ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal2p01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016365.1| Zea mays clone Contig198 mRNA sequence 40 0.35
2gb|BT018641.1| Zea mays clone EL01N0504H01.d mRNA sequence 40 0.35
3gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence 40 0.35
4gb|BT017226.1| Zea mays clone EL01N0302D08.c mRNA sequence 40 0.35
5gb|BT016821.1| Zea mays clone Contig654 mRNA sequence 40 0.35
6gb|BT014922.1| Drosophila melanogaster AT26578 full insert cDNA 40 0.35
7gb|BC021030.1| Homo sapiens hexosaminidase A (alpha polypeptide)... 40 0.35
8gb|BC005824.1| Homo sapiens cDNA clone IMAGE:2823381, **** WARNI... 40 0.35
9gb|BC015683.1| Homo sapiens eukaryotic translation elongation fa... 40 0.35
10gb|AY223337.1| Schistosoma japonicum clone ZZD819 mRNA sequence 40 0.35
11gb|BC071955.1| Homo sapiens cDNA clone IMAGE:6574557, **** WARNI... 40 0.35
12gb|BC011866.1| Homo sapiens cDNA clone IMAGE:4542413, **** WARNI... 40 0.35
13gb|BC019044.1| Homo sapiens cDNA clone IMAGE:4635339, **** WARNI... 40 0.35
14gb|BC045109.1| Homo sapiens mRNA similar to hypothetical protein... 40 0.35
15gb|BC012763.1| Homo sapiens cDNA clone IMAGE:3659204, **** WARNI... 40 0.35
16gb|AY092059.1| Homo sapiens breast cancer antigen 10828 mRNA, pa... 40 0.35
17gb|AY967583.1| Schmidtea mediterranea clone NBE.3.01F mRNA sequence 40 0.35
18gb|BT003650.1| Drosophila melanogaster AT09752 full insert cDNA 40 0.35
19gb|BT003321.1| Drosophila melanogaster AT12755 full insert cDNA 40 0.35
20gb|BC002350.1| Homo sapiens cDNA clone IMAGE:2820510 40 0.35
21gb|AY068599.1| Schmidtea mediterranea clone H.7.5b(T3) unknown m... 40 0.35
22gb|BT016530.1| Zea mays clone Contig363 mRNA sequence 38 1.4
23gb|BT018878.1| Zea mays clone EL01T0203B12.d mRNA sequence 38 1.4
24gb|BC032098.1| Homo sapiens G protein-coupled receptor kinase in... 38 1.4
25gb|BC030150.1| Homo sapiens mRNA similar to hypothetical protein... 38 1.4
26dbj|AB236793.1| Trifolium pratense RNA for putative zinc depende... 38 1.4
27gb|AC130542.4| Mus musculus chromosome 6 clone RP24-167F4, compl... 36 5.5
28gb|BT018599.1| Zea mays clone EL01N0449A02.d mRNA sequence 36 5.5
29gb|AC105164.12| Mus musculus chromosome 6, clone RP24-296I7, com... 36 5.5
30emb|CR386207.1| Gallus gallus finished cDNA, clone ChEST252j10 36 5.5
31gb|AC158681.3| Mus musculus 6 BAC RP23-338E5 (Roswell Park Cance... 36 5.5
32gb|AC145926.4| Gallus gallus BAC clone CH261-29I12 from chromoso... 36 5.5

>gb|BT016365.1| Zea mays clone Contig198 mRNA sequence
          Length = 628

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 1  gcacgagggagagaactag-tctcgagt 27



to top

>gb|BT018641.1| Zea mays clone EL01N0504H01.d mRNA sequence
          Length = 1720

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 5  gcacgagggagagaactag-tctcgagt 31



to top

>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 1  gcacgagggagagaactag-tctcgagt 27



to top

>gb|BT017226.1| Zea mays clone EL01N0302D08.c mRNA sequence
          Length = 313

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 1  gcacgagggagagaactag-tctcgagt 27



to top

>gb|BT016821.1| Zea mays clone Contig654 mRNA sequence
          Length = 1819

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 1  gcacgagggagagaactag-tctcgagt 27



to top

>gb|BT014922.1| Drosophila melanogaster AT26578 full insert cDNA
          Length = 2213

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 1   gcacgagggagagaactagctctcgagt 28
           ||||||||||||||||||| ||||||||
Sbjct: 861 gcacgagggagagaactag-tctcgagt 835



to top

>gb|BC021030.1| Homo sapiens hexosaminidase A (alpha polypeptide), mRNA (cDNA clone
            IMAGE:3626334), partial cds
          Length = 1186

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 1    gcacgagggagagaactagctctcgagt 28
            ||||||||||||||||||| ||||||||
Sbjct: 1185 gcacgagggagagaactag-tctcgagt 1159



to top

>gb|BC005824.1| Homo sapiens cDNA clone IMAGE:2823381, **** WARNING: chimeric clone
           ****
          Length = 3287

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 1   gcacgagggagagaactagctctcgagt 28
           ||||||||||||||||||| ||||||||
Sbjct: 985 gcacgagggagagaactag-tctcgagt 959



to top

>gb|BC015683.1| Homo sapiens eukaryotic translation elongation factor 1 gamma,
          mRNA (cDNA clone IMAGE:4651027), **** WARNING: chimeric
          clone ****
          Length = 2823

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 2  gcacgagggagagaactag-tctcgagt 28



to top

>gb|AY223337.1| Schistosoma japonicum clone ZZD819 mRNA sequence
          Length = 1412

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 1   gcacgagggagagaactagctctcgagt 28
           ||||||||||||||||||| ||||||||
Sbjct: 885 gcacgagggagagaactag-tctcgagt 859



to top

>gb|BC071955.1| Homo sapiens cDNA clone IMAGE:6574557, **** WARNING: chimeric clone
           ****
          Length = 2382

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 1   gcacgagggagagaactagctctcgagt 28
           ||||||||||||||||||| ||||||||
Sbjct: 371 gcacgagggagagaactag-tctcgagt 345



to top

>gb|BC011866.1| Homo sapiens cDNA clone IMAGE:4542413, **** WARNING: chimeric
          clone ****
          Length = 2480

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 2  gcacgagggagagaactag-tctcgagt 28



to top

>gb|BC019044.1| Homo sapiens cDNA clone IMAGE:4635339, **** WARNING: chimeric
          clone ****
          Length = 2503

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 2  gcacgagggagagaactag-tctcgagt 28



to top

>gb|BC045109.1| Homo sapiens mRNA similar to hypothetical protein FLJ20643 (cDNA
            clone IMAGE:5479484)
          Length = 3815

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 1    gcacgagggagagaactagctctcgagt 28
            ||||||||||||||||||| ||||||||
Sbjct: 2629 gcacgagggagagaactag-tctcgagt 2603



to top

>gb|BC012763.1| Homo sapiens cDNA clone IMAGE:3659204, **** WARNING: chimeric
          clone ****
          Length = 1995

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 2  gcacgagggagagaactag-tctcgagt 28



to top

>gb|AY092059.1| Homo sapiens breast cancer antigen 10828 mRNA, partial sequence
          Length = 930

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 2  gcacgagggagagaactag-tctcgagt 28



to top

>gb|AY967583.1| Schmidtea mediterranea clone NBE.3.01F mRNA sequence
          Length = 317

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 1   gcacgagggagagaactagctctcgagt 28
           ||||||||||||||||||| ||||||||
Sbjct: 317 gcacgagggagagaactag-tctcgagt 291



to top

>gb|BT003650.1| Drosophila melanogaster AT09752 full insert cDNA
          Length = 3551

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 1    gcacgagggagagaactagctctcgagt 28
            ||||||||||||||||||| ||||||||
Sbjct: 1512 gcacgagggagagaactag-tctcgagt 1486



to top

>gb|BT003321.1| Drosophila melanogaster AT12755 full insert cDNA
          Length = 3778

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 1    gcacgagggagagaactagctctcgagt 28
            ||||||||||||||||||| ||||||||
Sbjct: 1273 gcacgagggagagaactag-tctcgagt 1247



to top

>gb|BC002350.1| Homo sapiens cDNA clone IMAGE:2820510
          Length = 2920

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 2  gcacgagggagagaactag-tctcgagt 28



to top

>gb|AY068599.1| Schmidtea mediterranea clone H.7.5b(T3) unknown mRNA sequence
          Length = 941

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                      
Query: 1  gcacgagggagagaactagctctcgagt 28
          ||||||||||||||||||| ||||||||
Sbjct: 1  gcacgagggagagaactag-tctcgagt 27



to top

>gb|BT016530.1| Zea mays clone Contig363 mRNA sequence
          Length = 1677

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 1  gcacgagggagagaactag 19
          |||||||||||||||||||
Sbjct: 13 gcacgagggagagaactag 31



to top

>gb|BT018878.1| Zea mays clone EL01T0203B12.d mRNA sequence
          Length = 1378

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 1  gcacgagggagagaactag 19
          |||||||||||||||||||
Sbjct: 1  gcacgagggagagaactag 19



to top

>gb|BC032098.1| Homo sapiens G protein-coupled receptor kinase interactor 1, mRNA
          (cDNA clone IMAGE:4545101), partial cds
          Length = 1711

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 1  gcacgagggagagaactag 19
          |||||||||||||||||||
Sbjct: 2  gcacgagggagagaactag 20



to top

>gb|BC030150.1| Homo sapiens mRNA similar to hypothetical protein MGC28083 (cDNA
          clone IMAGE:4841613)
          Length = 4200

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 1  gcacgagggagagaactag 19
          |||||||||||||||||||
Sbjct: 2  gcacgagggagagaactag 20



to top

>dbj|AB236793.1| Trifolium pratense RNA for putative zinc dependent protease, complete
            cds, clone: C1867
          Length = 2414

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1    gcacgagggagagaactag 19
            |||||||||||||||||||
Sbjct: 2344 gcacgagggagagaactag 2326



to top

>gb|AC130542.4| Mus musculus chromosome 6 clone RP24-167F4, complete sequence
          Length = 192106

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      gagggagagaactagctc 22
              ||||||||||||||||||
Sbjct: 144725 gagggagagaactagctc 144742



to top

>gb|BT018599.1| Zea mays clone EL01N0449A02.d mRNA sequence
          Length = 1762

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                
Query: 1  gcacgagggagagaactagctc 22
          |||||||||||||| |||||||
Sbjct: 5  gcacgagggagagagctagctc 26



to top

>gb|AC105164.12| Mus musculus chromosome 6, clone RP24-296I7, complete sequence
          Length = 178877

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 5     gagggagagaactagctc 22
             ||||||||||||||||||
Sbjct: 70064 gagggagagaactagctc 70081



to top

>emb|CR386207.1| Gallus gallus finished cDNA, clone ChEST252j10
          Length = 1489

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 5   gagggagagaactagctc 22
           ||||||||||||||||||
Sbjct: 752 gagggagagaactagctc 735



to top

>gb|AC158681.3| Mus musculus 6 BAC RP23-338E5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 202460

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 5      gagggagagaactagctc 22
              ||||||||||||||||||
Sbjct: 120025 gagggagagaactagctc 120008



to top

>gb|AC145926.4| Gallus gallus BAC clone CH261-29I12 from chromosome unknown, complete
              sequence
          Length = 224974

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      gagggagagaactagctc 22
              ||||||||||||||||||
Sbjct: 113195 gagggagagaactagctc 113212


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 145,486
Number of Sequences: 3902068
Number of extensions: 145486
Number of successful extensions: 26667
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26633
Number of HSP's gapped (non-prelim): 34
length of query: 45
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 25
effective length of database: 17,155,003,908
effective search space: 428875097700
effective search space used: 428875097700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top