ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal3e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK064782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 539 e-150
2ref|XM_463609.1| Oryza sativa (japonica cultivar-group), predic... 535 e-149
3gb|AY466159.1| Zea mays DEAD box RNA helicase (DRH1) mRNA, compl... 484 e-133
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
5dbj|AP003416.4| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
6dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
7ref|NM_125706.2| Arabidopsis thaliana ATP binding / ATP-dependen... 103 7e-19
8ref|NM_203256.1| Arabidopsis thaliana ATP binding / ATP-dependen... 103 7e-19
9gb|BT000610.1| Arabidopsis thaliana AtP-dependent RNA helicase-l... 103 7e-19
10gb|AY060589.1| Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, comp... 103 7e-19
11emb|BX832051.1|CNS09YVO Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
12dbj|AB008265.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 92 3e-15
13gb|BT012961.1| Lycopersicon esculentum clone 114151R, mRNA sequence 78 4e-11
14ref|NM_104388.2| Arabidopsis thaliana ATP binding / ATP-dependen... 72 2e-09
15gb|AY128786.1| Arabidopsis thaliana unknown protein (At1g55150) ... 72 2e-09
16gb|AY062745.1| Arabidopsis thaliana Unknown protein (At1g55150; ... 72 2e-09
17emb|BX813460.1|CNS0AC9L Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
18gb|AC073944.6|AC073944 Arabidopsis thaliana chromosome 1 BAC T7N... 72 2e-09
19dbj|AK068197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
20gb|AF479823.1| Pantodon buchholzi DEAD box RNA helicase Vasa mRN... 68 4e-08
21gb|AF096248.1|AF096248 Lycopersicon esculentum ethylene-responsi... 68 4e-08
22ref|NM_004396.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypep... 66 2e-07
23ref|NM_188251.1| Oryza sativa (japonica cultivar-group), predic... 66 2e-07
24ref|XM_512004.1| PREDICTED: Pan troglodytes DEAD (Asp-Glu-Ala-As... 66 2e-07
25gb|BC016027.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti... 66 2e-07
26ref|XM_448941.1| Candida glabrata CBS138, CAGL0L03846 partial mRNA 66 2e-07
27ref|XM_855709.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
28ref|XM_855680.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
29ref|XM_855640.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
30ref|XM_845027.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
31ref|XM_855575.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
32ref|XM_531736.2| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
33ref|XM_855514.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
34ref|XM_855481.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
35ref|XM_855444.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
36ref|XM_855416.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
37ref|XM_855385.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
38ref|XM_855349.1| PREDICTED: Canis familiaris similar to Probable... 66 2e-07
39emb|X52104.1|HSP68A Human mRNA for p68 protein 66 2e-07
40emb|X15729.1|HSNP68M Human mRNA for nuclear p68 protein 66 2e-07
41emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 66 2e-07
42emb|BX571764.1|HSM806634 Homo sapiens mRNA; cDNA DKFZp686J01190 ... 66 2e-07
43gb|BT007642.1| Synthetic construct Homo sapiens DEAD/H (Asp-Glu-... 66 2e-07
44gb|BT006943.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 66 2e-07
45emb|CR607012.1| full-length cDNA clone CS0DA009YD21 of Neuroblas... 66 2e-07
46gb|AC138744.4| Homo sapiens chromosome 17, clone RP11-859E19, co... 66 2e-07
47dbj|AP003244.3| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-07
48gb|AY892740.1| Synthetic construct Homo sapiens clone FLH024742.... 66 2e-07
49gb|AY890256.1| Synthetic construct Homo sapiens clone FLH024746.... 66 2e-07
50gb|AY890255.1| Synthetic construct Homo sapiens clone FLH024745.... 66 2e-07
51gb|AF015812.1|AF015812 Homo sapiens RNA helicase p68 (HUMP68) ge... 66 2e-07
52dbj|AB209919.1| Homo sapiens mRNA for Hypothetical protein DKFZp... 66 2e-07
53gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, com... 66 2e-07
54emb|AJ010476.1|ATH010476 Arabidopsis thaliana mRNA for DEAD box ... 64 6e-07
55gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome... 64 6e-07
56dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
57gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 64 6e-07
58emb|X52648.1|SPP68 Schizosaccharomyces pombe p68 gene for p68 pr... 62 2e-06
59emb|AL032684.1|SPBP8B7 S.pombe chromosome II p1 p8B7 62 2e-06
60ref|NM_001022444.1| Schizosaccharomyces pombe 972h- hypothetical... 62 2e-06
61gb|L11574.1|YSPP68DBP Schizosaccharomyces pombe p68 RNA helicase... 62 2e-06
62emb|CR861259.1| Pongo pygmaeus mRNA; cDNA DKFZp459M043 (from clo... 58 4e-05
63ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 1e-04
64ref|XM_950413.1| Theileria annulata strain Ankara DEAD-box RNA h... 56 1e-04
65ref|XM_502093.1| Yarrowia lipolytica CLIB122, YALI0C21472g predi... 56 1e-04
66gb|AY786204.1| Monopterus albus DEAD box RNA helicase-PL10B mRNA... 56 1e-04
67emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 56 1e-04
68gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 56 1e-04
69ref|NM_111523.2| Arabidopsis thaliana ATP binding / ATP-dependen... 54 6e-04
70gb|BT016697.1| Zea mays clone Contig530 mRNA sequence 54 6e-04
71gb|AY587260.1| Sparus aurata vasa-like protein mRNA, partial cds 54 6e-04
72gb|AF520608.1| Sparus aurata vasa-like mRNA, partial cds 54 6e-04
73gb|AC011623.5|ATAC011623 Arabidopsis thaliana chromosome III BAC... 54 6e-04
74ref|XM_504478.1| Yarrowia lipolytica CLIB122, YALI0E27715g predi... 54 6e-04
75ref|XM_967408.1| PREDICTED: Tribolium castaneum similar to DEAD ... 54 6e-04
76emb|X57328.1|XLRNAHE X.laevis mRNA for an ATP dependent RNA heli... 54 6e-04
77gb|DQ399799.1| Acanthopagrus schlegelii vasa protein mRNA, parti... 54 6e-04
78dbj|AP003200.4| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
79gb|BC094097.1| Xenopus laevis cDNA clone MGC:115016 IMAGE:664359... 54 6e-04
80emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 54 6e-04
81dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone... 54 6e-04
82ref|XR_002773.1| PREDICTED: Mus musculus hypothetical protein LO... 52 0.002
83ref|XM_750315.1| Aspergillus fumigatus Af293 RNA helicase Dbp (A... 52 0.002
84emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chro... 52 0.002
85ref|NM_204708.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polype... 52 0.002
86gb|AF188678.1|AF188678 Pisum sativum P72 DEAD box protein mRNA, ... 52 0.002
87emb|AJ010936.1|HSA010936 Homo sapiens ddx5-ps1 gene, partial 52 0.002
88dbj|AB004836.1| Gallus gallus mRNA for Cvh, complete cds 52 0.002
89ref|NM_202477.1| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) tran... 50 0.009
90ref|NM_111020.2| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) tran... 50 0.009
91ref|NM_180161.1| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) tran... 50 0.009
92ref|NM_001035542.1| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) t... 50 0.009
93emb|CR954247.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 50 0.009
94gb|AC009325.8|ATAC009325 Arabidopsis thaliana chromosome III BAC... 50 0.009
95gb|BT000795.1| Arabidopsis thaliana putative RNA helicase, DRH1 ... 50 0.009
96gb|BT009670.1| Arabidopsis thaliana At3g01540 gene, complete cds 50 0.009
97gb|AF462866.1|AF462866 Arabidopsis thaliana AT3g01540/F4P13_9 mR... 50 0.009
98gb|AY062591.1| Arabidopsis thaliana RNA helicase, DRH1 (At3g0154... 50 0.009
99gb|AF428313.1|AF428313 Arabidopsis thaliana AT3g01540/F4P13_9 mR... 50 0.009
100gb|AY050375.1| Arabidopsis thaliana AT3g01540/F4P13_9 mRNA, comp... 50 0.009
101gb|AY730697.1| Nematostella vectensis DEAD box helicase Vasa2 (V... 50 0.009
102emb|BX823517.1|CNS0A7FC Arabidopsis thaliana Full-length cDNA Co... 50 0.009
103gb|AY110750.1| Zea mays CL9052_1 mRNA sequence 50 0.009
104dbj|AB010259.1| Arabidopsis thaliana mRNA for DRH1, complete cds 50 0.009
105ref|NM_121465.3| Arabidopsis thaliana ATP binding / ATP-dependen... 48 0.036
106ref|XM_550287.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.036
107ref|XM_550286.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.036
108gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 48 0.036
109gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete... 48 0.036
110ref|XM_426195.1| PREDICTED: Gallus gallus similar to DEAD (Asp-G... 48 0.036
111gb|BT012899.1| Lycopersicon esculentum clone 114007F, mRNA sequence 48 0.036
112ref|XM_757861.1| Theileria parva strain Muguga chromosome 3 ATP-... 48 0.036
113gb|AC144760.27| Medicago truncatula clone mth2-8p15, complete se... 48 0.036
114emb|AL163792.1|ATT15N1 Arabidopsis thaliana DNA chromosome 5, BA... 48 0.036
115gb|AC181983.2| Gallus gallus BAC clone CH261-63A17 from chromoso... 48 0.036
116ref|NM_165103.2| Drosophila melanogaster vasa CG3506-RA (vas), mRNA 48 0.036
117gb|AY084126.1| Drosophila melanogaster RE20606 full insert cDNA 48 0.036
118gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35... 48 0.036
119gb|AE009543.1| Brucella melitensis 16M chromosome I, section 100... 48 0.036
120dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.036
121gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 48 0.036
122ref|XM_320481.2| Anopheles gambiae str. PEST ENSANGP00000015773 ... 48 0.036
123dbj|AK100326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.036
124gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55... 48 0.036
125emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 48 0.036
126emb|X12946.1|DMVASA2 D.melanogaster vasa gene (exons 3 to 7) 48 0.036
127gb|M23560.1|DROVASA D.melanogaster antigen Mab46F11 (vasa) mRNA,... 48 0.036
128gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 46 0.14
129gb|BC063223.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box pol... 46 0.14
130gb|BT013678.1| Lycopersicon esculentum clone 132500R, mRNA sequence 46 0.14
131ref|XM_856506.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
132ref|XM_856475.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
133ref|XM_856444.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
134ref|XM_856419.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
135ref|XM_856382.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
136ref|XM_856356.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
137ref|XM_856327.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
138ref|XM_538003.2| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
139ref|XM_856286.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
140ref|XM_845289.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
141ref|XM_856207.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
142ref|XM_856175.1| PREDICTED: Canis familiaris similar to DEAD-box... 46 0.14
143ref|XM_569125.1| Cryptococcus neoformans var. neoformans JEC21 p... 46 0.14
144emb|CR628336.1| Legionella pneumophila str. Paris complete genome 46 0.14
145emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 46 0.14
146ref|NM_203898.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box p... 46 0.14
147gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.14
148dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 46 0.14
149dbj|AB169223.1| Macaca fascicularis testis cDNA, clone: QtsA-181... 46 0.14
150dbj|AB169157.1| Macaca fascicularis testis cDNA, clone: QtsA-176... 46 0.14
151dbj|AB080116.1| Mesocricetus auratus DBX mRNA for RNA helicase, ... 46 0.14
152gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 46 0.14
153emb|CR848548.2| Xenopus tropicalis finished cDNA, clone TEgg028e13 46 0.14
154gb|BC086320.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.56
155ref|NM_001016781.2| Xenopus tropicalis hypothetical protein LOC5... 44 0.56
156gb|BC084159.1| Xenopus tropicalis cDNA clone IMAGE:7016603 44 0.56
157gb|BC080992.1| Xenopus laevis hypothetical protein LOC398649, mR... 44 0.56
158gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 44 0.56
159ref|NM_007840.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep... 44 0.56
160gb|BC054236.1| Xenopus laevis hypothetical protein LOC398649, mR... 44 0.56
161gb|BC062916.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.56
162ref|XM_806839.1| Trypanosoma cruzi strain CL Brener ATP-dependen... 44 0.56
163ref|XM_946895.1| Theileria annulata strain Ankara ATP-dependent ... 44 0.56
164gb|AC136842.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.56
165emb|X65627.1|MMHELI M.musculus mRNA TNZ2 for p68 RNA helicase 44 0.56
166dbj|AK129022.1| Mus musculus cDNA fis, clone TRACH3036683, highl... 44 0.56
167gb|AF479821.1| Hyphessobrycon ecuadoriensis DEAD box RNA helicas... 44 0.56
168dbj|AK132779.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.56
169dbj|AK135173.1| Mus musculus 12 days embryo female ovary cDNA, R... 44 0.56
170dbj|AK166698.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 44 0.56
171dbj|AK166045.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 44 0.56
172gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.56
173dbj|AK088887.1| Mus musculus 2 days neonate thymus thymic cells ... 44 0.56
174gb|DQ336393.1| Elephas maximus DEAD/H box polypeptide (DBY) gene... 44 0.56
175dbj|AK044792.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 44 0.56
176dbj|AK076018.1| Mus musculus 10 days embryo whole body cDNA, RIK... 44 0.56
177ref|XM_392069.2| PREDICTED: Apis mellifera similar to ENSANGP000... 44 0.56
178ref|NM_001007613.1| Rattus norvegicus ddx5 gene (Ddx5), mRNA 44 0.56
179gb|BC079036.1| Rattus norvegicus ddx5 gene, mRNA (cDNA clone MGC... 44 0.56
180emb|AJ010940.1|RNO010940 Rattus norvegicus ddx5-ps1 pseudogene, ... 44 0.56
181emb|CR855694.2| Xenopus tropicalis finished cDNA, clone TGas068f07 44 0.56
182gb|BC046554.1| Mus musculus cDNA clone IMAGE:4973650 44 0.56
183gb|BC108369.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.56
184ref|NM_202726.1| Arabidopsis thaliana ATP binding / ATP-dependen... 42 2.2
185ref|NM_001035807.1| Arabidopsis thaliana ATP binding / ATP-depen... 42 2.2
186ref|NM_115713.2| Arabidopsis thaliana ATP binding / ATP-dependen... 42 2.2
187gb|AC149403.2| Phakopsora pachyrhizi clone JGIAFNA-61H19, comple... 42 2.2
188gb|AY391418.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid... 42 2.2
189ref|XM_633858.1| Dictyostelium discoideum hypothetical protein (... 42 2.2
190gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 42 2.2
191ref|XM_629763.1| Dictyostelium discoideum hypothetical protein (... 42 2.2
192ref|NM_004660.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypep... 42 2.2
193ref|NM_212612.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypept... 42 2.2
194gb|BC082849.1| Xenopus laevis p68 RNA helicase, mRNA (cDNA clone... 42 2.2
195gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 sect... 42 2.2
196ref|XM_361961.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 2.2
197gb|DQ441593.1| Odontesthes hatcheri vasa-like protein mRNA, part... 42 2.2
198gb|AY633112.1| Pan troglodytes DDX3Y mRNA, complete cds 42 2.2
199gb|AE009952.1| Yersinia pestis KIM, complete genome 42 2.2
200ref|XM_456137.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F23716g ... 42 2.2
201gb|BC067585.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid... 42 2.2
202gb|AC165060.2| Phakopsora pachyrhizi clone JGIAFNA-205B5, comple... 42 2.2
203ref|XM_981517.1| PREDICTED: Mus musculus DEAD/H (Asp-Glu-Ala-Asp... 42 2.2
204gb|BC085914.1| Rattus norvegicus DEAD/H (Asp-Glu-Ala-Asp/His) bo... 42 2.2
205gb|AF025536.1| Schizosaccharomyces pombe suppressor of uncontrol... 42 2.2
206gb|BC047981.1| Xenopus laevis similar to DEAD/H (Asp-Glu-Ala-Asp... 42 2.2
207gb|AC146254.2| Pan troglodytes BAC clone CH251-128L22 from Y, co... 42 2.2
208ref|XM_719206.1| Plasmodium yoelii yoelii str. 17XNL U5 snRNP 10... 42 2.2
209gb|AC146760.13| Medicago truncatula clone mth2-174d3, complete s... 42 2.2
210gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 42 2.2
211emb|Z71388.1|SCYNL112W S.cerevisiae chromosome XIV reading frame... 42 2.2
212emb|Z69382.1|SCCXIV38K S.cerevisiae 37,800 bp segment of chromos... 42 2.2
213emb|Z38117.1|MMDBRNAHL M.musculus mRNA for dead-box RNA helicase 42 2.2
214emb|X52649.1|SCP68 S.cerevisiae p68 gene 42 2.2
215emb|CR628337.1| Legionella pneumophila str. Lens complete genome 42 2.2
216emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 42 2.2
217emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 42 2.2
218emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 42 2.2
219emb|AL137082.1|ATF14P22 Arabidopsis thaliana DNA chromosome 3, B... 42 2.2
220emb|AL022598.2|SPCC1795 S.pombe chromosome III cosmid c1795 42 2.2
221emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; seg... 42 2.2
222emb|AJ237697.1|SPO237697 Schizosaccharomyces pombe mRNA for puta... 42 2.2
223emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in... 42 2.2
224gb|BC034942.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti... 42 2.2
225emb|CR857318.1| Pongo pygmaeus mRNA; cDNA DKFZp469G1332 (from cl... 42 2.2
226dbj|BS000629.2| Pan troglodytes chromosome Y clone: PTB-194O02, ... 42 2.2
227dbj|BS000552.1| Pan troglodytes chromosome Y clone:PTB-302F24, c... 42 2.2
228gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 42 2.2
229gb|AY114637.1| Arabidopsis thaliana ATP-dependent RNA helicase-l... 42 2.2
230dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 42 2.2
231gb|AY062446.1| Arabidopsis thaliana ATP-dependent RNA helicase-l... 42 2.2
232dbj|AK163250.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 42 2.2
233gb|CP000249.1| Frankia sp. CcI3, complete genome 42 2.2
234gb|AY541738.1| Microtus agrestis isolate ExDBYsorknord DBY gene,... 42 2.2
235gb|AY541715.1| Microtus agrestis isolate ExDBYsorksyd DBY gene, ... 42 2.2
236dbj|AK140990.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 42 2.2
237gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 42 2.2
238ref|NM_001023025.1| Schizosaccharomyces pombe 972h- hypothetical... 42 2.2
239gb|AF218580.1|AF218580 Xenopus laevis p68 RNA helicase mRNA, com... 42 2.2
240ref|NM_065859.3| Caenorhabditis elegans F01F1.7 (F01F1.7) mRNA, ... 42 2.2
241emb|BX823918.1|CNS0A4PV Arabidopsis thaliana Full-length cDNA Co... 42 2.2
242ref|NM_001008986.1| Pan troglodytes DEAD (Asp-Glu-Ala-Asp) box p... 42 2.2
243ref|XM_228701.3| PREDICTED: Rattus norvegicus DEAD (Asp-Glu-Ala-... 42 2.2
244gb|AY088091.1| Arabidopsis thaliana clone 41181 mRNA, complete s... 42 2.2
245gb|AY960203.1| Odontesthes bonariensis Vasa-like protein mRNA, p... 42 2.2
246dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 42 2.2
247dbj|AB051835.1| Oreochromis niloticus vas-s mRNA for vasa short ... 42 2.2
248dbj|AB032467.1| Oreochromis niloticus mRNA for vasa, complete cds 42 2.2
249emb|AL833805.11| Mouse DNA sequence from clone RP23-158L19 on ch... 42 2.2
250emb|BX085195.5| Zebrafish DNA sequence from clone DKEY-226A5 in ... 42 2.2
251gb|AC004474.1|AC004474 Homo sapiens chromosome Y, clone 475I1, c... 42 2.2
252gb|AF000985.1|HSAF000985 Homo sapiens dead box, Y isoform (DBY) ... 42 2.2
253gb|AF000984.1|HSAF000984 Homo sapiens dead box, Y isoform (DBY) ... 42 2.2
254gb|U13070.1| Caenorhabditis elegans cosmid F01F1, complete sequence 42 2.2
255gb|AF084222.1|AF084222 Schizosaccharomyces pombe putative DEAD b... 42 2.2
256ref|NM_010028.1| Mus musculus DEAD/H (Asp-Glu-Ala-Asp/His) box p... 42 2.2
257gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete ge... 42 2.2
258gb|L25126.1|MUSRNAHELI Mus musculus RNA helicase mRNA, complete cds 42 2.2
259dbj|AB012389.1| Schizosaccharomyces pombe mRNA for Moc2 RNA heli... 42 2.2
260gb|AC154130.1| Tribolium castaneum BAC T.cast_C11O3 (Clemson Un... 40 8.8
261gb|AF510054.1| Schistocerca gregaria vasa-like gene, partial cds 40 8.8
262ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (... 40 8.8
263ref|XM_480203.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.8
264ref|XM_477619.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.8
265ref|NM_177069.2| Mus musculus RIKEN cDNA E330009P21 gene (E33000... 40 8.8
266gb|AY723847.1| Saccharomyces cerevisiae clone FLH004944.01X YLR2... 40 8.8
267ref|XM_613184.2| PREDICTED: Bos taurus similar to Probable RNA-d... 40 8.8
268gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRN... 40 8.8
269ref|NM_026360.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep... 40 8.8
270ref|NM_175214.3| Mus musculus kinesin family member 27 (Kif27), ... 40 8.8
271ref|XM_705616.1| Candida albicans SC5314 putative nonsense-media... 40 8.8
272ref|XM_705602.1| Candida albicans SC5314 putative nonsense-media... 40 8.8
273ref|XM_755134.1| Ustilago maydis 521 hypothetical protein (UM040... 40 8.8
274ref|XM_816398.1| Trypanosoma cruzi strain CL Brener ATP-dependen... 40 8.8
275gb|BC060168.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.8
276ref|XM_651823.1| Entamoeba histolytica HM-1:IMSS DEAD/DEAH box h... 40 8.8
277ref|XM_759104.1| Theileria parva strain Muguga chromosome 4 RNA ... 40 8.8
278gb|AY274092.1| Coccyzus erythropthalmus phosphoenolpyruvate carb... 40 8.8
279ref|XM_789693.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.8
280emb|AL450389.12| Human DNA sequence from clone RP5-929G5 on chro... 40 8.8
281gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 8.8
282ref|XM_505193.1| Yarrowia lipolytica CLIB122, YALI0F09141g predi... 40 8.8
283emb|CR388143.6| Zebrafish DNA sequence from clone DKEY-189O20 in... 40 8.8
284ref|XM_963915.1| PREDICTED: Tribolium castaneum similar to CG455... 40 8.8
285gb|AE008734.1| Salmonella typhimurium LT2, section 42 of 220 of ... 40 8.8
286gb|BC099397.1| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cD... 40 8.8
287emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 40 8.8
288emb|AL627268.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 8.8
289emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A stra... 40 8.8
290gb|BC095944.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.8
291emb|BX647482.1|HSM807628 Homo sapiens genomic DNA; cDNA DKFZp686... 40 8.8
292emb|AJ719824.1| Gallus gallus mRNA for hypothetical protein, clo... 40 8.8
293ref|NM_001007853.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box pol... 40 8.8
294dbj|AB110202.1| Oryza sativa (japonica cultivar-group) mRNA for ... 40 8.8
295gb|DQ397098.1| Crepidula fornicata PL10 mRNA, partial cds 40 8.8
296gb|AC105094.6| Homo sapiens chromosome 18, clone RP11-1096D5, co... 40 8.8
297gb|AC110997.4| Homo sapiens chromosome 18, clone RP11-56J20, com... 40 8.8
298dbj|AK136136.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.8
299dbj|AK135949.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.8
300gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, comp... 40 8.8
301gb|L80215.1|HUM69DC8Z Homo sapiens (subclone 1_a7 from P1 H69) D... 40 8.8
302ref|NM_199036.1| Mus musculus F-box and WD-40 domain protein 15 ... 40 8.8
303dbj|AK010310.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 8.8
304gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosom... 40 8.8
305dbj|AK087902.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.8
306gb|DQ067445.1| Mus musculus early ovarian protein-1 (Eop1) mRNA,... 40 8.8
307dbj|AK087710.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.8
308dbj|AK087669.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.8
309gb|BC103318.1| Bos taurus cDNA clone IMAGE:7941432, partial cds 40 8.8
310dbj|AK076982.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 8.8
311ref|NM_001039431.1| Tribolium castaneum vasa RNA helicase (vasa)... 40 8.8
312tpg|BK001056.1| TPA: TPA_exp: Mus musculus kinesin-related prote... 40 8.8
313gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 8.8
314ref|XM_623665.1| PREDICTED: Apis mellifera similar to CG10077-PA... 40 8.8
315ref|XM_623423.1| PREDICTED: Apis mellifera similar to CG10077-PA... 40 8.8
316ref|XM_623281.1| PREDICTED: Apis mellifera similar to CG10077-PA... 40 8.8
317ref|XM_394925.2| PREDICTED: Apis mellifera similar to GA20653-PA... 40 8.8
318ref|XM_623190.1| PREDICTED: Apis mellifera similar to DEAD (Asp-... 40 8.8
319dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
320dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
321gb|AC147286.3| Pan troglodytes BAC clone RP43-75F15 from chromos... 40 8.8
322gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 8.8
323dbj|AK196692.1| Mus musculus cDNA, clone:Y1G0122J24, strand:plus... 40 8.8
324dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 8.8
325dbj|AP006529.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
326emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chr... 40 8.8
327dbj|AP004698.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
328dbj|AP004635.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
329dbj|AK102570.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.8
330dbj|AK102356.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.8
331gb|AC005534.2|AC005534 Homo sapiens PAC clone RP5-982E9 from 7q3... 40 8.8
332dbj|AK073463.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.8
333gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, comple... 40 8.8
334emb|BX511306.10| Zebrafish DNA sequence from clone DKEY-219L12 i... 40 8.8
335gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 8.8
336emb|AJ010934.1|RNO010934 Rattus norvegicus ddx5 gene, exons 2 to... 40 8.8
337gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 8.8
338gb|AY887136.1| Tribolium castaneum vasa RNA helicase mRNA, compl... 40 8.8
339gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, comple... 40 8.8
340gb|U17245.1|YSCL9328 Saccharomyces cerevisiae chromosome XII cos... 40 8.8
341emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 8.8
342gb|L81906.1|HSL81906 Homo sapiens (subclone 2_f8 from P1 H69) DN... 40 8.8
343gb|AC001214.1|HSAC001214 Homo sapiens (subclone 1_a7 from P1 H69... 40 8.8
344emb|AL606529.9| Human DNA sequence from clone RP4-744B2 on chrom... 40 8.8
345emb|X94313.1|MMHLR1 M.musculus Hlr1 gene 40 8.8
346dbj|D86601.1| Bombyx mori BmVLG mRNA, complete cds 40 8.8
347dbj|AB048845.1| Aurelia aurita mRNA for PL10-related protein CnP... 40 8.8
348emb|AL603664.16| Mouse DNA sequence from clone RP23-247J12 on ch... 40 8.8

>dbj|AK064782.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B12, full
            insert sequence
          Length = 3413

 Score =  539 bits (272), Expect = e-150
 Identities = 542/632 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 72
            ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 510  gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 569

                                                                        
Query: 73   cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 132
            || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 570  cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 629

                                                                        
Query: 133  aactttccagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcct 192
            ||||| ||||||||||| |||||||| || ||||||   ||||| || ||||| ||||||
Sbjct: 630  aacttcccagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcct 689

                                                                        
Query: 193  atccaagctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaa 252
            || ||  | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||
Sbjct: 690  attcagtcacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaa 749

                                                                        
Query: 253  actggatctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaa 312
            ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| 
Sbjct: 750  actggctctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacag 809

                                                                        
Query: 313  cctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactg 372
            |||||||| |||||||||||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 810  cctcgactagaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactg 869

                                                                        
Query: 373  gctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactagaagcaca 432
            ||||||||||||||   |||| ||   || |||||||||||||| |||||||||||||| 
Sbjct: 870  gctgttcaaatacaacaagaatctggcaaatttggatcatactcaagaactagaagcact 929

                                                                        
Query: 433  tgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaa 492
            |||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 930  tgtatctatggtggagcacctaagggaccacaaatacgtgaccttaggagaggggttgag 989

                                                                        
Query: 493  atcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacacaaaccta 552
            || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| ||||| 
Sbjct: 990  attgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacactaacctg 1049

                                                                        
Query: 553  cgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 612
            ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||||||| 
Sbjct: 1050 cgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggttttgag 1109

                                            
Query: 613  cctcagattcggaaaatattagcacaaatccg 644
            || |||||||| |||||| | ||||| |||||
Sbjct: 1110 ccccagattcgtaaaatagtggcacagatccg 1141



to top

>ref|XM_463609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1443

 Score =  535 bits (270), Expect = e-149
 Identities = 531/618 (85%)
 Strand = Plus / Plus

                                                                       
Query: 13  gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 72
           ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 364 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 423

                                                                       
Query: 73  cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 132
           || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 424 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 483

                                                                       
Query: 133 aactttccagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcct 192
           ||||| ||||||||||| |||||||| || ||||||   ||||| || ||||| ||||||
Sbjct: 484 aacttcccagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcct 543

                                                                       
Query: 193 atccaagctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaa 252
           || ||  | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||
Sbjct: 544 attcagtcacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaa 603

                                                                       
Query: 253 actggatctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaa 312
           ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| 
Sbjct: 604 actggctctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacag 663

                                                                       
Query: 313 cctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactg 372
           |||||||| |||||||||||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 664 cctcgactagaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactg 723

                                                                       
Query: 373 gctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactagaagcaca 432
           ||||||||||||||   |||| ||   || |||||||||||||| |||||||||||||| 
Sbjct: 724 gctgttcaaatacaacaagaatctggcaaatttggatcatactcaagaactagaagcact 783

                                                                       
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaa 492
           |||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 784 tgtatctatggtggagcacctaagggaccacaaatacgtgaccttaggagaggggttgag 843

                                                                       
Query: 493 atcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacacaaaccta 552
           || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| ||||| 
Sbjct: 844 attgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacactaacctg 903

                                                                       
Query: 553 cgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 612
           ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||||||| 
Sbjct: 904 cgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggttttgag 963

                             
Query: 613 cctcagattcggaaaata 630
           || |||||||| ||||||
Sbjct: 964 ccccagattcgtaaaata 981



to top

>gb|AY466159.1| Zea mays DEAD box RNA helicase (DRH1) mRNA, complete cds
          Length = 2214

 Score =  484 bits (244), Expect = e-133
 Identities = 451/518 (87%), Gaps = 4/518 (0%)
 Strand = Plus / Plus

                                                                        
Query: 127  gaagccaactttccagattactgcatgcaagcgatcgccaagtccggatttgtggagcca 186
            ||||||||||| |||||||||||||||||||| || ||||| || |||||||||||||||
Sbjct: 554  gaagccaacttcccagattactgcatgcaagctattgccaa-tctggatttgtggagcca 612

                                                                        
Query: 187  acgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgattggtatt 246
            || ||||| ||| |||| |||||||| |||   |||||||| |||||| |||||||||| 
Sbjct: 613  acacctattcaatctcaaggttggcctatg---ttgaagggtagggacctgattggtatc 669

                                                                        
Query: 247  gcagaaactggatctgggaaaacactatcttacatactacctggtttggttcatgttggt 306
            ||  |||| || || ||||||||| |||||||  |  |||||||  ||||||||||||||
Sbjct: 670  gctcaaacaggctcagggaaaacattatcttatctgttacctgggctggttcatgttggt 729

                                                                        
Query: 307  gcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaaga 366
            || || ||||| || |||||||| |||||||||||||| || || || ||||| ||||||
Sbjct: 730  gcccagcctcggctagaacaaggcgatggcccaattgtattaattctcgctcccacaaga 789

                                                                        
Query: 367  gaactggctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactaga 426
            |||||||||||||||||||||| |||| ||||||| ||||||||||| || |||||||||
Sbjct: 790  gaactggctgttcaaatacaggaagaatctacaaaatttggatcatattcaagaactaga 849

                                                                        
Query: 427  agcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagagga 486
            ||||||||| |||| ||||| ||||||||||| ||||||||||| ||||| || ||||||
Sbjct: 850  agcacatgtgtctatggtggtgcacctaagggtccacaaatacgggaccttagaagagga 909

                                                                        
Query: 487  gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 546
            |||||||| ||||||||||| || || |||||||||||||||||||||||||||||||||
Sbjct: 910  gttgaaattgtcattgcaactcctggccggttgattgatatgctggaagctggtcacaca 969

                                                                        
Query: 547  aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 606
            ||||||||| | || |||||||||||| |||||||||| ||||| ||||| |||||||| 
Sbjct: 970  aacctacgtagagtgacataccttgtgttggatgaggctgaccggatgctagatatgggg 1029

                                                  
Query: 607  tttgaacctcagattcggaaaatattagcacaaatccg 644
            ||||| || || |||||||||||| ||||||| |||||
Sbjct: 1030 tttgagccccaaattcggaaaatagtagcacagatccg 1067



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  206 bits (104), Expect = 7e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                            
Query: 322      gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 381
                |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 39684703 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 39684644

                                                                            
Query: 382      atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 441
                |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 39684643 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 39684584

                                                            
Query: 442      ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 485
                ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 39684583 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 39684540



 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                            
Query: 140      cagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcctatccaag 199
                |||||||||| |||||||| || ||||||   ||||| || ||||| |||||||| ||  
Sbjct: 39684965 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 39684906

                                                                            
Query: 200      ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 259
                | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 39684905 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 39684846

                                                                            
Query: 260      ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 319
                |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 39684845 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 39684786

                 
Query: 320      t 320
                |
Sbjct: 39684785 t 39684785



 Score =  127 bits (64), Expect = 5e-26
 Identities = 124/144 (86%)
 Strand = Plus / Minus

                                                                            
Query: 487      gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 546
                ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 39684463 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 39684404

                                                                            
Query: 547      aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 606
                ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 39684403 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 39684344

                                        
Query: 607      tttgaacctcagattcggaaaata 630
                ||||| || |||||||| ||||||
Sbjct: 39684343 tttgagccccagattcgtaaaata 39684320



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                            
Query: 577     gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
               |||||||||||||| ||||| |||||||| |||||||||||||||
Sbjct: 5248026 gatgaggcagaccggatgctggatatgggctttgaacctcagatt 5247982



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                            
Query: 13       gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 72
                ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 39685208 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 39685149

                                                                            
Query: 73       cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 132
                || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 39685148 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 39685089

                          
Query: 133      aactttccag 142
                ||||| ||||
Sbjct: 39685088 aacttcccag 39685079



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 72      ccgggatatcaccgtggagggccgggaggtgcccaagcc 110
               |||||| ||||||||||||||||| || |||||||||||
Sbjct: 5249657 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 5249619



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                           
Query: 568     cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
               ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 3715154 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 3715111



to top

>dbj|AP003416.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0456E05
          Length = 173699

 Score =  206 bits (104), Expect = 7e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                          
Query: 322    gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 381
              |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 165659 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 165600

                                                                          
Query: 382    atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 441
              |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 165599 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 165540

                                                          
Query: 442    ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 485
              ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 165539 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 165496



 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                          
Query: 140    cagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcctatccaag 199
              |||||||||| |||||||| || ||||||   ||||| || ||||| |||||||| ||  
Sbjct: 165921 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 165862

                                                                          
Query: 200    ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 259
              | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 165861 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 165802

                                                                          
Query: 260    ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 319
              |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 165801 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 165742

               
Query: 320    t 320
              |
Sbjct: 165741 t 165741



 Score =  127 bits (64), Expect = 5e-26
 Identities = 124/144 (86%)
 Strand = Plus / Minus

                                                                          
Query: 487    gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 546
              ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 165419 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 165360

                                                                          
Query: 547    aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 606
              ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 165359 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 165300

                                      
Query: 607    tttgaacctcagattcggaaaata 630
              ||||| || |||||||| ||||||
Sbjct: 165299 tttgagccccagattcgtaaaata 165276



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                          
Query: 13     gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 72
              ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 166164 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 166105

                                                                          
Query: 73     cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 132
              || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 166104 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 166045

                        
Query: 133    aactttccag 142
              ||||| ||||
Sbjct: 166044 aacttcccag 166035



to top

>dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0470A12
          Length = 185095

 Score =  206 bits (104), Expect = 7e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                         
Query: 322   gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 381
             |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 35602 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 35543

                                                                         
Query: 382   atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 441
             |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 35542 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 35483

                                                         
Query: 442   ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 485
             ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 35482 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 35439



 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                         
Query: 140   cagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcctatccaag 199
             |||||||||| |||||||| || ||||||   ||||| || ||||| |||||||| ||  
Sbjct: 35864 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 35805

                                                                         
Query: 200   ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 259
             | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 35804 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 35745

                                                                         
Query: 260   ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 319
             |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 35744 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 35685

              
Query: 320   t 320
             |
Sbjct: 35684 t 35684



 Score =  127 bits (64), Expect = 5e-26
 Identities = 124/144 (86%)
 Strand = Plus / Minus

                                                                         
Query: 487   gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 546
             ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 35362 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 35303

                                                                         
Query: 547   aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 606
             ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 35302 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 35243

                                     
Query: 607   tttgaacctcagattcggaaaata 630
             ||||| || |||||||| ||||||
Sbjct: 35242 tttgagccccagattcgtaaaata 35219



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                         
Query: 13    gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 72
             ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 36107 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 36048

                                                                         
Query: 73    cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 132
             || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 36047 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 35988

                       
Query: 133   aactttccag 142
             ||||| ||||
Sbjct: 35987 aacttcccag 35978



to top

>ref|NM_125706.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G63120 transcript
           variant AT5G63120.1 mRNA, complete cds
          Length = 2372

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 181 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 240
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 753 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 812

                                                                       
Query: 241 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 300
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 813 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 872

                                                                       
Query: 301 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 360
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 873 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 932

                               
Query: 361 acaagagaactggctgttca 380
           ||||||||||| ||||||||
Sbjct: 933 acaagagaactagctgttca 952



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 423  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 482
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 995  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1054

                                                                
Query: 483  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 534
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1055 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1106



to top

>ref|NM_203256.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G63120 transcript
           variant AT5G63120.2 mRNA, complete cds
          Length = 2185

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 181 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 240
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 753 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 812

                                                                       
Query: 241 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 300
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 813 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 872

                                                                       
Query: 301 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 360
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 873 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 932

                               
Query: 361 acaagagaactggctgttca 380
           ||||||||||| ||||||||
Sbjct: 933 acaagagaactagctgttca 952



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 423  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 482
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 995  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1054

                                                                
Query: 483  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 534
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1055 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1106



to top

>gb|BT000610.1| Arabidopsis thaliana AtP-dependent RNA helicase-like protein
           (At5g63120/MDC12_8) mRNA, complete cds
          Length = 1455

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 181 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 240
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 559 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 618

                                                                       
Query: 241 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 300
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 619 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 678

                                                                       
Query: 301 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 360
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 679 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 738

                               
Query: 361 acaagagaactggctgttca 380
           ||||||||||| ||||||||
Sbjct: 739 acaagagaactagctgttca 758



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 423 tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 482
           |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 801 tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 860

                                                               
Query: 483 aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 534
           ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 861 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 912



to top

>gb|AY060589.1| Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, complete cds
          Length = 2366

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 181 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 240
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 754 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 813

                                                                       
Query: 241 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 300
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 814 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 873

                                                                       
Query: 301 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 360
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 874 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 933

                               
Query: 361 acaagagaactggctgttca 380
           ||||||||||| ||||||||
Sbjct: 934 acaagagaactagctgttca 953



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 423  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 482
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 996  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1055

                                                                
Query: 483  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 534
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1056 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1107



to top

>emb|BX832051.1|CNS09YVO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH48ZH12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2119

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 115/138 (83%)
 Strand = Plus / Plus

                                                                       
Query: 181 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 240
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 742 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 801

                                                                       
Query: 241 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 300
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 802 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 861

                             
Query: 301 gttggtgcacaacctcga 318
           ||| ||||||||||||||
Sbjct: 862 gttagtgcacaacctcga 879



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 481  agaggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 534
            ||||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1041 agaggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1094



to top

>dbj|AB008265.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12
          Length = 81662

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                         
Query: 181   gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 240
             |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 29983 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 29924

                                                                         
Query: 241   ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 300
             |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 29923 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 29864

                               
Query: 301   gttggtgcacaacctcga 318
             ||| ||||||||||||||
Sbjct: 29863 gttagtgcacaacctcga 29846



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 499   attgcaacaccaggtcggttgattgatatgctggaa 534
             ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 29490 attgctacacctggtcgtttgattgatatgttggaa 29455



to top

>gb|BT012961.1| Lycopersicon esculentum clone 114151R, mRNA sequence
          Length = 1763

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 487 gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 546
           |||||||| || ||||| ||||| ||  |||||||||||||| | ||| ||  ||| |||
Sbjct: 701 gttgaaattgttattgccacacctggaaggttgattgatatgttagaatctaatcataca 760

                                                                       
Query: 547 aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 606
           || || ||  | || ||||| || |||||||||||||| ||||| ||||| || ||||||
Sbjct: 761 aatcttcgaagagtgacatatctcgtgctggatgaggctgaccgcatgctagacatgggt 820

                                  
Query: 607 tttgaacctcagattcggaaaat 629
           |||||||||||||| || |||||
Sbjct: 821 tttgaacctcagatccgcaaaat 843



to top

>ref|NM_104388.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT1G55150 mRNA, complete
           cds
          Length = 1825

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 542 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 601
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 872 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 931

                                       
Query: 602 tgggttttgaacctcagattcggaaaat 629
           |||| ||||| |||||||| ||||||||
Sbjct: 932 tggggtttgaccctcagatccggaaaat 959



to top

>gb|AY128786.1| Arabidopsis thaliana unknown protein (At1g55150) mRNA, complete cds
          Length = 1539

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 542 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 601
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 722 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 781

                                       
Query: 602 tgggttttgaacctcagattcggaaaat 629
           |||| ||||| |||||||| ||||||||
Sbjct: 782 tggggtttgaccctcagatccggaaaat 809



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 328 ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 387
           ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 508 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 567



to top

>gb|AY062745.1| Arabidopsis thaliana Unknown protein (At1g55150; T7N22.9) mRNA,
           complete cds
          Length = 1814

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 542 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 601
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 872 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 931

                                       
Query: 602 tgggttttgaacctcagattcggaaaat 629
           |||| ||||| |||||||| ||||||||
Sbjct: 932 tggggtttgaccctcagatccggaaaat 959



to top

>emb|BX813460.1|CNS0AC9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZH04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1731

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 542 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 601
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 850 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 909

                                       
Query: 602 tgggttttgaacctcagattcggaaaat 629
           |||| ||||| |||||||| ||||||||
Sbjct: 910 tggggtttgaccctcagatccggaaaat 937



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 328 ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 387
           ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 636 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 695



to top

>gb|AC073944.6|AC073944 Arabidopsis thaliana chromosome 1 BAC T7N22 genomic sequence, complete
             sequence
          Length = 44540

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                         
Query: 542   acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 601
             |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 35818 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 35877

                                         
Query: 602   tgggttttgaacctcagattcggaaaat 629
             |||| ||||| |||||||| ||||||||
Sbjct: 35878 tggggtttgaccctcagatccggaaaat 35905



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                         
Query: 328   ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 387
             ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 35499 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 35558



to top

>dbj|AK068197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013140N02, full
           insert sequence
          Length = 4012

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Plus

                                                                       
Query: 537 tggtcacacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgct 596
           ||||||||| ||||| ||  | || |||||||| || ||||||||||| ||||| |||||
Sbjct: 2   tggtcacactaacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgct 61

                                                           
Query: 597 cgatatgggttttgaacctcagattcggaaaatattagcacaaatccg 644
            || ||||||||||| || |||||||| |||||| | ||||| |||||
Sbjct: 62  tgacatgggttttgagccccagattcgtaaaatagtggcacagatccg 109



to top

>gb|AF479823.1| Pantodon buchholzi DEAD box RNA helicase Vasa mRNA, complete cds
          Length = 1512

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 565 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacc 614
           |||||||| ||||||||||||||||| ||| | |||||||||||||||||
Sbjct: 340 taccttgtactggatgaggcagaccgcatgttggatatgggttttgaacc 389



to top

>gb|AF096248.1|AF096248 Lycopersicon esculentum ethylene-responsive RNA helicase (ER68)
           mRNA, complete cds
          Length = 1752

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 571 gtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           |||||||||||||| ||||| ||||| || ||||||||||||||||||||
Sbjct: 824 gtgctggatgaggctgaccgcatgctagacatgggttttgaacctcagat 873



to top

>ref|NM_004396.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5), mRNA
          Length = 2325

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 768 tgtatctacggtggtgctcctaagggaccacaaatacgtga 808



to top

>ref|NM_188251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1485

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 577 gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
           |||||||||||||| ||||| |||||||| |||||||||||||||
Sbjct: 733 gatgaggcagaccggatgctggatatgggctttgaacctcagatt 777



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 72  ccgggatatcaccgtggagggccgggaggtgcccaagcc 110
           |||||| ||||||||||||||||| || |||||||||||
Sbjct: 228 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 266



to top

>ref|XM_512004.1| PREDICTED: Pan troglodytes DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
           (LOC455267), mRNA
          Length = 1462

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 743 tgtatctacggtggtgctcctaagggaccacaaatacgtga 783



to top

>gb|BC016027.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:1516 IMAGE:3528578), complete cds
          Length = 2366

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 739 tgtatctacggtggtgctcctaagggaccacaaatacgtga 779



to top

>ref|XM_448941.1| Candida glabrata CBS138, CAGL0L03846 partial mRNA
          Length = 1635

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 327 aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 383
           ||||||||| |||||||||||| | || |||||||| |||||||| |||||||||||
Sbjct: 540 aggtgatggtccaattgtcttggttctagctccaaccagagaacttgctgttcaaat 596



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 489 tgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagc 536
           |||||| |||||||| || |||||| | |||||||||||||| |||||
Sbjct: 702 tgaaattgtcattgctaccccaggtagattgattgatatgcttgaagc 749



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 598 gatatgggttttgaacctca 617
           ||||||||||||||||||||
Sbjct: 811 gatatgggttttgaacctca 830



to top

>ref|XM_855709.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 14 (LOC474508), mRNA
          Length = 4759

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855680.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 13 (LOC474508), mRNA
          Length = 4789

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 980  taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1039

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1040 aaaat 1044



to top

>ref|XM_855640.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 12 (LOC474508), mRNA
          Length = 4885

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_845027.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 2 (LOC474508), mRNA
          Length = 4873

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855575.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 11 (LOC474508), mRNA
          Length = 4870

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_531736.2| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 1 (LOC474508), mRNA
          Length = 4909

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855514.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 10 (LOC474508), mRNA
          Length = 4882

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855481.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 9 (LOC474508), mRNA
          Length = 1645

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855444.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 8 (LOC474508), mRNA
          Length = 1946

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855416.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 7 (LOC474508), mRNA
          Length = 1637

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855385.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 6 (LOC474508), mRNA
          Length = 1887

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>ref|XM_855349.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 5 (LOC474508), mRNA
          Length = 4807

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||||||||| || 
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaacctcagatccgt 1117

                 
Query: 625  aaaat 629
            |||||
Sbjct: 1118 aaaat 1122



to top

>emb|X52104.1|HSP68A Human mRNA for p68 protein
          Length = 2330

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 773 tgtatctacggtggtgctcctaagggaccacaaatacgtga 813



to top

>emb|X15729.1|HSNP68M Human mRNA for nuclear p68 protein
          Length = 2323

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 765 tgtatctacggtggtgctcctaagggaccacaaatacgtga 805



to top

>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327    aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 383
              ||||||||| |||||||||||| | || |||||||| |||||||| |||||||||||
Sbjct: 443875 aggtgatggtccaattgtcttggttctagctccaaccagagaacttgctgttcaaat 443819



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 489    tgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagc 536
              |||||| |||||||| || |||||| | |||||||||||||| |||||
Sbjct: 443713 tgaaattgtcattgctaccccaggtagattgattgatatgcttgaagc 443666



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 598    gatatgggttttgaacctca 617
              ||||||||||||||||||||
Sbjct: 443604 gatatgggttttgaacctca 443585



to top

>emb|BX571764.1|HSM806634 Homo sapiens mRNA; cDNA DKFZp686J01190 (from clone DKFZp686J01190)
          Length = 3572

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 769 tgtatctacggtggtgctcctaagggaccacaaatacgtga 809



to top

>gb|BT007642.1| Synthetic construct Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 5 (RNA helicase, 68kDa) mRNA, partial cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|BT006943.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA
           helicase, 68kDa) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>emb|CR607012.1| full-length cDNA clone CS0DA009YD21 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1800

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 265 tgtatctacggtggtgctcctaagggaccacaaatacgtga 305



to top

>gb|AC138744.4| Homo sapiens chromosome 17, clone RP11-859E19, complete sequence
          Length = 177325

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                       
Query: 433    tgtatctacggtggagcacctaagggaccacaaatacgtga 473
              |||||||||||||| || |||||||||||||||||||||||
Sbjct: 169364 tgtatctacggtggtgctcctaagggaccacaaatacgtga 169324



to top

>dbj|AP003244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0419B01
          Length = 149610

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                          
Query: 577   gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
             |||||||||||||| ||||| |||||||| |||||||||||||||
Sbjct: 43277 gatgaggcagaccggatgctggatatgggctttgaacctcagatt 43233



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 72    ccgggatatcaccgtggagggccgggaggtgcccaagcc 110
             |||||| ||||||||||||||||| || |||||||||||
Sbjct: 44908 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 44870



to top

>gb|AY892740.1| Synthetic construct Homo sapiens clone FLH024742.01L DEAD box
           polypeptide 5 (DDX5) mRNA, partial cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AY890256.1| Synthetic construct Homo sapiens clone FLH024746.01X DEAD box
           polypeptide 5 (DDX5) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AY890255.1| Synthetic construct Homo sapiens clone FLH024745.01X DEAD box
           polypeptide 5 (DDX5) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AF015812.1|AF015812 Homo sapiens RNA helicase p68 (HUMP68) gene, complete cds
          Length = 7834

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 433  tgtatctacggtggagcacctaagggaccacaaatacgtga 473
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 3767 tgtatctacggtggtgctcctaagggaccacaaatacgtga 3807



to top

>dbj|AB209919.1| Homo sapiens mRNA for Hypothetical protein DKFZp686J01190 variant
           protein
          Length = 3539

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 752 tgtatctacggtggtgctcctaagggaccacaaatacgtga 792



to top

>gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, complete sequence
          Length = 188552

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                       
Query: 433    tgtatctacggtggagcacctaagggaccacaaatacgtga 473
              |||||||||||||| || |||||||||||||||||||||||
Sbjct: 149714 tgtatctacggtggtgctcctaagggaccacaaatacgtga 149754



to top

>emb|AJ010476.1|ATH010476 Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH30
          Length = 790

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 423 tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 482
           |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 34  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 93

                                                               
Query: 483 aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 534
           ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 94  aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 145



to top

>gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0047M04, complete sequence
          Length = 109523

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 568   cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
             |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 77215 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 77258



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 568      cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
                |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 27126162 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 27126205



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 577      gatgaggcagaccgtatgctcgatatgggttttgaacc 614
                |||||||||||  | ||||| |||||||||||||||||
Sbjct: 22097173 gatgaggcagatagaatgcttgatatgggttttgaacc 22097210



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 568      cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
                |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 27453215 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 27453258



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 577      gatgaggcagaccgtatgctcgatatgggttttgaacc 614
                |||||||||||  | ||||| |||||||||||||||||
Sbjct: 22407120 gatgaggcagatagaatgcttgatatgggttttgaacc 22407157



to top

>emb|X52648.1|SPP68 Schizosaccharomyces pombe p68 gene for p68 protein
          Length = 2742

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 571  gtgctggatgaggcagaccgtatgctcgatatgggttttgaacctca 617
            ||||||||||| || ||||| ||||| ||||||||||||||||||||
Sbjct: 1102 gtgctggatgaagccgaccgaatgcttgatatgggttttgaacctca 1148



to top

>emb|AL032684.1|SPBP8B7 S.pombe chromosome II p1 p8B7
          Length = 71000

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                            
Query: 571   gtgctggatgaggcagaccgtatgctcgatatgggttttgaacctca 617
             ||||||||||| || ||||| ||||| ||||||||||||||||||||
Sbjct: 31858 gtgctggatgaagccgaccgaatgcttgatatgggttttgaacctca 31812



to top

>ref|NM_001022444.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBP8B7.16c),
           partial mRNA
          Length = 1653

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 571 gtgctggatgaggcagaccgtatgctcgatatgggttttgaacctca 617
           ||||||||||| || ||||| ||||| ||||||||||||||||||||
Sbjct: 820 gtgctggatgaagccgaccgaatgcttgatatgggttttgaacctca 866



to top

>gb|L11574.1|YSPP68DBP Schizosaccharomyces pombe p68 RNA helicase (dbp2) mRNA, complete
           cds
          Length = 1780

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 571 gtgctggatgaggcagaccgtatgctcgatatgggttttgaacctca 617
           ||||||||||| || ||||| ||||| ||||||||||||||||||||
Sbjct: 820 gtgctggatgaagccgaccgaatgcttgatatgggttttgaacctca 866



to top

>emb|CR861259.1| Pongo pygmaeus mRNA; cDNA DKFZp459M043 (from clone DKFZp459M043)
          Length = 3724

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||| ||||| || |||||||||||||||||||||||
Sbjct: 768 tgtatctatggtggtgctcctaagggaccacaaatacgtga 808



to top

>ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5931.2), mRNA
          Length = 1692

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 520 attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 579
           ||||||||||| |||||||| | ||| ||||| || || ||||| ||||| || || || 
Sbjct: 823 attgatatgctcgaagctggccgcaccaaccttcgccgagttacttacctcgttcttgac 882

                                           
Query: 580 gaggcagaccgtatgctcgatatgggttttga 611
           ||||| ||||| ||| | ||||||||||||||
Sbjct: 883 gaggccgaccgcatgttggatatgggttttga 914



to top

>ref|XM_950413.1| Theileria annulata strain Ankara DEAD-box RNA helicase (TA18420)
            partial mRNA
          Length = 1965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcggaaaata 630
            |||||||||||||  | ||| | |||||||| |||||||| |||||||||||||||
Sbjct: 1286 tggatgaggcagatagaatgttagatatgggatttgaaccacagattcggaaaata 1341



to top

>ref|XM_502093.1| Yarrowia lipolytica CLIB122, YALI0C21472g predicted mRNA
          Length = 1857

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
            |||||||| || |||||||| ||||| |||||||||||||||||
Sbjct: 961  taccttgtccttgatgaggccgaccgaatgctcgatatgggttt 1004



to top

>gb|AY786204.1| Monopterus albus DEAD box RNA helicase-PL10B mRNA, partial cds
          Length = 1127

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 565 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           ||||| || |||||||||||||| |||||||| || ||||| |||||||| |||||
Sbjct: 571 tacctggtcctggatgaggcagatcgtatgcttgacatgggctttgaaccacagat 626



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 565     taccttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
               |||||||| || |||||||| ||||| |||||||||||||||||
Sbjct: 2869924 taccttgtccttgatgaggccgaccgaatgctcgatatgggttt 2869881



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 574     ctggatgaggcagaccgtatgctcgatatgggtttt 609
               ||||||||||||||||| |||||||| |||||||||
Sbjct: 3049759 ctggatgaggcagaccggatgctcgacatgggtttt 3049724



to top

>ref|NM_111523.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT3G06480 mRNA, complete cds
          Length = 3605

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacc 614
            |||||||| || ||||||||||| ||||| || ||||||||||||||
Sbjct: 1849 cttgtgcttgacgaggcagaccgaatgcttgacatgggttttgaacc 1895



to top

>gb|BT016697.1| Zea mays clone Contig530 mRNA sequence
          Length = 1750

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 tttgtggagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggac 234
           |||||||| || || ||||||||| | || |||||||||||||| ||||  ||| | |||
Sbjct: 253 tttgtggaacctacccctatccaatcgcaaggttggccgatggcattgagaggccgcgac 312

                                              
Query: 235 gtgattggtattgcagaaactggatctgggaaaac 269
            | ||||| |||||||| || ||||| ||||||||
Sbjct: 313 cttattggcattgcagagacaggatcagggaaaac 347



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 577 gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
           ||||| |||||||| ||||| || ||||| |||||||||||||||
Sbjct: 655 gatgaagcagaccggatgctagacatgggatttgaacctcagatt 699



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 331 gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacaggca 390
           ||||| |||||||||||| |  | ||||| ||| | ||||| |||||||| ||||||  |
Sbjct: 409 gatggtccaattgtcttggtgttagctcctacacgtgaacttgctgttcagatacagcaa 468

                            
Query: 391 gaagctacaaagtttgg 407
           ||||| || ||||||||
Sbjct: 469 gaagcaaccaagtttgg 485



to top

>gb|AY587260.1| Sparus aurata vasa-like protein mRNA, partial cds
          Length = 594

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 569 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 371 ttgtgctggatgaggctgaccggatgttggatatgggttttga 413



to top

>gb|AF520608.1| Sparus aurata vasa-like mRNA, partial cds
          Length = 1586

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 569 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 344 ttgtgctggatgaggctgaccggatgttggatatgggttttga 386



to top

>gb|AC011623.5|ATAC011623 Arabidopsis thaliana chromosome III BAC F24P17 genomic sequence,
            complete sequence
          Length = 86022

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacc 614
            |||||||| || ||||||||||| ||||| || ||||||||||||||
Sbjct: 4902 cttgtgcttgacgaggcagaccgaatgcttgacatgggttttgaacc 4948



to top

>ref|XM_504478.1| Yarrowia lipolytica CLIB122, YALI0E27715g predicted mRNA
          Length = 1659

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 577 gatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
           |||||||| ||||| ||||||||||||||||| || ||||| |||||
Sbjct: 808 gatgaggccgaccgaatgctcgatatgggtttcgagcctcaaattcg 854



to top

>ref|XM_967408.1| PREDICTED: Tribolium castaneum similar to DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5 (LOC661233), mRNA
          Length = 1623

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 580 gaggcagaccgtatgctcgatatgggttttgaacctcagattcggaaaata 630
           |||||||| || ||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 736 gaggcagatcggatgcttgatatgggttttgaaccccaaattcgtaaaata 786



to top

>emb|X57328.1|XLRNAHE X.laevis mRNA for an ATP dependent RNA helicase
          Length = 2094

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||| |||||| | ||||| || |||||||||||||||||||||||
Sbjct: 1162 gatgaagcagacagaatgcttgacatgggttttgaacctcagattcg 1208



to top

>gb|DQ399799.1| Acanthopagrus schlegelii vasa protein mRNA, partial cds
          Length = 780

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 569 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 200 ttgtgctggatgaggctgaccggatgttggatatgggttttga 242



to top

>dbj|AP003200.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:B1046G12
          Length = 163533

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 72   ccgggatatcaccgtggagggccgggaggtgcccaagcc 110
            |||||| ||||||||||||||||| || |||||||||||
Sbjct: 1001 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 963



to top

>gb|BC094097.1| Xenopus laevis cDNA clone MGC:115016 IMAGE:6643594, complete cds
          Length = 4727

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||| |||||| | ||||| || |||||||||||||||||||||||
Sbjct: 1383 gatgaagcagacagaatgcttgacatgggttttgaacctcagattcg 1429



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                              
Query: 577     gatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
               |||||||| ||||| ||||||||||||||||| || ||||| |||||
Sbjct: 3273532 gatgaggccgaccgaatgctcgatatgggtttcgagcctcaaattcg 3273486



to top

>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172,
              complete sequence
          Length = 127731

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 175    tttgtggagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggac 234
              ||||| ||||| || || ||||| |||||||||||||| |||||| ||| ||| ||||| 
Sbjct: 104909 tttgttgagcccactccaatccaggctcagggttggcccatggctctgacgggtagggat 104850

                                     
Query: 235    gtgattggtattgcagaaactgg 257
               ||||||| ||||| || |||||
Sbjct: 104849 ttgattggcattgctgagactgg 104827



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 601    atgggttttgaacctcagattcggaaaat 629
              |||||||||||||||||||| ||||||||
Sbjct: 104272 atgggttttgaacctcagatacggaaaat 104244



to top

>ref|XR_002773.1| PREDICTED: Mus musculus hypothetical protein LOC670055 (LOC670055),
            mRNA
          Length = 2773

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 253  actggatctgggaaaacactatctta 278
            ||||||||||||||||||||||||||
Sbjct: 1070 actggatctgggaaaacactatctta 1095



to top

>ref|XM_750315.1| Aspergillus fumigatus Af293 RNA helicase Dbp (Afu2g10750) partial
           mRNA
          Length = 1698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 518 tgattgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctgg 577
           ||||||| |||||||||||||| |  || ||||| || || || || ||||| || || |
Sbjct: 764 tgattgacatgctggaagctggccggaccaacctccgccgtgtcacgtacctcgttcttg 823

                                                         
Query: 578 atgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
           | || || ||||| ||||| || |||||||| ||||||||||||||
Sbjct: 824 acgaagctgaccgcatgctggacatgggtttcgaacctcagattcg 869



to top

>emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chromosome 11 Contains a
             DEAD box polypeptide 5 (Ddx5) pseudogene, the Gnb2-rs1
             gene for guanine nucleotide binding protein, beta 2
             related sequence 1, the Trim41 gene for tripartite
             motif-containing 41, a novel protein similar to CDK2
             (cyclin-dependent kinase 2)-associated protein 1 (Cdkap1),
             the Trim7 gene for tripartite motif protein 7, the Ifi1
             gene for interferon inducible protein 1, a novel gene
             (LOC277018), two novel genes and four CpG islands,
             complete sequence
          Length = 202559

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 253   actggatctgggaaaacactatctta 278
             ||||||||||||||||||||||||||
Sbjct: 13020 actggatctgggaaaacactatctta 12995



to top

>ref|NM_204708.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 (DDX4), mRNA
          Length = 1989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 577  gatgaggcagaccgtatgctcgatatgggttttg 610
            ||||| |||||||| |||||||||||||||||||
Sbjct: 1177 gatgaagcagaccgcatgctcgatatgggttttg 1210



to top

>gb|AF188678.1|AF188678 Pisum sativum P72 DEAD box protein mRNA, complete cds
          Length = 2924

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagattcggaa 626
            |||||||||||| | ||||| || ||||||||||||||||| ||| ||||
Sbjct: 1100 gatgaggcagacaggatgctggacatgggttttgaacctcaaattaggaa 1149



to top

>emb|AJ010936.1|HSA010936 Homo sapiens ddx5-ps1 gene, partial
          Length = 334

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           ||||||||||||||||||||||||||
Sbjct: 262 actggatctgggaaaacactatctta 287



to top

>dbj|AB004836.1| Gallus gallus mRNA for Cvh, complete cds
          Length = 1989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 577  gatgaggcagaccgtatgctcgatatgggttttg 610
            ||||| |||||||| |||||||||||||||||||
Sbjct: 1177 gatgaagcagaccgcatgctcgatatgggttttg 1210



to top

>ref|NM_202477.1| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) transcript variant
            AT3G01540.3 mRNA, complete cds
          Length = 2365

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1101 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1153



to top

>ref|NM_111020.2| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) transcript variant
            AT3G01540.1 mRNA, complete cds
          Length = 2392

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1131 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1183



to top

>ref|NM_180161.1| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) transcript variant
            AT3G01540.2 mRNA, complete cds
          Length = 2395

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1131 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1183



to top

>ref|NM_001035542.1| Arabidopsis thaliana DRH1 AT3G01540 (DRH1) transcript variant
            AT3G01540.4 mRNA, complete cds
          Length = 2289

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1131 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1183



to top

>emb|CR954247.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome II, complete
              sequence
          Length = 635328

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 577    gatgaggcagaccgtatgctcgatatggg 605
              ||||| |||||||||||||||||||||||
Sbjct: 468000 gatgaagcagaccgtatgctcgatatggg 468028



to top

>gb|AC009325.8|ATAC009325 Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence,
             complete sequence
          Length = 105543

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 568   cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
             |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 36276 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 36224



to top

>gb|BT000795.1| Arabidopsis thaliana putative RNA helicase, DRH1 (At3g01540) mRNA,
           partial cds
          Length = 1532

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 568 cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 339 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 391



to top

>gb|BT009670.1| Arabidopsis thaliana At3g01540 gene, complete cds
          Length = 1857

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 568 cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 922 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 974



to top

>gb|AF462866.1|AF462866 Arabidopsis thaliana AT3g01540/F4P13_9 mRNA sequence
          Length = 2415

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1372 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1424



to top

>gb|AY062591.1| Arabidopsis thaliana RNA helicase, DRH1 (At3g01540; F4P13.9) mRNA,
            complete cds
          Length = 2264

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1125 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1177



to top

>gb|AF428313.1|AF428313 Arabidopsis thaliana AT3g01540/F4P13_9 mRNA, complete cds
          Length = 2067

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1027 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1079



to top

>gb|AY050375.1| Arabidopsis thaliana AT3g01540/F4P13_9 mRNA, complete cds
          Length = 2165

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1125 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1177



to top

>gb|AY730697.1| Nematostella vectensis DEAD box helicase Vasa2 (Vas2) mRNA, partial
           cds
          Length = 844

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 575 tggatgaggcagaccgtatgctcgatatgggttttgaacct 615
           ||||||| |||||||||||||| || ||||| |||||||||
Sbjct: 315 tggatgaagcagaccgtatgctggacatgggctttgaacct 355



to top

>emb|BX823517.1|CNS0A7FC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS47ZA08 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2267

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 1103 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 1155



to top

>gb|AY110750.1| Zea mays CL9052_1 mRNA sequence
          Length = 1387

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
            ||||| |||||||| ||||| || ||||| |||||||||||||||
Sbjct: 1051 gatgaagcagaccggatgctagacatgggatttgaacctcagatt 1007



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 331  gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacaggca 390
            ||||| |||||||||||| |  | ||||| ||| | ||||| |||||||| ||||||  |
Sbjct: 1297 gatggtccaattgtcttggtgttagctcctacacgtgaacttgctgttcagatacagcaa 1238

                             
Query: 391  gaagctacaaagtttgg 407
            ||||| || ||||||||
Sbjct: 1237 gaagcaaccaagtttgg 1221



to top

>dbj|AB010259.1| Arabidopsis thaliana mRNA for DRH1, complete cds
          Length = 1924

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 568 cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           |||||||| |||||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 929 cttgtgctagatgaggcagatagaatgttggacatgggttttgaacctcagat 981



to top

>ref|NM_121465.3| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT5G14610 mRNA, complete cds
          Length = 2661

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 565  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||||||||||| ||||||||  | ||||| || ||||| || |||||||||||
Sbjct: 1298 taccttgtgctggacgaggcagatagaatgctggacatggggttcgaacctcagat 1353



to top

>ref|XM_550287.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2864

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1356 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1399



to top

>ref|XM_550286.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2127

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 988  cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1031



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 577    gatgaggcagaccgtatgctcgatatgggttt 608
              ||||| || |||||||||||||||||||||||
Sbjct: 912330 gatgaagccgaccgtatgctcgatatgggttt 912361



to top

>gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete sequence
          Length = 184681

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 569 ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
           |||||||||||||||| || || ||||| |||||||||||
Sbjct: 152 ttgtgctggatgaggccgatcgcatgctagatatgggttt 113



to top

>ref|XM_426195.1| PREDICTED: Gallus gallus similar to DEAD (Asp-Glu-Ala-Asp) box
           polypeptide 43; DEAD-box protein 43 (LOC428637), mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 577 gatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           |||||||| ||| | ||||| |||||||| ||||||||||||||
Sbjct: 775 gatgaggctgacagaatgctggatatgggatttgaacctcagat 818



to top

>gb|BT012899.1| Lycopersicon esculentum clone 114007F, mRNA sequence
          Length = 2183

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            ||||| ||||| |||||||| || ||||| ||||||||||||||
Sbjct: 1052 gatgaagcagatcgtatgctggacatgggatttgaacctcagat 1095



to top

>ref|XM_757861.1| Theileria parva strain Muguga chromosome 3 ATP-dependent RNA helicase
            (TP03_0830) partial mRNA
          Length = 2262

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcggaaaatattag 634
            ||||||||||||| || ||||| || ||||| |||||||| || ||| |||||||  |||
Sbjct: 1531 tggatgaggcagatcggatgctagacatgggatttgaaccacaaattaggaaaatcgtag 1590

                    
Query: 635  cacaaatc 642
             |||||||
Sbjct: 1591 gacaaatc 1598



to top

>gb|AC144760.27| Medicago truncatula clone mth2-8p15, complete sequence
          Length = 108569

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 571   gtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcggaa 626
             ||||| || ||||||||| | ||||| || ||||||||||||||||| ||| ||||
Sbjct: 80826 gtgctagacgaggcagacaggatgctggacatgggttttgaacctcaaattaggaa 80881



to top

>emb|AL163792.1|ATT15N1 Arabidopsis thaliana DNA chromosome 5, BAC clone T15N1 (ESSA project)
          Length = 86574

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 565   taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
             |||||||||||||| ||||||||  | ||||| || ||||| || |||||||||||
Sbjct: 50358 taccttgtgctggacgaggcagatagaatgctggacatggggttcgaacctcagat 50413



to top

>gb|AC181983.2| Gallus gallus BAC clone CH261-63A17 from chromosome ul, complete
             sequence
          Length = 161905

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 577   gatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
             |||||||| ||| | ||||| |||||||| ||||||||||||||
Sbjct: 91909 gatgaggctgacagaatgctggatatgggatttgaacctcagat 91952



to top

>ref|NM_165103.2| Drosophila melanogaster vasa CG3506-RA (vas), mRNA
          Length = 2285

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 569  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1338 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1377



to top

>gb|AY084126.1| Drosophila melanogaster RE20606 full insert cDNA
          Length = 2252

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 569  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1333 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1372



to top

>gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
             BACR06I01, complete sequence
          Length = 175167

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 569   ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
             |||||||||||||||| || || ||||| |||||||||||
Sbjct: 27903 ttgtgctggatgaggccgatcgcatgctagatatgggttt 27942



to top

>gb|AE009543.1| Brucella melitensis 16M chromosome I, section 100 of 195 of the
            complete sequence
          Length = 14857

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 577  gatgaggcagaccgtatgctcgatatgggttt 608
            ||||| || |||||||||||||||||||||||
Sbjct: 6366 gatgaagccgaccgtatgctcgatatgggttt 6335



to top

>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0583G08
          Length = 135295

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 568    cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
              ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 123634 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 123591



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 577    gatgaggcagaccgtatgctcgatatgggttt 608
              ||||| || |||||||||||||||||||||||
Sbjct: 934021 gatgaagccgaccgtatgctcgatatgggttt 934052



to top

>ref|XM_320481.2| Anopheles gambiae str. PEST ENSANGP00000015773
           (ENSANGG00000013284), partial mRNA
          Length = 1587

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 562 acataccttgtgctggatgaggcagaccgtatgctcgatatggg 605
           |||||||| |||||||||||||| ||||| ||||| || |||||
Sbjct: 736 acatacctcgtgctggatgaggccgaccggatgctggacatggg 779



to top

>dbj|AK100326.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079L21, full
            insert sequence
          Length = 2864

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 611
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1356 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1399



to top

>gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55 of 83 of the complete
             sequence
          Length = 265413

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 569   ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
             |||||||||||||||| || || ||||| |||||||||||
Sbjct: 72956 ttgtgctggatgaggccgatcgcatgctagatatgggttt 72995



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 577    gatgaggcagaccgtatgctcgatatgggttt 608
              ||||| || |||||||||||||||||||||||
Sbjct: 931143 gatgaagccgaccgtatgctcgatatgggttt 931174



to top

>emb|X12946.1|DMVASA2 D.melanogaster vasa gene (exons 3 to 7)
          Length = 1904

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 569 ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
           |||||||||||||||| || || ||||| |||||||||||
Sbjct: 864 ttgtgctggatgaggccgatcgcatgctagatatgggttt 903



to top

>gb|M23560.1|DROVASA D.melanogaster antigen Mab46F11 (vasa) mRNA, complete cds
          Length = 2225

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 569  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 608
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1279 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1318



to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 575     tggatgaggcagaccgtatgctcgatatgggtttt 609
               |||||||||||||| | ||||| ||||||||||||
Sbjct: 2367638 tggatgaggcagacagaatgctggatatgggtttt 2367672



to top

>gb|BC063223.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA
           (cDNA clone MGC:76265 IMAGE:5379210), complete cds
          Length = 2192

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 562 acataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           ||||| || ||||||||||| || ||||| ||||| || ||||| ||||| ||||||||
Sbjct: 739 acatatctagtgctggatgaagctgaccggatgcttgacatgggctttgagcctcagat 797



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 445 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 504
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 622 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 681

                
Query: 505 acacc 509
           |||||
Sbjct: 682 acacc 686



to top

>gb|BT013678.1| Lycopersicon esculentum clone 132500R, mRNA sequence
          Length = 2534

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 580  gaggcagaccgtatgctcgatatgggttttgaacctcagattcggaaaata 630
            ||||| ||||| ||||| || ||||||||||||||||| ||  ||||||||
Sbjct: 1204 gaggctgaccggatgcttgacatgggttttgaacctcaaataaggaaaata 1254



to top

>ref|XM_856506.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 13 (LOC480886), mRNA
          Length = 4632

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1129 gatatgggttttgaacctcagat 1151



to top

>ref|XM_856475.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 12 (LOC480886), mRNA
          Length = 4623

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1120 gatatgggttttgaacctcagat 1142



to top

>ref|XM_856444.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 11 (LOC480886), mRNA
          Length = 4602

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1099 gatatgggttttgaacctcagat 1121



to top

>ref|XM_856419.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 10 (LOC480886), mRNA
          Length = 4584

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1147 gatatgggttttgaacctcagat 1169



to top

>ref|XM_856382.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 9 (LOC480886), mRNA
          Length = 4653

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1147 gatatgggttttgaacctcagat 1169



to top

>ref|XM_856356.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 8 (LOC480886), mRNA
          Length = 4430

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1147 gatatgggttttgaacctcagat 1169



to top

>ref|XM_856327.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
           X-chromosomal (Helicase-like protein 2) (HLP2)
           (DEAD-box, X isoform), transcript variant 7 (LOC480886),
           mRNA
          Length = 3918

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 598 gatatgggttttgaacctcagat 620
           |||||||||||||||||||||||
Sbjct: 415 gatatgggttttgaacctcagat 437



to top

>ref|XM_538003.2| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 1 (LOC480886), mRNA
          Length = 4801

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1366 gatatgggttttgaacctcagat 1388



to top

>ref|XM_856286.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 6 (LOC480886), mRNA
          Length = 4211

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1147 gatatgggttttgaacctcagat 1169



to top

>ref|XM_845289.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 2 (LOC480886), mRNA
          Length = 2192

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1147 gatatgggttttgaacctcagat 1169



to top

>ref|XM_856207.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 4 (LOC480886), mRNA
          Length = 2462

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1147 gatatgggttttgaacctcagat 1169



to top

>ref|XM_856175.1| PREDICTED: Canis familiaris similar to DEAD-box protein 3,
            X-chromosomal (Helicase-like protein 2) (HLP2) (DEAD-box,
            X isoform), transcript variant 3 (LOC480886), mRNA
          Length = 4869

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 598  gatatgggttttgaacctcagat 620
            |||||||||||||||||||||||
Sbjct: 1366 gatatgggttttgaacctcagat 1388



to top

>ref|XM_569125.1| Cryptococcus neoformans var. neoformans JEC21 pre-mRNA splicing
            factor (CNB01970) partial mRNA
          Length = 3219

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctca 617
            |||||||||| ||||| ||| | |||||||| |||||||||||
Sbjct: 1676 tggatgaggccgaccgaatgtttgatatgggctttgaacctca 1718



to top

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 575     tggatgaggcagaccgtatgctcgatatgggtttt 609
               |||||||||||||| | ||||| ||||||||||||
Sbjct: 2307879 tggatgaggcagacagaatgctggatatgggtttt 2307913



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 571     gtgctggatgaggcagaccgtatgctcgatatggg 605
               ||||||||||| |||||||| ||||| ||||||||
Sbjct: 3146658 gtgctggatgaagcagaccggatgctggatatggg 3146624



to top

>ref|NM_203898.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (ddx5),
           mRNA
          Length = 2192

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 562 acataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           ||||| || ||||||||||| || ||||| ||||| || ||||| ||||| ||||||||
Sbjct: 739 acatatctagtgctggatgaagctgaccggatgcttgacatgggctttgagcctcagat 797



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 445 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 504
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 622 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 681

                
Query: 505 acacc 509
           |||||
Sbjct: 682 acacc 686



to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 575    tggatgaggcagaccgtatgctcgatatgggttttgaacctca 617
              |||||||||| ||||| ||| | |||||||| |||||||||||
Sbjct: 575087 tggatgaggccgaccgaatgtttgatatgggctttgaacctca 575129



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 571    gtgctggatgaggcagaccgtatgctcgatatggg 605
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 387945 gtgctggatgaagcagaccgcatgctggatatggg 387911



to top

>dbj|AB169223.1| Macaca fascicularis testis cDNA, clone: QtsA-18104, similar to
           human DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5),
           mRNA, RefSeq: NM_004396.2
          Length = 2182

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 568 cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacc 614
           ||||| || ||||| |||||| | ||||| |||||||||||||||||
Sbjct: 737 cttgtccttgatgaagcagacagaatgcttgatatgggttttgaacc 783



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 602 tgtatctatggtggtgctcccaagggaccccaaatacgtga 642



to top

>dbj|AB169157.1| Macaca fascicularis testis cDNA, clone: QtsA-17658, similar to human
            DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5), mRNA,
            RefSeq: NM_004396.2
          Length = 2416

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 568  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacc 614
            ||||| || ||||| |||||| | ||||| |||||||||||||||||
Sbjct: 985  cttgtccttgatgaagcagacagaatgcttgatatgggttttgaacc 1031



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacgtga 473
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 850 tgtatctatggtggtgctcccaagggaccccaaatacgtga 890



to top

>dbj|AB080116.1| Mesocricetus auratus DBX mRNA for RNA helicase, complete cds
          Length = 1989

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||| || ||||| ||| | |||||||| |||||||||||||||||
Sbjct: 1039 gatgaagctgaccggatgttagatatggggtttgaacctcagattcg 1085



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 571     gtgctggatgaggcagaccgtatgctcgatatgggtttt 609
               |||||||||||||| |||||| |||| || |||||||||
Sbjct: 1177879 gtgctggatgaggctgaccgtttgctggagatgggtttt 1177917



to top

>emb|CR848548.2| Xenopus tropicalis finished cDNA, clone TEgg028e13
          Length = 2152

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 562 acataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           ||||| || ||||||||||| || ||||| ||||| || ||||| ||||| ||||||||
Sbjct: 748 acatatctagtgctggatgaagctgaccggatgcttgacatgggctttgagcctcagat 806



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 445 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 504
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 631 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 690

                
Query: 505 acacc 509
           |||||
Sbjct: 691 acacc 695



to top

>gb|BC086320.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone IMAGE:6466882), partial cds
          Length = 2275

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 519 actggatctgggaaaacattatctta 544



to top

>ref|NM_001016781.2| Xenopus tropicalis hypothetical protein LOC549535 (LOC549535), mRNA
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 565 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
           ||||||||||| ||||| || ||  | ||||| || |||||||||||||| ||||| || 
Sbjct: 836 taccttgtgctagatgaagctgatagaatgcttgacatgggttttgaaccacagatccgc 895

                 
Query: 625 aaaata 630
           ||||||
Sbjct: 896 aaaata 901



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacg 470
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC084159.1| Xenopus tropicalis cDNA clone IMAGE:7016603
          Length = 4542

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 565 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
           ||||||||||| ||||| || ||  | ||||| || |||||||||||||| ||||| || 
Sbjct: 836 taccttgtgctagatgaagctgatagaatgcttgacatgggttttgaaccacagatccgc 895

                 
Query: 625 aaaata 630
           ||||||
Sbjct: 896 aaaata 901



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacg 470
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC080992.1| Xenopus laevis hypothetical protein LOC398649, mRNA (cDNA clone
           MGC:80019 IMAGE:3401294), complete cds
          Length = 2818

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacg 470
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 672 tgtatctatggtggggctcctaaaggaccacaaatacg 709



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 577     gatgaggcagaccgtatgctcgatatgggttttg 610
               ||||| || ||||||||||| |||||||||||||
Sbjct: 1292737 gatgaagctgaccgtatgctagatatgggttttg 1292770



to top

>ref|NM_007840.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (Ddx5), mRNA
          Length = 3521

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|BC054236.1| Xenopus laevis hypothetical protein LOC398649, mRNA (cDNA clone
           IMAGE:6880238), partial cds
          Length = 1336

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacg 470
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 651 tgtatctatggtggggctcctaaaggaccacaaatacg 688



to top

>gb|BC062916.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone IMAGE:6827275), partial cds
          Length = 3645

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 581 actggatctgggaaaacattatctta 606



to top

>ref|XM_806839.1| Trypanosoma cruzi strain CL Brener ATP-dependent RNA helicase
           (Tc00.1047053506213.120) partial mRNA
          Length = 1896

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 574 ctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
           ||||||||||| || || ||||| || ||||||||||| || ||||||||
Sbjct: 865 ctggatgaggctgatcgcatgcttgacatgggttttgagccacagattcg 914



to top

>ref|XM_946895.1| Theileria annulata strain Ankara ATP-dependent RNA helicase
           (TA14795) partial mRNA
          Length = 1368

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 346 ttgatccttgctccaacaagagaact 371
           ||||||||||||||||| ||||||||
Sbjct: 337 ttgatccttgctccaactagagaact 362



to top

>gb|AC136842.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0085C16, complete sequence
          Length = 156069

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 577    gatgaggcagaccgtatgctcgatatgggttttgaacc 614
              |||||||||||  | ||||| |||||||||||||||||
Sbjct: 135169 gatgaggcagatagaatgcttgatatgggttttgaacc 135206



to top

>emb|X65627.1|MMHELI M.musculus mRNA TNZ2 for p68 RNA helicase
          Length = 2318

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 578 actggatctgggaaaacattatctta 603



to top

>dbj|AK129022.1| Mus musculus cDNA fis, clone TRACH3036683, highly similar to
           Probable RNA-dependent helicase p68
          Length = 3602

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 596 actggatctgggaaaacattatctta 621



to top

>gb|AF479821.1| Hyphessobrycon ecuadoriensis DEAD box RNA helicase Vasa mRNA,
           complete cds
          Length = 1730

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 574 ctggatgaggcagaccgtatgctcgatatgggttttga 611
           ||||||||||| || ||||||||||| ||||| |||||
Sbjct: 349 ctggatgaggctgatcgtatgctcgacatgggatttga 386



to top

>dbj|AK132779.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4922505M03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 2375

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 643 actggatctgggaaaacattatctta 668



to top

>dbj|AK135173.1| Mus musculus 12 days embryo female ovary cDNA, RIKEN full-length
           enriched library, clone:6620402N06 product:DEAD
           (Asp-Glu-Ala-Asp) box polypeptide 5, full insert
           sequence
          Length = 3522

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>dbj|AK166698.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0003N03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 2461

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 729 actggatctgggaaaacattatctta 754



to top

>dbj|AK166045.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730030M03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 3521

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0043E10, complete sequence
          Length = 124591

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 577   gatgaggcagaccgtatgctcgatatgggttttgaacc 614
             |||||||||||  | ||||| |||||||||||||||||
Sbjct: 97495 gatgaggcagatagaatgcttgatatgggttttgaacc 97458



to top

>dbj|AK088887.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029P14
           product:DEAD (aspartate-glutamate-alanine-aspartate) box
           polypeptide 5, full insert sequence
          Length = 2329

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|DQ336393.1| Elephas maximus DEAD/H box polypeptide (DBY) gene, partial sequence
          Length = 458

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 358 ccaacaagagaactggctgttcaaat 383
           |||||||||||||||||||| |||||
Sbjct: 284 ccaacaagagaactggctgtacaaat 309



to top

>dbj|AK044792.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
           clone:A930106P08 product:DEAD
           (aspartate-glutamate-alanine-aspartate) box polypeptide
           5, full insert sequence
          Length = 2329

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 596 actggatctgggaaaacattatctta 621



to top

>dbj|AK076018.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610035N22 product:DEAD
           (aspartate-glutamate-alanine-aspartate) box polypeptide
           5, full insert sequence
          Length = 2338

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 598 actggatctgggaaaacattatctta 623



to top

>ref|XM_392069.2| PREDICTED: Apis mellifera similar to ENSANGP00000017814 (LOC408524),
            mRNA
          Length = 2743

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaa 612
            ||||||| || || |||||| |||||||||||||||||
Sbjct: 1778 tggatgaagcggatcgtatgatcgatatgggttttgaa 1815



to top

>ref|NM_001007613.1| Rattus norvegicus ddx5 gene (Ddx5), mRNA
          Length = 2508

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 648 actggatctgggaaaacattatctta 673



to top

>gb|BC079036.1| Rattus norvegicus ddx5 gene, mRNA (cDNA clone MGC:93965
           IMAGE:7114313), complete cds
          Length = 2508

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 648 actggatctgggaaaacattatctta 673



to top

>emb|AJ010940.1|RNO010940 Rattus norvegicus ddx5-ps1 pseudogene, partial
          Length = 336

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 264 actggatctgggaaaacattatctta 289



to top

>emb|CR855694.2| Xenopus tropicalis finished cDNA, clone TGas068f07
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 565 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcgg 624
           ||||||||||| ||||| || ||  | ||||| || |||||||||||||| ||||| || 
Sbjct: 836 taccttgtgctagatgaagctgatagaatgcttgacatgggttttgaaccacagatccgc 895

                 
Query: 625 aaaata 630
           ||||||
Sbjct: 896 aaaata 901



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 433 tgtatctacggtggagcacctaagggaccacaaatacg 470
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC046554.1| Mus musculus cDNA clone IMAGE:4973650
          Length = 2321

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 574 actggatctgggaaaacattatctta 599



to top

>gb|BC108369.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:118083 IMAGE:6312791), complete cds
          Length = 2236

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 253 actggatctgggaaaacactatctta 278
           |||||||||||||||||| |||||||
Sbjct: 441 actggatctgggaaaacattatctta 466



to top

>ref|NM_202726.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT3G58510 transcript variant
            AT3G58510.2 mRNA, complete cds
          Length = 2508

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
            |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 1266 gatgaggcagacaggatgctggacatgggttttgagccacagatt 1310



to top

>ref|NM_001035807.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT3G58510 transcript variant
            AT3G58510.3 mRNA, complete cds
          Length = 2438

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
            |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 1196 gatgaggcagacaggatgctggacatgggttttgagccacagatt 1240



to top

>ref|NM_115713.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT3G58510 transcript variant
            AT3G58510.1 mRNA, complete cds
          Length = 2348

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
            |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 1106 gatgaggcagacaggatgctggacatgggttttgagccacagatt 1150



to top

>gb|AC149403.2| Phakopsora pachyrhizi clone JGIAFNA-61H19, complete sequence
          Length = 36597

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 331   gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 383
             |||||||| ||||| |||||| | || || ||| | |||||||||||||||||
Sbjct: 23701 gatggccctattgtattgatcttagcacccacacgggaactggctgttcaaat 23649



to top

>gb|AY391418.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5) mRNA,
           complete cds
          Length = 2482

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 184 ccaacgcctatccaagctcagggttggcc 212
           ||||| ||||||||||||||||| |||||
Sbjct: 417 ccaacccctatccaagctcaggggtggcc 445



to top

>ref|XM_633858.1| Dictyostelium discoideum hypothetical protein (DDB0185613), partial
            mRNA
          Length = 2139

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||||| || || |||||| | ||||||||||||||||| || |||||
Sbjct: 1229 tggatgaagctgatcgtatgttagatatgggttttgaaccacaaattcg 1277



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 580     gaggcagaccgtatgctcgatatgggttt 608
               ||||||||||| |||||||| ||||||||
Sbjct: 3430699 gaggcagaccggatgctcgacatgggttt 3430727



to top

>ref|XM_629763.1| Dictyostelium discoideum hypothetical protein (DDB0184159), partial
            mRNA
          Length = 2334

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 489  tgaaatcgtcattgcaacaccaggtcggttgattgat 525
            ||||||| ||||||||||||| ||||| ||| |||||
Sbjct: 1314 tgaaatcatcattgcaacaccgggtcgtttggttgat 1350



to top

>ref|NM_004660.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
            (DDX3Y), mRNA
          Length = 4416

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 592  atgctcgatatgggttttgaacctcagat 620
            ||||| |||||||| ||||||||||||||
Sbjct: 1119 atgctggatatgggatttgaacctcagat 1147



to top

>ref|NM_212612.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (ddx5), mRNA
          Length = 2482

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 184 ccaacgcctatccaagctcagggttggcc 212
           ||||| ||||||||||||||||| |||||
Sbjct: 417 ccaacccctatccaagctcaggggtggcc 445



to top

>gb|BC082849.1| Xenopus laevis p68 RNA helicase, mRNA (cDNA clone MGC:81559
           IMAGE:6862986), complete cds
          Length = 2177

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 481 agaggagttgaaatcgtcattgcaacacc 509
           |||||||||||||||  ||||||||||||
Sbjct: 679 agaggagttgaaatctgcattgcaacacc 707



to top

>gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 section 10 of 16 of the
              complete genome
          Length = 290294

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 574    ctggatgaggcagaccgtatgctcgatatgggttttg 610
              |||||||| || ||||||||||| || ||||||||||
Sbjct: 168361 ctggatgaagctgaccgtatgctggacatgggttttg 168325



to top

>ref|XM_361961.1| Magnaporthe grisea 70-15 hypothetical protein (MG04406.4) partial cds
          Length = 7962

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 250  gaaactggatctgggaaaaca 270
            |||||||||||||||||||||
Sbjct: 1288 gaaactggatctgggaaaaca 1308



to top

>gb|DQ441593.1| Odontesthes hatcheri vasa-like protein mRNA, partial cds
          Length = 287

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 571 gtgctggatgaggcagaccgtatgctcgatatgggttttga 611
           ||||||||||| ||||| || ||| | ||||||||||||||
Sbjct: 192 gtgctggatgaagcagatcgcatgttggatatgggttttga 232



to top

>gb|AY633112.1| Pan troglodytes DDX3Y mRNA, complete cds
          Length = 2028

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 592  atgctcgatatgggttttgaacctcagat 620
            ||||| |||||||| ||||||||||||||
Sbjct: 1054 atgctggatatgggatttgaacctcagat 1082



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 574     ctggatgaggcagaccgtatgctcgatatgggttttg 610
               |||||||| || ||||||||||| || ||||||||||
Sbjct: 1430731 ctggatgaagctgaccgtatgctggacatgggttttg 1430695



to top

>ref|XM_456137.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F23716g predicted mRNA
          Length = 1665

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 327 aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 383
           ||||||||| |||||||| ||| |  | |||||||| |||||| | |||||||||||
Sbjct: 549 aggtgatggtccaattgttttggtattggctccaaccagagaattagctgttcaaat 605



to top

>gb|BC067585.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:85704 IMAGE:6963939), complete cds
          Length = 2245

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 184 ccaacgcctatccaagctcagggttggcc 212
           ||||| ||||||||||||||||| |||||
Sbjct: 438 ccaacccctatccaagctcaggggtggcc 466



to top

>gb|AC165060.2| Phakopsora pachyrhizi clone JGIAFNA-205B5, complete sequence
          Length = 44829

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 331   gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 383
             |||||||| ||||| |||||| | || || ||| | |||||||||||||||||
Sbjct: 20583 gatggccctattgtattgatcttagcacccacacgggaactggctgttcaaat 20635



to top

>ref|XM_981517.1| PREDICTED: Mus musculus DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 3, X-linked (Ddx3x), mRNA
          Length = 4309

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 564 ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
           |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 789 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 845



to top

>gb|BC085914.1| Rattus norvegicus DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3,
            X-linked, mRNA (cDNA clone IMAGE:7107275)
          Length = 4652

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 564  ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 1183 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 1239



to top

>gb|AF025536.1| Schizosaccharomyces pombe suppressor of uncontrolled mitosis (sum3)
            mRNA, complete cds
          Length = 2062

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||||| || || |||||||| ||||||||||| || ||||| |||||
Sbjct: 1037 tggatgaagctgatcgtatgctggatatgggtttcgagcctcaaattcg 1085



to top

>gb|BC047981.1| Xenopus laevis similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 5 (RNA helicase, 68kDa), mRNA (cDNA clone
           MGC:53795 IMAGE:5541855), complete cds
          Length = 2158

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 481 agaggagttgaaatcgtcattgcaacacc 509
           |||||||||||||||  ||||||||||||
Sbjct: 663 agaggagttgaaatctgcattgcaacacc 691



to top

>gb|AC146254.2| Pan troglodytes BAC clone CH251-128L22 from Y, complete sequence
          Length = 177240

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 592   atgctcgatatgggttttgaacctcagat 620
             ||||| |||||||| ||||||||||||||
Sbjct: 48240 atgctggatatgggatttgaacctcagat 48212



to top

>ref|XM_719206.1| Plasmodium yoelii yoelii str. 17XNL U5 snRNP 100 kD protein (PY04051)
            partial mRNA
          Length = 2904

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 238  attggtattgcagaaactggatctgggaaaaca 270
            ||||| ||||| |||||||||||||| ||||||
Sbjct: 1750 attggaattgctgaaactggatctggaaaaaca 1782



to top

>gb|AC146760.13| Medicago truncatula clone mth2-174d3, complete sequence
          Length = 122316

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                           
Query: 577    gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
              |||||||||||  | ||||| |||||||||||||| || ||||||
Sbjct: 117103 gatgaggcagataggatgcttgatatgggttttgagccacagatt 117147



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 577     gatgaggcagaccgtatgctcgatatggg 605
               ||||| |||||||| ||||||||||||||
Sbjct: 1814632 gatgaagcagaccgcatgctcgatatggg 1814604



to top

>emb|Z71388.1|SCYNL112W S.cerevisiae chromosome XIV reading frame ORF YNL112w
          Length = 3740

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 355  gctccaacaagagaactggctgttcaaat 383
            |||||||| |||||| |||||||||||||
Sbjct: 1016 gctccaactagagaattggctgttcaaat 1044



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 598  gatatgggttttgaacctca 617
            ||||||||||||||||||||
Sbjct: 1259 gatatgggttttgaacctca 1278



to top

>emb|Z69382.1|SCCXIV38K S.cerevisiae 37,800 bp segment of chromosome XIV
          Length = 37800

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 355   gctccaacaagagaactggctgttcaaat 383
             |||||||| |||||| |||||||||||||
Sbjct: 30156 gctccaactagagaattggctgttcaaat 30184



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 598   gatatgggttttgaacctca 617
             ||||||||||||||||||||
Sbjct: 30399 gatatgggttttgaacctca 30418



to top

>emb|Z38117.1|MMDBRNAHL M.musculus mRNA for dead-box RNA helicase
          Length = 3185

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 564  ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 1101 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 1157



to top

>emb|X52649.1|SCP68 S.cerevisiae p68 gene
          Length = 2733

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 355 gctccaacaagagaactggctgttcaaat 383
           |||||||| |||||| |||||||||||||
Sbjct: 637 gctccaactagagaattggctgttcaaat 665



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 598 gatatgggttttgaacctca 617
           ||||||||||||||||||||
Sbjct: 880 gatatgggttttgaacctca 899



to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 577     gatgaggcagaccgtatgctcgatatgggtttt 609
               |||||||||||| | ||||| ||||||||||||
Sbjct: 2284659 gatgaggcagacagaatgctggatatgggtttt 2284691



to top

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 577     gatgaggcagaccgtatgctcgatatggg 605
               ||||| |||||||||||||| ||||||||
Sbjct: 2788064 gatgaagcagaccgtatgcttgatatggg 2788036



to top

>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2602197

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                        
Query: 327     aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 383
               ||||||||| |||||||| ||| |  | |||||||| |||||| | |||||||||||
Sbjct: 2217581 aggtgatggtccaattgttttggtattggctccaaccagagaattagctgttcaaat 2217525



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                    
Query: 574     ctggatgaggcagaccgtatgctcgatatgggttttg 610
               |||||||| || ||||||||||| || ||||||||||
Sbjct: 3431694 ctggatgaagctgaccgtatgctggacatgggttttg 3431730



to top

>emb|AL137082.1|ATF14P22 Arabidopsis thaliana DNA chromosome 3, BAC clone F14P22
          Length = 94239

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 577   gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
             |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 35518 gatgaggcagacaggatgctggacatgggttttgagccacagatt 35562



to top

>emb|AL022598.2|SPCC1795 S.pombe chromosome III cosmid c1795
          Length = 34564

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 575   tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
             ||||||| || || |||||||| ||||||||||| || ||||| |||||
Sbjct: 12334 tggatgaagctgatcgtatgctggatatgggtttcgagcctcaaattcg 12286



to top

>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20
          Length = 258050

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 574    ctggatgaggcagaccgtatgctcgatatgggttttg 610
              |||||||| || ||||||||||| || ||||||||||
Sbjct: 122801 ctggatgaagctgaccgtatgctggacatgggttttg 122765



to top

>emb|AJ237697.1|SPO237697 Schizosaccharomyces pombe mRNA for putative RNA helicase ded1 gene
          Length = 2732

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||||| || || |||||||| ||||||||||| || ||||| |||||
Sbjct: 1053 tggatgaagctgatcgtatgctggatatgggtttcgagcctcaaattcg 1101



to top

>emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in linkage group 3,
             complete sequence
          Length = 154312

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 184   ccaacgcctatccaagctcagggttggcc 212
             ||||| ||||||||||||||||| |||||
Sbjct: 58048 ccaacccctatccaagctcaggggtggcc 58020



to top

>gb|BC034942.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked, mRNA
            (cDNA clone MGC:25989 IMAGE:4826417), complete cds
          Length = 2713

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 592  atgctcgatatgggttttgaacctcagat 620
            ||||| |||||||| ||||||||||||||
Sbjct: 1357 atgctggatatgggatttgaacctcagat 1385



to top

>emb|CR857318.1| Pongo pygmaeus mRNA; cDNA DKFZp469G1332 (from clone DKFZp469G1332)
          Length = 2455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 592  atgctcgatatgggttttgaacctcagat 620
            ||||| |||||||| ||||||||||||||
Sbjct: 1107 atgctggatatgggatttgaacctcagat 1135



to top

>dbj|BS000629.2| Pan troglodytes chromosome Y clone: PTB-194O02, complete sequence
          Length = 184689

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 592    atgctcgatatgggttttgaacctcagat 620
              ||||| |||||||| ||||||||||||||
Sbjct: 113882 atgctggatatgggatttgaacctcagat 113854



to top

>dbj|BS000552.1| Pan troglodytes chromosome Y clone:PTB-302F24, complete sequences
          Length = 157728

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 592   atgctcgatatgggttttgaacctcagat 620
             ||||| |||||||| ||||||||||||||
Sbjct: 96212 atgctggatatgggatttgaacctcagat 96240



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 592      atgctcgatatgggttttgaacctcagat 620
                ||||| |||||||| ||||||||||||||
Sbjct: 18027819 atgctggatatgggatttgaacctcagat 18027847



to top

>gb|AY114637.1| Arabidopsis thaliana ATP-dependent RNA helicase-like protein
           (At3g58510) mRNA, complete cds
          Length = 1296

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 577 gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
           |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 355 gatgaggcagacaggatgctggacatgggttttgagccacagatt 399



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                           
Query: 520     attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 579
               ||||||||||| || ||||| | ||| ||||| || || || || |||||||| || || 
Sbjct: 1421874 attgatatgctcgaggctggccgcactaacctccgccgtgtcacttaccttgttcttgac 1421933

                                            
Query: 580     gaggcagaccgtatgctcgatatgggttt 608
               ||||| ||||| ||||| || ||||||||
Sbjct: 1421934 gaggccgaccgcatgctggacatgggttt 1421962



to top

>gb|AY062446.1| Arabidopsis thaliana ATP-dependent RNA helicase-like protein
           (At3g58510; F14P22.100) mRNA, complete cds
          Length = 1856

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 577 gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
           |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 613 gatgaggcagacaggatgctggacatgggttttgagccacagatt 657



to top

>dbj|AK163250.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
            clone:B020006B14 product:DEAD/H (Asp-Glu-Ala-Asp/His) box
            polypeptide 3, X-linked, full insert sequence
          Length = 2954

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 564  ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 1092 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 1148



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 80      tcaccgtggagggccgggaggtgcc 104
               ||||||||||||||||| |||||||
Sbjct: 2793394 tcaccgtggagggccggcaggtgcc 2793418



to top

>gb|AY541738.1| Microtus agrestis isolate ExDBYsorknord DBY gene, partial sequence
          Length = 298

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 592 atgctcgatatgggttttgaacctcagat 620
           ||||| |||||||| ||||||||||||||
Sbjct: 28  atgctagatatgggatttgaacctcagat 56



to top

>gb|AY541715.1| Microtus agrestis isolate ExDBYsorksyd DBY gene, partial sequence
          Length = 298

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 592 atgctcgatatgggttttgaacctcagat 620
           ||||| |||||||| ||||||||||||||
Sbjct: 28  atgctagatatgggatttgaacctcagat 56



to top

>dbj|AK140990.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130093B14 product:DEAD/H
            (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked, full
            insert sequence
          Length = 3203

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 564  ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 1118 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 1174



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 569     ttgtgctggatgaggcagaccgtatgctcgatatggg 605
               |||| ||||| || |||||||||||||| ||||||||
Sbjct: 2372992 ttgttctggacgaagcagaccgtatgcttgatatggg 2372956



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 574     ctggatgaggcagaccgtatgctcgatatggg 605
               ||||| || |||||||||||||| ||||||||
Sbjct: 1026523 ctggacgaagcagaccgtatgcttgatatggg 1026492



to top

>ref|NM_001023025.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPCC1795.11),
            partial mRNA
          Length = 1911

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 575  tggatgaggcagaccgtatgctcgatatgggttttgaacctcagattcg 623
            ||||||| || || |||||||| ||||||||||| || ||||| |||||
Sbjct: 1004 tggatgaagctgatcgtatgctggatatgggtttcgagcctcaaattcg 1052



to top

>gb|AF218580.1|AF218580 Xenopus laevis p68 RNA helicase mRNA, complete cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 481 agaggagttgaaatcgtcattgcaacacc 509
           |||||||||||||||  ||||||||||||
Sbjct: 705 agaggagttgaaatctgcattgcaacacc 733



to top

>ref|NM_065859.3| Caenorhabditis elegans F01F1.7 (F01F1.7) mRNA, complete cds
          Length = 2282

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 487  gttgaaatcgtcattgcaacaccaggtcg 515
            |||||| | ||||||||||||||||||||
Sbjct: 1286 gttgaagtggtcattgcaacaccaggtcg 1314



to top

>emb|BX823918.1|CNS0A4PV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS92ZB07 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2476

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
            |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 1269 gatgaggcagacaggatgctggacatgggttttgagccacagatt 1313



to top

>ref|NM_001008986.1| Pan troglodytes DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
            (DDX3Y), mRNA
          Length = 2028

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 592  atgctcgatatgggttttgaacctcagat 620
            ||||| |||||||| ||||||||||||||
Sbjct: 1054 atgctggatatgggatttgaacctcagat 1082



to top

>ref|XM_228701.3| PREDICTED: Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box polypeptide
            3, X-linked (Ddx3x), mRNA
          Length = 2481

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 564  ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
            |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 1263 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 1319



to top

>gb|AY088091.1| Arabidopsis thaliana clone 41181 mRNA, complete sequence
          Length = 2348

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 577  gatgaggcagaccgtatgctcgatatgggttttgaacctcagatt 621
            |||||||||||| | ||||| || ||||||||||| || ||||||
Sbjct: 1106 gatgaggcagacaggatgctggacatgggttttgagccacagatt 1150



to top

>gb|AY960203.1| Odontesthes bonariensis Vasa-like protein mRNA, partial cds
          Length = 287

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 571 gtgctggatgaggcagaccgtatgctcgatatgggttttga 611
           ||||||||||| ||||| || ||| | ||||||||||||||
Sbjct: 192 gtgctggatgaagcagatcgcatgttggatatgggttttga 232



to top

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 577     gatgaggcagaccgtatgctcgatatggg 605
               ||||| |||||||||||||| ||||||||
Sbjct: 2673286 gatgaagcagaccgtatgcttgatatggg 2673258



to top

>dbj|AB051835.1| Oreochromis niloticus vas-s mRNA for vasa short form, complete cds
          Length = 2058

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 571  gtgctggatgaggcagaccgtatgctcgatatgggttttga 611
            |||||||||||||| ||||| ||| | |||||||| |||||
Sbjct: 1062 gtgctggatgaggctgaccgcatgttggatatggggtttga 1102



to top

>dbj|AB032467.1| Oreochromis niloticus mRNA for vasa, complete cds
          Length = 2130

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 571  gtgctggatgaggcagaccgtatgctcgatatgggttttga 611
            |||||||||||||| ||||| ||| | |||||||| |||||
Sbjct: 1134 gtgctggatgaggctgaccgcatgttggatatggggtttga 1174



to top

>emb|AL833805.11| Mouse DNA sequence from clone RP23-158L19 on chromosome X, complete
             sequence
          Length = 118691

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 564   ataccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaacctcagat 620
             |||||| ||| | ||||| || ||||| ||| | |||||||| ||||||||||||||
Sbjct: 98821 atacctggtgttagatgaagctgaccggatgttagatatggggtttgaacctcagat 98877



to top

>emb|BX085195.5| Zebrafish DNA sequence from clone DKEY-226A5 in linkage group 3, complete
              sequence
          Length = 227111

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 184    ccaacgcctatccaagctcagggttggcc 212
              ||||| ||||||||||||||||| |||||
Sbjct: 155137 ccaacccctatccaagctcaggggtggcc 155165


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,520,738
Number of Sequences: 3902068
Number of extensions: 4520738
Number of successful extensions: 102487
Number of sequences better than 10.0: 348
Number of HSP's better than 10.0 without gapping: 352
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 101014
Number of HSP's gapped (non-prelim): 1457
length of query: 644
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 621
effective length of database: 17,143,297,704
effective search space: 10645987874184
effective search space used: 10645987874184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top