ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal3f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL353651.11| Human DNA sequence from clone RP4-726F1 on chro... 40 2.3
2emb|BX897734.11| Zebrafish DNA sequence from clone CH211-194J14,... 40 2.3
3ref|NM_117859.2| Arabidopsis thaliana RAB1C; GTP binding AT4G175... 38 9.1
4emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chr... 38 9.1
5emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on ch... 38 9.1
6emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ... 38 9.1
7emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ... 38 9.1
8emb|AJ539160.1|TAE539160 Triticum aestivum sdh2-rps14 gene 38 9.1
9emb|BX640453.23| Zebrafish DNA sequence from clone DKEY-9L5 in l... 38 9.1
10gb|AC073367.11| Homo sapiens chromosome 10 clone RP11-197M22, co... 38 9.1
11gb|AY052204.1| Arabidopsis thaliana AT4g17530/dl4800c mRNA, comp... 38 9.1
12dbj|AK046001.1| Mus musculus adult male corpora quadrigemina cDN... 38 9.1
13emb|BX826393.1|CNS0A420 Arabidopsis thaliana Full-length cDNA Co... 38 9.1
14gb|AF127134.1|AF127134 Arabidopsis thaliana ras-related small GT... 38 9.1
15emb|AL929194.8| Mouse DNA sequence from clone RP23-385L14 on chr... 38 9.1
16emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chr... 38 9.1

>emb|AL353651.11| Human DNA sequence from clone RP4-726F1 on chromosome 1p31.1-31.3
             Contains a novel gene, complete sequence
          Length = 92141

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    attactgaatgacataatat 62
             ||||||||||||||||||||
Sbjct: 58760 attactgaatgacataatat 58779



to top

>emb|BX897734.11| Zebrafish DNA sequence from clone CH211-194J14, complete sequence
          Length = 151729

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   catattcctatttgaatgat 180
             ||||||||||||||||||||
Sbjct: 36518 catattcctatttgaatgat 36499



to top

>ref|NM_117859.2| Arabidopsis thaliana RAB1C; GTP binding AT4G17530 (RAB1C) mRNA,
           complete cds
          Length = 1410

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 49  gaatgacataatatggtta 67
           |||||||||||||||||||
Sbjct: 806 gaatgacataatatggtta 788



to top

>emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chromosome 10 Contains
            the 5' end of the RSU1 gene for Ras suppressor protein 1,
            the 3' end of the CUBN gene for cubilin (intrinsic
            factor-cobalamin receptor) and a CpG island, complete
            sequence
          Length = 184703

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 131  caggttaactattcttcaa 149
            |||||||||||||||||||
Sbjct: 1229 caggttaactattcttcaa 1247



to top

>emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on chromosome 6 Contains an
              IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1)
              pseudogene, an RNA helicase pseudogene and part of a novel
              gene similar to KIAA0161, complete sequence
          Length = 165653

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 159    tgcatattcctatttgaat 177
              |||||||||||||||||||
Sbjct: 111581 tgcatattcctatttgaat 111599



to top

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     gaatgacataatatggtta 67
              |||||||||||||||||||
Sbjct: 138457 gaatgacataatatggtta 138475



to top

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     gaatgacataatatggtta 67
              |||||||||||||||||||
Sbjct: 127822 gaatgacataatatggtta 127840



to top

>emb|AJ539160.1|TAE539160 Triticum aestivum sdh2-rps14 gene
          Length = 3666

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 39   ctcgattactgaatgacat 57
            |||||||||||||||||||
Sbjct: 1245 ctcgattactgaatgacat 1263



to top

>emb|BX640453.23| Zebrafish DNA sequence from clone DKEY-9L5 in linkage group 12, complete
              sequence
          Length = 223071

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 46     actgaatgacataatatgg 64
              |||||||||||||||||||
Sbjct: 190468 actgaatgacataatatgg 190450



to top

>gb|AC073367.11| Homo sapiens chromosome 10 clone RP11-197M22, complete sequence
          Length = 168920

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 131  caggttaactattcttcaa 149
            |||||||||||||||||||
Sbjct: 3430 caggttaactattcttcaa 3412



to top

>gb|AY052204.1| Arabidopsis thaliana AT4g17530/dl4800c mRNA, complete cds
          Length = 938

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 49  gaatgacataatatggtta 67
           |||||||||||||||||||
Sbjct: 806 gaatgacataatatggtta 788



to top

>dbj|AK046001.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230332M13
            product:unclassifiable, full insert sequence
          Length = 2977

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 53   gacataatatggttatgat 71
            |||||||||||||||||||
Sbjct: 1094 gacataatatggttatgat 1076



to top

>emb|BX826393.1|CNS0A420 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB20ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 301

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 49  gaatgacataatatggtta 67
           |||||||||||||||||||
Sbjct: 164 gaatgacataatatggtta 146



to top

>gb|AF127134.1|AF127134 Arabidopsis thaliana ras-related small GTP-binding protein (RAB1c)
           mRNA, complete cds
          Length = 950

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 49  gaatgacataatatggtta 67
           |||||||||||||||||||
Sbjct: 798 gaatgacataatatggtta 780



to top

>emb|AL929194.8| Mouse DNA sequence from clone RP23-385L14 on chromosome 2, complete
             sequence
          Length = 120827

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    ataatatggttatgatgtg 74
             |||||||||||||||||||
Sbjct: 99968 ataatatggttatgatgtg 99986



to top

>emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chromosome 2, complete
              sequence
          Length = 204398

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     gacataatatggttatgat 71
              |||||||||||||||||||
Sbjct: 144827 gacataatatggttatgat 144845


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,219,189
Number of Sequences: 3902068
Number of extensions: 1219189
Number of successful extensions: 82871
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82847
Number of HSP's gapped (non-prelim): 24
length of query: 185
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 163
effective length of database: 17,147,199,772
effective search space: 2794993562836
effective search space used: 2794993562836
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top