNA
          Length = 2832

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1725 atgagaagaatctggaagaccagt 1748
to top
>dbj|AK153288.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830135C11 product:weakly similar to
            Raftlin [Gallus gallus], full insert sequence
          Length = 2771

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1647 atgagaagaatctggaagaccagt 1670
to top
>emb|AL929261.27| Zebrafish DNA sequence from clone CH211-245H5 in linkage group 24,
             complete sequence
          Length = 193600

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    agttcaaatgcatcagatga 33
             ||||||||||||||||||||
Sbjct: 68962 agttcaaatgcatcagatga 68943
to top
>dbj|AK088466.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430018F20
            product:similar to HYPOTHETICAL 35.0 KDA PROTEIN
            (FRAGMENT) [Homo sapiens], full insert sequence
          Length = 2386

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1262 atgagaagaatctggaagaccagt 1285
to top
>dbj|AK087803.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
            full-length enriched library, clone:E330023B18
            product:hypothetical protein, full insert sequence
          Length = 3626

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1499 atgagaagaatctggaagaccagt 1522
to top
>dbj|AK049045.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230095A10
            product:unclassifiable, full insert sequence
          Length = 1923

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 184  aggccagtcacatactgcagaatcaatg 211
            |||||||||||||| ||| |||||||||
Sbjct: 1282 aggccagtcacatagtgcggaatcaatg 1309
to top
>dbj|AK082517.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230058M18 product:similar to
            HYPOTHETICAL 35.0 KDA PROTEIN (FRAGMENT) [Homo sapiens],
            full insert sequence
          Length = 3349

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1338 atgagaagaatctggaagaccagt 1361
to top
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 304     tcttgatgaccttggtgaag 323
               ||||||||||||||||||||
Sbjct: 2555556 tcttgatgaccttggtgaag 2555537
to top
>dbj|AK172884.1| Mus musculus mRNA for mKIAA0084 protein
          Length = 2779

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   atgagaagaatctgaaagaccagt 53
            |||||||||||||| |||||||||
Sbjct: 1653 atgagaagaatctggaagaccagt 1676
to top
>emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chromosome 2, complete
              sequence
          Length = 105895

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 184    aggccagtcacatactgcagaatcaatg 211
              |||||||||||||| ||| |||||||||
Sbjct: 104108 aggccagtcacatagtgcggaatcaatg 104081
to top
>emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chromosome 2, complete
           sequence
          Length = 204398

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 aggccagtcacatactgcagaatcaatg 211
           |||||||||||||| ||| |||||||||
Sbjct: 213 aggccagtcacatagtgcggaatcaatg 186


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,896,001
Number of Sequences: 3902068
Number of extensions: 3896001
Number of successful extensions: 67496
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67373
Number of HSP's gapped (non-prelim): 123
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top