>gb|BT009512.1| Triticum aestivum clone wr1.pk0094.f2:fis, full insert mRNA
           sequence
          Length = 1061

 Score = 65.9 bits (33), Expect = 9e-09
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 14  tcgccacacacataanccanggntgatttgccagggggcaac 55
           ||||||||||||||| ||| || |||||||||||||||||||
Sbjct: 680 tcgccacacacataagccaaggatgatttgccagggggcaac 639

>gb|AY568306.1| Triticum aestivum CCAAT-box transcription factor complex WHAP12
           (WHAP12) mRNA, complete cds
          Length = 926

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 17  ccacacacataanccanggntgatttgccagggggcaa 54
           |||||||||||| ||| || ||||||||||||||||||
Sbjct: 837 ccacacacataagccaaggatgatttgccagggggcaa 800

>gb|AY568305.1| Triticum aestivum CCAAT-box transcription factor complex WHAP11
           (WHAP11) mRNA, complete cds
          Length = 927

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 17  ccacacacataanccanggntgatttgccagggggcaa 54
           |||||||||||| ||| || ||||||||||||||||||
Sbjct: 838 ccacacacataagccaaggatgatttgccagggggcaa 801

>gb|AY568303.1| Triticum aestivum CCAAT-box transcription factor complex WHAP9
            (WHAP9) mRNA, complete cds
          Length = 1199

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 17   ccacacacataanccanggntgatttgccagggggcaa 54
            |||||||||||| ||| || ||||||||||||||||||
Sbjct: 1110 ccacacacataagccaaggatgatttgccagggggcaa 1073

>gb|AY568302.1| Triticum aestivum CCAAT-box transcription factor complex WHAP8
           (WHAP8) mRNA, complete cds
          Length = 926

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 17  ccacacacataanccanggntgatttgccagggggcaa 54
           |||||||||||| ||| || ||||||||||||||||||
Sbjct: 838 ccacacacataagccaaggatgatttgccagggggcaa 801

>gb|AY568301.1| Triticum aestivum CCAAT-box transcription factor complex WHAP7
           (WHAP7) mRNA, complete cds
          Length = 927

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 17  ccacacacataanccanggntgatttgccagggggcaa 54
           |||||||||||| ||| || ||||||||||||||||||
Sbjct: 838 ccacacacataagccaaggatgatttgccagggggcaa 801

>gb|AY568300.1| Triticum aestivum CCAAT-box transcription factor complex WHAP6
           (WHAP6) mRNA, complete cds
          Length = 927

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 17  ccacacacataanccanggntgatttgccagggggcaa 54
           |||||||||||| ||| || ||||||||||||||||||
Sbjct: 838 ccacacacataagccaaggatgatttgccagggggcaa 801

>gb|AY568304.1| Triticum aestivum CCAAT-box transcription factor complex WHAP10
           (WHAP10) mRNA, complete cds
          Length = 932

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 14  tcgccacacacataanccanggntgatttgccagggg 50
           ||||||||||||||| ||| || ||||||||| ||||
Sbjct: 846 tcgccacacacataagccaaggatgatttgccggggg 810

>gb|AY568299.1| Triticum aestivum CCAAT-box transcription factor complex WHAP5
           (WHAP5) mRNA, complete cds
          Length = 931

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 14  tcgccacacacataanccanggntgatttgccagggg 50
           ||||||||||||||| ||| || ||||||||| ||||
Sbjct: 845 tcgccacacacataagccaaggatgatttgccggggg 809

>gb|AY568298.1| Triticum aestivum CCAAT-box transcription factor complex WHAP4
           (WHAP4) mRNA, complete cds
          Length = 930

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 14  tcgccacacacataanccanggntgatttgccagggg 50
           ||||||||||||||| ||| || ||||||||| ||||
Sbjct: 846 tcgccacacacataagccaaggatgatttgccggggg 810

>gb|AY568295.1| Triticum aestivum CCAAT-box transcription factor complex WHAP1
           (WHAP1) mRNA, complete cds
          Length = 932

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 14  tcgccacacacataanccanggntgatttgccagggg 50
           ||||||||||||||| ||| || ||||||||| ||||
Sbjct: 846 tcgccacacacataagccaaggatgatttgccggggg 810

>gb|AY456087.2| Triticum aestivum CCAAT-box transcription factor complex WHAP2
           (WHAP2) mRNA, complete cds
          Length = 1124

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 14  tcgccacacacataanccanggntgatttgccagggg 50
           ||||||||||||||| ||| || ||||||||| ||||
Sbjct: 846 tcgccacacacataagccaaggatgatttgccggggg 810

>gb|AY568297.1| Triticum aestivum CCAAT-box transcription factor complex WHAP3
           (WHAP3) mRNA, complete cds
          Length = 932

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                          
Query: 14  tcgccacacacataanccanggntgatttgc 44
           ||||||||||||||| ||| || ||||||||
Sbjct: 846 tcgccacacacataagccaaggatgatttgc 816

>gb|AY568307.1| Triticum aestivum CCAAT-box transcription factor complex WHAP13
           (WHAP13) mRNA, complete cds
          Length = 931

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 32/37 (86%)
 Strand = Plus / Minus

                                                
Query: 14  tcgccacacacataanccanggntgatttgccagggg 50
           ||||||||||||||  ||| || ||||||||| ||||
Sbjct: 846 tcgccacacacatacgccaaggatgatttgccggggg 810


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 186,378
Number of Sequences: 3902068
Number of extensions: 186378
Number of successful extensions: 4840
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 4826
Number of HSP's gapped (non-prelim): 14
length of query: 58
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 37
effective length of database: 17,151,101,840
effective search space: 634590768080
effective search space used: 634590768080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)