ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal2o22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_472987.1| Oryza sativa (japonica cultivar-group), predic... 329 4e-87
2dbj|AK105071.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 4e-87
3dbj|AK066522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 4e-87
4dbj|AK104854.1| Oryza sativa (japonica cultivar-group) cDNA clon... 321 1e-84
5emb|AL731617.3|OSJN00261 Oryza sativa genomic DNA, chromosome 4,... 153 6e-34
6dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 153 6e-34
7emb|AL606613.3|OSJN00051 Oryza sativa genomic DNA, chromosome 4,... 153 6e-34
8gb|AY484589.1| Musa acuminata clone MuH9, genomic sequence 72 2e-09
9gb|AC147179.15| Medicago truncatula clone mth2-142n19, complete ... 46 0.094
10emb|CR450824.9| Zebrafish DNA sequence from clone CH211-147F12 i... 44 0.37
11gb|AC124761.4| Mus musculus BAC clone RP23-142G18 from 6, comple... 44 0.37
12gb|AC122353.5| Mus musculus BAC clone RP23-391E17 from chromosom... 42 1.5
13gb|AC068762.15| Homo sapiens 3 BAC RP11-215N17 (Roswell Park Can... 42 1.5
14dbj|BS000238.1| Pan troglodytes chromosome 22 clone:PTB-016O01, ... 42 1.5
15emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-1... 42 1.5
16dbj|AP001752.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 1.5
17gb|AC124235.11| Mus musculus chromosome 13, clone RP23-273G24, c... 42 1.5
18dbj|AP001052.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 42 1.5
19ref|NM_123027.2| Arabidopsis thaliana catalytic/ hydrolase/ phos... 40 5.8
20ref|NM_124150.2| Arabidopsis thaliana ATPK5; phosphoglycolate ph... 40 5.8
21ref|NM_123037.2| Arabidopsis thaliana catalytic/ hydrolase/ phos... 40 5.8
22gb|AF019413.1|HSMHCT8S22 Homo sapiens HLA class III region conta... 40 5.8
23gb|AC004236.1| Homo sapiens chromosome 1, BAC clone 174p12 (LBNL... 40 5.8
24gb|AC164418.10| Mus musculus chromosome 1, clone RP23-431J24, co... 40 5.8
25gb|AC119842.9| Mus musculus chromosome 1, clone RP23-277F23, com... 40 5.8
26gb|AC110177.19| Mus musculus chromosome 1, clone RP24-245K23, co... 40 5.8
27emb|AJ868436.1| Sodalis glossinidius pSG2 plasmid from Glossina ... 40 5.8
28emb|AJ868435.1| Sodalis glossinidius pSG2 plasmid from Glossina ... 40 5.8
29emb|CR385066.13| Zebrafish DNA sequence from clone DKEY-220L23 i... 40 5.8
30gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, co... 40 5.8
31ref|XM_808839.1| Trypanosoma cruzi strain CL Brener lectin (Tc00... 40 5.8
32gb|AC107959.8| Homo sapiens chromosome 8, clone RP11-875O11, com... 40 5.8
33gb|AY224378.1| Homo sapiens Tosi C4 gene, exon 9 and partial cds... 40 5.8
34gb|AY224377.1| Trachypithecus cristatus DJ.1 C4 gene, exon 9 and... 40 5.8
35gb|AY224376.1| Presbytis melalophos DJ.36 C4 gene, exon 9 and pa... 40 5.8
36gb|AY224375.1| Mandrillus sphinx Mandrill.1119 C4 gene, exon 9 a... 40 5.8
37gb|AY224374.1| Theropithecus gelada 891096 C4 gene, exon 9 and p... 40 5.8
38gb|AY224373.1| Papio hamadryas 73-347 C4 gene, exon 9 and partia... 40 5.8
39gb|AY224372.1| Macaca tonkeana PM604.H.clade C4 gene, exon 9 and... 40 5.8
40gb|AY224371.1| Macaca tonkeana PM558.N.clade C4 gene, exon 9 and... 40 5.8
41gb|AY224370.1| Macaca thibetana Sich.KIZ C4 gene, exon 9 and par... 40 5.8
42gb|AY224369.1| Macaca thibetana 587041 C4 gene, exon 9 and parti... 40 5.8
43gb|AY224368.1| Macaca sylvanus 1076 C4 gene, exon 9 and partial ... 40 5.8
44gb|AY224367.1| Macaca sylvanus 201 C4 gene, exon 9 and partial c... 40 5.8
45gb|AY224366.1| Macaca sinica 985 C4 gene, exon 9 and partial cds... 40 5.8
46gb|AY224365.1| Macaca sinica 716 C4 gene, exon 9 and partial cds... 40 5.8
47gb|AY224364.1| Macaca silenus 20382 C4 gene, exon 9 and partial ... 40 5.8
48gb|AY224363.1| Macaca silenus 108806 C4 gene, exon 9 and partial... 40 5.8
49gb|AY224362.1| Macaca radiata 3033 C4 gene, exon 9 and partial c... 40 5.8
50gb|AY224361.1| Macaca radiata 3028 C4 gene, exon 9 and partial c... 40 5.8
51gb|AY224360.1| Macaca ochreata Greyarm C4 gene, exon 9 and parti... 40 5.8
52gb|AY224359.1| Macaca nigrescens 101 C4 gene, exon 9 and partial... 40 5.8
53gb|AY224358.1| Macaca nigra PM661 C4 gene, exon 9 and partial cd... 40 5.8
54gb|AY224357.1| Macaca nemestrina pagensis.955 C4 gene, exon 9 an... 40 5.8
55gb|AY224356.1| Macaca nemestrina pagensis.820 C4 gene, exon 9 an... 40 5.8
56gb|AY224355.1| Macaca nemestrina PM665.E.Borneo C4 gene, exon 9 ... 40 5.8
57gb|AY224354.1| Macaca nemestrina SUKA.NE.Borneo C4 gene, exon 9 ... 40 5.8
58gb|AY224353.1| Macaca nemestrina Thai.1A C4 gene, exon 9 and par... 40 5.8
59gb|AY224352.1| Macaca nemestrina #12.KIZ.17 C4 gene, exon 9 and ... 40 5.8
60gb|AY224351.1| Macaca nemestrina #1.KIZ.2 C4 gene, exon 9 and pa... 40 5.8
61gb|AY224350.1| Macaca mulatta China.20156 C4 gene, exon 9 and pa... 40 5.8
62gb|AY224349.1| Macaca mulatta Burma.23269 C4 gene, exon 9 and pa... 40 5.8
63gb|AY224348.1| Macaca mulatta 16805 C4 gene, exon 9 and partial ... 40 5.8
64gb|AY224347.1| Macaca mulatta India.92B.560 C4 gene, exon 9 and ... 40 5.8
65gb|AY224346.1| Macaca maura PM616 C4 gene, exon 9 and partial cd... 40 5.8
66gb|AY224345.1| Macaca hecki 1 C4 gene, exon 9 and partial cds; a... 40 5.8
67gb|AY224344.1| Macaca fuscata 22086 C4 gene, exon 9 and partial ... 40 5.8
68gb|AY224343.1| Macaca fuscata 22082 C4 gene, exon 9 and partial ... 40 5.8
69gb|AY224342.1| Macaca fuscata 13751 C4 gene, exon 9 and partial ... 40 5.8
70gb|AY224341.1| Macaca fascicularis C4 gene, exon 9 and partial c... 40 5.8
71gb|AY224340.1| Macaca fascicularis Java.34 C4 gene, exon 9 and p... 40 5.8
72gb|AY224339.1| Macaca fascicularis Borneo.PM.666 C4 gene, exon 9... 40 5.8
73gb|AY224338.1| Macaca fascicularis Sepilok C4 gene, exon 9 and p... 40 5.8
74gb|AY224337.1| Macaca fascicularis Sarawak C4 gene, exon 9 and p... 40 5.8
75gb|AY224336.1| Macaca fascicularis DM2687 C4 gene, exon 9 and pa... 40 5.8
76gb|AY224335.1| Macaca fascicularis UKM.004 C4 gene, exon 9 and p... 40 5.8
77gb|AY224334.1| Macaca fascicularis Johor.DJ.95 C4 gene, exon 9 a... 40 5.8
78gb|AY224333.1| Macaca fascicularis #3 C4 gene, exon 9 and partia... 40 5.8
79gb|AY224332.1| Macaca fascicularis Vietnam.290.WB C4 gene, exon ... 40 5.8
80gb|AY224331.1| Macaca cyclopis #1 C4 gene, exon 9 and partial cd... 40 5.8
81gb|AY224330.1| Macaca cyclopis 2682 C4 gene, exon 9 and partial ... 40 5.8
82gb|AY224329.1| Macaca brunnescens #3 C4 gene, exon 9 and partial... 40 5.8
83gb|AY224328.1| Macaca assamensis 89019 C4 gene, exon 9 and parti... 40 5.8
84gb|AY224327.1| Macaca assamensis 1.KIZ.B C4 gene, exon 9 and par... 40 5.8
85gb|AY224326.1| Macaca arctoides St0316 C4 gene, exon 9 and parti... 40 5.8
86gb|AY224325.1| Macaca arctoides Hanoi.05.02 C4 gene, exon 9 and ... 40 5.8
87gb|AY224324.1| Macaca arctoides Thai.2A C4 gene, exon 9 and part... 40 5.8
88gb|AY224323.1| Macaca arctoides 101.Malaya C4 gene, exon 9 and p... 40 5.8
89gb|AC073424.8| Homo sapiens BAC clone RP11-653O17 from 7, comple... 40 5.8
90emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on ch... 40 5.8
91ref|NG_000013.2| Homo sapiens MHC class III complement gene clus... 40 5.8
92emb|BX247883.11| Human DNA sequence from clone DASS-360P21 on ch... 40 5.8
93emb|AL662886.6| Human DNA sequence from clone RP13-339K12 on chr... 40 5.8
94emb|AL645860.5| Human DNA sequence from clone RP11-15O15 on chro... 40 5.8
95emb|AL671879.2| Human DNA sequence from clone XXbac-254L4 on chr... 40 5.8
96emb|AL357500.17| Human DNA sequence from clone RP11-242O24 on ch... 40 5.8
97emb|AL358253.16| Human DNA sequence from clone RP11-460G22 on ch... 40 5.8
98emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on ch... 40 5.8
99emb|AL162734.15| Human DNA sequence from clone RP11-243J18 on ch... 40 5.8
100emb|AL160270.19| Human DNA sequence from clone RP11-296L22 on ch... 40 5.8
101emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on ch... 40 5.8
102emb|AL161734.12| Human DNA sequence from clone RP11-33M22 on chr... 40 5.8
103emb|AL157932.21| Human DNA sequence from clone RP11-187A9 on chr... 40 5.8
104emb|AL121932.19|HSA373N24 Human DNA sequence from clone RP11-373... 40 5.8
105emb|AL121934.18|HSBA209A2 Human DNA sequence from clone RP11-209... 40 5.8
106emb|AL117327.5|HSJ421I20 Human DNA sequence from clone RP3-421I2... 40 5.8
107emb|CR753845.11| Human DNA sequence from clone DADB-112B14 on ch... 40 5.8
108emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.8
109emb|BX640433.1| Bordetella parapertussis strain 12822, complete ... 40 5.8
110emb|BX640421.1| Bordetella pertussis strain Tohama I, complete g... 40 5.8
111emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chrom... 40 5.8
112emb|AL645922.11| Human DNA sequence from clone XXbac-116M5 on ch... 40 5.8
113emb|CR936924.2| Human DNA sequence from clone DAMC-258G8 on chro... 40 5.8
114gb|AC107913.7| Homo sapiens chromosome 17, clone CTD-3051C7, com... 40 5.8
115gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, co... 40 5.8
116gb|AC119424.2| Homo sapiens chromosome 3 clone RP11-475O23, comp... 40 5.8
117gb|AY122899.1| Arabidopsis thaliana AT5g36790/f5h8_20 mRNA, comp... 40 5.8
118dbj|AP008234.1| Sodalis glossinidius str. 'morsitans' plasmid pS... 40 5.8
119gb|DQ438980.1| Trypanosoma cruzi antigenic lectin-2 gene, comple... 40 5.8
120gb|AC105751.2| Homo sapiens chromosome 3 clone RP11-908O9, compl... 40 5.8
121gb|AY094446.1| Arabidopsis thaliana AT5g36790/f5h8_20 mRNA, comp... 40 5.8
122gb|AC024288.9| Homo sapiens, clone RP11-23B5, complete sequence 40 5.8
123ref|NG_004658.1| Homo sapiens MHC class III complement gene clus... 40 5.8
124gb|S80811.1| C4A=fourth component of complement {ancient retrovi... 40 5.8
125gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.8
126gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.8
127gb|AC008383.8|AC008383 Homo sapiens chromosome 5 clone CTC-222O2... 40 5.8
128emb|BX679671.7| Human DNA sequence from clone DASS-307J8 on chro... 40 5.8
129emb|BX936373.1| Human DNA sequence from clone DASS-307J8 on chro... 40 5.8
130emb|BX826485.1|CNS0A467 Arabidopsis thaliana Full-length cDNA Co... 40 5.8
131gb|AC161476.3| Pan troglodytes BAC clone CH251-284F7 from chromo... 40 5.8
132gb|AC007215.49| Homo sapiens 12 BAC RP11-59H1 (Roswell Park Canc... 40 5.8
133gb|AC092646.2| Homo sapiens BAC clone RP11-415D20 from 2, comple... 40 5.8
134gb|BT005294.1| Arabidopsis thaliana At5g47760 mRNA, complete cds 40 5.8
135gb|AC009408.4| Homo sapiens BAC clone RP11-227I18 from 2, comple... 40 5.8
136gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, c... 40 5.8
137gb|AC006565.4|AC006565 Homo sapiens chromosome Y, clone CTC-484O... 40 5.8
138gb|AC010251.3|AC010251 Homo sapiens chromosome 5 clone CTC-426D1... 40 5.8
139dbj|AP002029.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.8
140dbj|AB025605.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.8
141dbj|AB016886.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.8
142dbj|D10909.1|ATHPK5 Arabidopsis thaliana gene for serine/threoni... 40 5.8
143dbj|AK118640.1| Arabidopsis thaliana At5g47760 mRNA for putative... 40 5.8
144dbj|AK117908.1| Arabidopsis thaliana At5g36790 mRNA for putative... 40 5.8
145emb|X80240.1|HSERVKC4 Homo sapiens endogenous retrovirus HERV-KC... 40 5.8
146gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E su... 40 5.8
147gb|AC007868.2|AC007868 Genomic Sequence for Homo sapiens clone 3... 40 5.8
148gb|U07856.1|HSU07856 Human endogenous retrovirus in complement C... 40 5.8
149emb|AJ305027.1|HSA305027 Homo sapiens partial ALOX12B gene for a... 40 5.8
150gb|AF012327.1|AF012327 Human Endogenous Retrovirus K1,2-1 5' ret... 40 5.8
151gb|AC005204.1|AC005204 Homo sapiens chromosome 19, cosmid F24083... 40 5.8
152gb|AE015925.1| Chlamydophila caviae GPIC, complete genome 40 5.8
153gb|L38804.1|ORAGAG Pongo pygmaeus gag protein (gag) gene, long t... 40 5.8
154gb|L38803.1|ORAENVE Pongo pygmaeus envelope protein (env) gene, ... 40 5.8
155gb|L38796.1|AGMENV Cercopithecus aethiops envelope protein (env)... 40 5.8
156gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome... 40 5.8
157gb|M28671.1|RATIGG2B Rattus norvegicus rearranged IgG-2b gene, l... 40 5.8
158gb|M59816.1|HUMC4AA1 Human complement component C4A gene, exons ... 40 5.8
159gb|M13802.1|RATIGCG2 Rat Ig germline gamma-2b H-chain C-region g... 40 5.8
160emb|AJ005342.1|ALAJ5342 Alternaria linicola mRNA for nitrophenyl... 40 5.8 
>ref|XM_472987.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1098

 Score =  329 bits (166), Expect = 4e-87
 Identities = 226/246 (91%)
 Strand = Plus / Plus

                                                                        
Query: 16   gtcgggaagccgtcgacattcatgatggactacctggcaaagaagtttggaatcacaaca 75
            |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 844  gtcgggaagccgtcaacattcatgatggactacctggcaaagaagtttgggatcacaaca 903

                                                                        
Query: 76   tctcagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgga 135
            || |||||||||||||| ||||||||||||||||| ||| |  | ||||| ||||| |||
Sbjct: 904  tcccagatatgcatggttggtgaccgtttggataccgacatcttgtttggccaaaacgga 963

                                                                        
Query: 136  ggctgcaaaactctcctggttctttcaggtgtgacttctgtgcagatgcttcagagcccc 195
            || ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 964  ggttgcaaaactcttctggtcctttcaggtgtcacttctgtacagatgcttcagagccct 1023

                                                                        
Query: 196  gacaacacgatccagccagatttctacacaaaccaaatttctgattttctcacccttaaa 255
            |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1024 gacaactcgatccagccagatttctacacaaaccaaatttctgattttctcaccctcaaa 1083

                  
Query: 256  acagca 261
             |||||
Sbjct: 1084 gcagca 1089
to top
>dbj|AK105071.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-C11, full
            insert sequence
          Length = 2822

 Score =  329 bits (166), Expect = 4e-87
 Identities = 226/246 (91%)
 Strand = Plus / Plus

                                                                        
Query: 16   gtcgggaagccgtcgacattcatgatggactacctggcaaagaagtttggaatcacaaca 75
            |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 851  gtcgggaagccgtcaacattcatgatggactacctggcaaagaagtttgggatcacaaca 910

                                                                        
Query: 76   tctcagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgga 135
            || |||||||||||||| ||||||||||||||||| ||| |  | ||||| ||||| |||
Sbjct: 911  tcccagatatgcatggttggtgaccgtttggataccgacatcttgtttggccaaaacgga 970

                                                                        
Query: 136  ggctgcaaaactctcctggttctttcaggtgtgacttctgtgcagatgcttcagagcccc 195
            || ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 971  ggttgcaaaactcttctggtcctttcaggtgtcacttctgtacagatgcttcagagccct 1030

                                                                        
Query: 196  gacaacacgatccagccagatttctacacaaaccaaatttctgattttctcacccttaaa 255
            |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1031 gacaactcgatccagccagatttctacacaaaccaaatttctgattttctcaccctcaaa 1090

                  
Query: 256  acagca 261
             |||||
Sbjct: 1091 gcagca 1096
to top
>dbj|AK066522.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013072G15, full
            insert sequence
          Length = 1373

 Score =  329 bits (166), Expect = 4e-87
 Identities = 226/246 (91%)
 Strand = Plus / Plus

                                                                        
Query: 16   gtcgggaagccgtcgacattcatgatggactacctggcaaagaagtttggaatcacaaca 75
            |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 927  gtcgggaagccgtcaacattcatgatggactacctggcaaagaagtttgggatcacaaca 986

                                                                        
Query: 76   tctcagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgga 135
            || |||||||||||||| ||||||||||||||||| ||| |  | ||||| ||||| |||
Sbjct: 987  tcccagatatgcatggttggtgaccgtttggataccgacatcttgtttggccaaaacgga 1046

                                                                        
Query: 136  ggctgcaaaactctcctggttctttcaggtgtgacttctgtgcagatgcttcagagcccc 195
            || ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 1047 ggttgcaaaactcttctggtcctttcaggtgtcacttctgtacagatgcttcagagccct 1106

                                                                        
Query: 196  gacaacacgatccagccagatttctacacaaaccaaatttctgattttctcacccttaaa 255
            |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1107 gacaactcgatccagccagatttctacacaaaccaaatttctgattttctcaccctcaaa 1166

                  
Query: 256  acagca 261
             |||||
Sbjct: 1167 gcagca 1172
to top
>dbj|AK104854.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-B10, full
            insert sequence
          Length = 1353

 Score =  321 bits (162), Expect = 1e-84
 Identities = 225/246 (91%)
 Strand = Plus / Plus

                                                                        
Query: 16   gtcgggaagccgtcgacattcatgatggactacctggcaaagaagtttggaatcacaaca 75
            |||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 927  gtcgggaagccgtcaacattcatgatggactacctagcaaagaagtttgggatcacaaca 986

                                                                        
Query: 76   tctcagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgga 135
            || |||||||||||||| ||||||||||||||||| ||| |  | ||||| ||||| |||
Sbjct: 987  tcccagatatgcatggttggtgaccgtttggataccgacatcttgtttggccaaaacgga 1046

                                                                        
Query: 136  ggctgcaaaactctcctggttctttcaggtgtgacttctgtgcagatgcttcagagcccc 195
            || ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 1047 ggttgcaaaactcttctggtcctttcaggtgtcacttctgtacagatgcttcagagccct 1106

                                                                        
Query: 196  gacaacacgatccagccagatttctacacaaaccaaatttctgattttctcacccttaaa 255
            |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1107 gacaactcgatccagccagatttctacacaaaccaaatttctgattttctcaccctcaaa 1166

                  
Query: 256  acagca 261
             |||||
Sbjct: 1167 gcagca 1172
to top
>emb|AL731617.3|OSJN00261 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0076N16,
             complete sequence
          Length = 146313

 Score =  153 bits (77), Expect = 6e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                         
Query: 161   caggtgtgacttctgtgcagatgcttcagagccccgacaacacgatccagccagatttct 220
             ||||||| |||||||| ||||||||||||||||| |||||| ||||||||||||||||||
Sbjct: 63157 caggtgtcacttctgtacagatgcttcagagccctgacaactcgatccagccagatttct 63098

                                                      
Query: 221   acacaaaccaaatttctgattttctcacccttaaaacagca 261
             ||||||||||||||||||||||||||||||| ||| |||||
Sbjct: 63097 acacaaaccaaatttctgattttctcaccctcaaagcagca 63057



 Score =  107 bits (54), Expect = 3e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                         
Query: 60    gtttggaatcacaacatctcagatatgcatggtaggtgaccgtttggatactgacgttct 119
             |||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |  |
Sbjct: 63346 gtttgggatcacaacatcccagatatgcatggttggtgaccgtttggataccgacatctt 63287

                                                           
Query: 120   atttgggcaaaatggaggctgcaaaactctcctggttctttcaggt 165
              ||||| ||||| ||||| ||||||||||| ||||| |||||||||
Sbjct: 63286 gtttggccaaaacggaggttgcaaaactcttctggtcctttcaggt 63241



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                           
Query: 16    gtcgggaagccgtcgacattcatgatggactacctggcaaagaagt 61
             |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 63502 gtcgggaagccgtcaacattcatgatggactacctggcaaagaagt 63457
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  153 bits (77), Expect = 6e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                            
Query: 161      caggtgtgacttctgtgcagatgcttcagagccccgacaacacgatccagccagatttct 220
                ||||||| |||||||| ||||||||||||||||| |||||| ||||||||||||||||||
Sbjct: 24503526 caggtgtcacttctgtacagatgcttcagagccctgacaactcgatccagccagatttct 24503467

                                                         
Query: 221      acacaaaccaaatttctgattttctcacccttaaaacagca 261
                ||||||||||||||||||||||||||||||| ||| |||||
Sbjct: 24503466 acacaaaccaaatttctgattttctcaccctcaaagcagca 24503426



 Score =  107 bits (54), Expect = 3e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                            
Query: 60       gtttggaatcacaacatctcagatatgcatggtaggtgaccgtttggatactgacgttct 119
                |||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |  |
Sbjct: 24503715 gtttgggatcacaacatcccagatatgcatggttggtgaccgtttggataccgacatctt 24503656

                                                              
Query: 120      atttgggcaaaatggaggctgcaaaactctcctggttctttcaggt 165
                 ||||| ||||| ||||| ||||||||||| ||||| |||||||||
Sbjct: 24503655 gtttggccaaaacggaggttgcaaaactcttctggtcctttcaggt 24503610



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                              
Query: 16       gtcgggaagccgtcgacattcatgatggactacctggcaaagaagt 61
                |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 24503871 gtcgggaagccgtcaacattcatgatggactacctggcaaagaagt 24503826
to top
>emb|AL606613.3|OSJN00051 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K20,
             complete sequence
          Length = 116983

 Score =  153 bits (77), Expect = 6e-34
 Identities = 95/101 (94%)
 Strand = Plus / Minus

                                                                         
Query: 161   caggtgtgacttctgtgcagatgcttcagagccccgacaacacgatccagccagatttct 220
             ||||||| |||||||| ||||||||||||||||| |||||| ||||||||||||||||||
Sbjct: 96848 caggtgtcacttctgtacagatgcttcagagccctgacaactcgatccagccagatttct 96789

                                                      
Query: 221   acacaaaccaaatttctgattttctcacccttaaaacagca 261
             ||||||||||||||||||||||||||||||| ||| |||||
Sbjct: 96788 acacaaaccaaatttctgattttctcaccctcaaagcagca 96748



 Score =  107 bits (54), Expect = 3e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                         
Query: 60    gtttggaatcacaacatctcagatatgcatggtaggtgaccgtttggatactgacgttct 119
             |||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |  |
Sbjct: 97037 gtttgggatcacaacatcccagatatgcatggttggtgaccgtttggataccgacatctt 96978

                                                           
Query: 120   atttgggcaaaatggaggctgcaaaactctcctggttctttcaggt 165
              ||||| ||||| ||||| ||||||||||| ||||| |||||||||
Sbjct: 96977 gtttggccaaaacggaggttgcaaaactcttctggtcctttcaggt 96932



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                           
Query: 16    gtcgggaagccgtcgacattcatgatggactacctggcaaagaagt 61
             |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 97193 gtcgggaagccgtcaacattcatgatggactacctggcaaagaagt 97148
to top
>gb|AY484589.1| Musa acuminata clone MuH9, genomic sequence
          Length = 82723

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                        
Query: 75   atctcagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
            |||||| |||||||||||||| || || |||||||| ||  | |||||||||||||||||
Sbjct: 8506 atctcaaatatgcatggtaggagatcggttggataccgatatactatttgggcaaaatgg 8447

                        
Query: 135  aggctgcaaaac 146
             |||||||||||
Sbjct: 8446 tggctgcaaaac 8435



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 162  aggtgtgacttctgtgcagatgcttcagagccccgacaacacgatccagccagatttcta 221
            |||||| |||||| |||| ||||| || ||||||  |||| | || || |||||||||||
Sbjct: 8341 aggtgttacttctctgcaaatgctgcaaagccccagcaactccatacaaccagatttcta 8282

                   
Query: 222  cacaaac 228
            |||||||
Sbjct: 8281 cacaaac 8275
to top
>gb|AC147179.15| Medicago truncatula clone mth2-142n19, complete sequence
          Length = 113361

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 121   tttgggcaaaatggaggctgcaaaactctcctggttctttcaggtgt 167
             ||||| |||||||| |||||||||||||| || || || ||||||||
Sbjct: 14508 tttggacaaaatggtggctgcaaaactctacttgtcctctcaggtgt 14462
to top
>emb|CR450824.9| Zebrafish DNA sequence from clone CH211-147F12 in linkage group 23,
              complete sequence
          Length = 170611

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 162    aggtgtgacttctgtgcagatgcttc 187
              |||||||| |||||||||||||||||
Sbjct: 139657 aggtgtgaattctgtgcagatgcttc 139632
to top
>gb|AC124761.4| Mus musculus BAC clone RP23-142G18 from 6, complete sequence
          Length = 182921

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 388    taaatgcaagtatgtacatcat 409
              ||||||||||||||||||||||
Sbjct: 131838 taaatgcaagtatgtacatcat 131817
to top
>gb|AC122353.5| Mus musculus BAC clone RP23-391E17 from chromosome 16, complete sequence
          Length = 200401

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 225    aaaccaaatttctgattttct 245
              |||||||||||||||||||||
Sbjct: 122779 aaaccaaatttctgattttct 122759
to top
>gb|AC068762.15| Homo sapiens 3 BAC RP11-215N17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 152541

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 222   cacaaaccaaatttctgattt 242
             |||||||||||||||||||||
Sbjct: 27728 cacaaaccaaatttctgattt 27748
to top
>dbj|BS000238.1| Pan troglodytes chromosome 22 clone:PTB-016O01, map 22, complete
              sequences
          Length = 168017

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 125    ggcaaaatggaggctgcaaaa 145
              |||||||||||||||||||||
Sbjct: 154833 ggcaaaatggaggctgcaaaa 154813
to top
>emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-109N16, complete sequence
          Length = 190477

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 125    ggcaaaatggaggctgcaaaa 145
              |||||||||||||||||||||
Sbjct: 101010 ggcaaaatggaggctgcaaaa 100990



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 125   ggcaaaatggaggctgcaaaa 145
             |||||||||||||||||||||
Sbjct: 59659 ggcaaaatggaggctgcaaaa 59639
to top
>dbj|AP001752.1| Homo sapiens genomic DNA, chromosome 21q, section 96/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 125    ggcaaaatggaggctgcaaaa 145
              |||||||||||||||||||||
Sbjct: 132511 ggcaaaatggaggctgcaaaa 132491



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 125   ggcaaaatggaggctgcaaaa 145
             |||||||||||||||||||||
Sbjct: 92581 ggcaaaatggaggctgcaaaa 92561
to top
>gb|AC124235.11| Mus musculus chromosome 13, clone RP23-273G24, complete sequence
          Length = 242383

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 59    agtttggaatcacaacatctc 79
             |||||||||||||||||||||
Sbjct: 43851 agtttggaatcacaacatctc 43831
to top
>dbj|AP001052.1| Homo sapiens genomic DNA, chromosome 21, clone:KB22A5, MX1-D21S171
              region, complete sequence
          Length = 145540

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 125    ggcaaaatggaggctgcaaaa 145
              |||||||||||||||||||||
Sbjct: 110690 ggcaaaatggaggctgcaaaa 110670



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 125   ggcaaaatggaggctgcaaaa 145
             |||||||||||||||||||||
Sbjct: 70760 ggcaaaatggaggctgcaaaa 70740
to top
>ref|NM_123027.2| Arabidopsis thaliana catalytic/ hydrolase/ phosphoglycolate
           phosphatase/ phosphoric monoester hydrolase AT5G36700
           mRNA, complete cds
          Length = 1413

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 79  cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
           |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 931 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 986
to top
>ref|NM_124150.2| Arabidopsis thaliana ATPK5; phosphoglycolate phosphatase AT5G47760
           (ATPK5) mRNA, complete cds
          Length = 1155

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 121 tttgggcaaaatggaggctgcaaaactctcct 152
           |||||||| ||||  |||||||||||||||||
Sbjct: 775 tttgggcagaatgctggctgcaaaactctcct 806
to top
>ref|NM_123037.2| Arabidopsis thaliana catalytic/ hydrolase/ phosphoglycolate
           phosphatase/ phosphoric monoester hydrolase AT5G36790
           mRNA, complete cds
          Length = 1371

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 79  cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
           |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 931 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 986
to top
>gb|AF019413.1|HSMHCT8S22 Homo sapiens HLA class III region containing tenascin X (tenascin-X)
             gene, partial cds; cytochrome P450 21-hydroxylase
             (CYP21B), complement component C4 (C4B) G11, helicase
             (SKI2W), RD, complement factor B (Bf), and  complement
             component C2 (C2) genes, complete cds
          Length = 109646

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 40749 gcaaaatggaggctgcaaaa 40730



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 34935 gcaaaatggaggctgcaaaa 34916
to top
>gb|AC004236.1| Homo sapiens chromosome 1, BAC clone 174p12 (LBNL H110), complete
             sequence
          Length = 43591

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 39277 gcaaaatggaggctgcaaaa 39258
to top
>gb|AC164418.10| Mus musculus chromosome 1, clone RP23-431J24, complete sequence
          Length = 189965

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     gcaaagaagtttggaatcac 71
              ||||||||||||||||||||
Sbjct: 103732 gcaaagaagtttggaatcac 103751
to top
>gb|AC119842.9| Mus musculus chromosome 1, clone RP23-277F23, complete sequence
          Length = 175179

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     gcaaagaagtttggaatcac 71
              ||||||||||||||||||||
Sbjct: 143868 gcaaagaagtttggaatcac 143887
to top
>gb|AC110177.19| Mus musculus chromosome 1, clone RP24-245K23, complete sequence
          Length = 165052

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 267    atgaacagaaatgtgaatgt 286
              ||||||||||||||||||||
Sbjct: 155035 atgaacagaaatgtgaatgt 155016
to top
>emb|AJ868436.1| Sodalis glossinidius pSG2 plasmid from Glossina austini
          Length = 27240

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   ctcctggttctttcaggtgt 167
             ||||||||||||||||||||
Sbjct: 24064 ctcctggttctttcaggtgt 24083
to top
>emb|AJ868435.1| Sodalis glossinidius pSG2 plasmid from Glossina palpalis palpalis
          Length = 27240

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   ctcctggttctttcaggtgt 167
             ||||||||||||||||||||
Sbjct: 24064 ctcctggttctttcaggtgt 24083
to top
>emb|CR385066.13| Zebrafish DNA sequence from clone DKEY-220L23 in linkage group 3,
             complete sequence
          Length = 238822

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 389   aaatgcaagtatgtacatca 408
             ||||||||||||||||||||
Sbjct: 44604 aaatgcaagtatgtacatca 44623
to top
>gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, complete sequence
          Length = 196037

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 77611 gcaaaatggaggctgcaaaa 77592
to top
>ref|XM_808839.1| Trypanosoma cruzi strain CL Brener lectin (Tc00.1047053506177.20)
           partial mRNA
          Length = 1689

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 aacagcagcagtatgaacag 274
           ||||||||||||||||||||
Sbjct: 956 aacagcagcagtatgaacag 975
to top
>gb|AC107959.8| Homo sapiens chromosome 8, clone RP11-875O11, complete sequence
          Length = 211291

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 47897 gcaaaatggaggctgcaaaa 47916
to top
>gb|AY224378.1| Homo sapiens Tosi C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3010

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 521 gcaaaatggaggctgcaaaa 540
to top
>gb|AY224377.1| Trachypithecus cristatus DJ.1 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3319

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224376.1| Presbytis melalophos DJ.36 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3298

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224375.1| Mandrillus sphinx Mandrill.1119 C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3024

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 526 gcaaaatggaggctgcaaaa 545
to top
>gb|AY224374.1| Theropithecus gelada 891096 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3022

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 526 gcaaaatggaggctgcaaaa 545
to top
>gb|AY224373.1| Papio hamadryas 73-347 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3019

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 526 gcaaaatggaggctgcaaaa 545
to top
>gb|AY224372.1| Macaca tonkeana PM604.H.clade C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224371.1| Macaca tonkeana PM558.N.clade C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224370.1| Macaca thibetana Sich.KIZ C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224369.1| Macaca thibetana 587041 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224368.1| Macaca sylvanus 1076 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3625

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 517 gcaaaatggaggctgcaaaa 536
to top
>gb|AY224367.1| Macaca sylvanus 201 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3589

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 480 gcaaaatggaggctgcaaaa 499
to top
>gb|AY224366.1| Macaca sinica 985 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 520 gcaaaatggaggctgcaaaa 539
to top
>gb|AY224365.1| Macaca sinica 716 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 520 gcaaaatggaggctgcaaaa 539
to top
>gb|AY224364.1| Macaca silenus 20382 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3263

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 453 gcaaaatggaggctgcaaaa 472
to top
>gb|AY224363.1| Macaca silenus 108806 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224362.1| Macaca radiata 3033 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224361.1| Macaca radiata 3028 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224360.1| Macaca ochreata Greyarm C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3287

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 480 gcaaaatggaggctgcaaaa 499
to top
>gb|AY224359.1| Macaca nigrescens 101 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224358.1| Macaca nigra PM661 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3260

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 453 gcaaaatggaggctgcaaaa 472
to top
>gb|AY224357.1| Macaca nemestrina pagensis.955 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224356.1| Macaca nemestrina pagensis.820 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224355.1| Macaca nemestrina PM665.E.Borneo C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3294

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224354.1| Macaca nemestrina SUKA.NE.Borneo C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3281

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224353.1| Macaca nemestrina Thai.1A C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224352.1| Macaca nemestrina #12.KIZ.17 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224351.1| Macaca nemestrina #1.KIZ.2 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224350.1| Macaca mulatta China.20156 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224349.1| Macaca mulatta Burma.23269 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224348.1| Macaca mulatta 16805 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224347.1| Macaca mulatta India.92B.560 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224346.1| Macaca maura PM616 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224345.1| Macaca hecki 1 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224344.1| Macaca fuscata 22086 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3313

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224343.1| Macaca fuscata 22082 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3314

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224342.1| Macaca fuscata 13751 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3308

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224341.1| Macaca fascicularis C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224340.1| Macaca fascicularis Java.34 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3323

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224339.1| Macaca fascicularis Borneo.PM.666 C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224338.1| Macaca fascicularis Sepilok C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224337.1| Macaca fascicularis Sarawak C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224336.1| Macaca fascicularis DM2687 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224335.1| Macaca fascicularis UKM.004 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224334.1| Macaca fascicularis Johor.DJ.95 C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224333.1| Macaca fascicularis #3 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224332.1| Macaca fascicularis Vietnam.290.WB C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224331.1| Macaca cyclopis #1 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224330.1| Macaca cyclopis 2682 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224329.1| Macaca brunnescens #3 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3324

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224328.1| Macaca assamensis 89019 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224327.1| Macaca assamensis 1.KIZ.B C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224326.1| Macaca arctoides St0316 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3328

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224325.1| Macaca arctoides Hanoi.05.02 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224324.1| Macaca arctoides Thai.2A C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AY224323.1| Macaca arctoides 101.Malaya C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 519 gcaaaatggaggctgcaaaa 538
to top
>gb|AC073424.8| Homo sapiens BAC clone RP11-653O17 from 7, complete sequence
          Length = 191141

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 354  tttcacattgatttgtaatc 373
            ||||||||||||||||||||
Sbjct: 7570 tttcacattgatttgtaatc 7589
to top
>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the
              NEU1 gene for sialidase 1 (lysosomal sialidase), the
              C6orf29 gene for chromosome 6 open reading frame 29, the
              BAT8 gene for HLA-B associated transcript 8, a novel
              transcript DAQB-331I12.5, the ZBTB12 gene (previously
              C6orf46) for zinc finger and BTB domain containing 12, the
              C2 gene for complement component 2, the Bf gene for
              B-factor, properdin, the RDBP gene for RD RNA binding
              protein, the SKIV2L gene for superkiller viralicidic
              activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3
              homolog Z (C. elegans), the STK19 gene for serine/threonine
              kinase 19, the 5' end of the C4A gene for complement
              component 4A and 8 CpG isalnds, complete sequence
          Length = 153464

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 144743 gcaaaatggaggctgcaaaa 144762



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 138929 gcaaaatggaggctgcaaaa 138948
to top
>ref|NG_000013.2| Homo sapiens MHC class III complement gene cluster, monomodular haplotype
              (MCGC@) on chromosome 6
          Length = 180017

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 111120 gcaaaatggaggctgcaaaa 111101



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 105306 gcaaaatggaggctgcaaaa 105287
to top
>emb|BX247883.11| Human DNA sequence from clone DASS-360P21 on chromosome 6, complete
             sequence
          Length = 46777

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 16708 gcaaaatggaggctgcaaaa 16727



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 10895 gcaaaatggaggctgcaaaa 10914
to top
>emb|AL662886.6| Human DNA sequence from clone RP13-339K12 on chromosome X Contains a
             pseudogene similar to part of p30 (nuclear protein p30)
             and a CpG island, complete sequence
          Length = 63451

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 59120 gcaaaatggaggctgcaaaa 59139
to top
>emb|AL645860.5| Human DNA sequence from clone RP11-15O15 on chromosome 1 Contains the
            5' end of the RPS6KC1 gene for ribosomal protein S6
            kinase 52kDa polypeptide 1, complete sequence
          Length = 26247

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 4887 gcaaaatggaggctgcaaaa 4906
to top
>emb|AL671879.2| Human DNA sequence from clone XXbac-254L4 on chromosome 6 contains a
             novel SCAN domain and Integrase core domain containing
             protein (FLJ31087, KIAA1925), a putative novel transcript,
             a laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1)
             pseudogene and two CpG islands, complete sequence
          Length = 176995

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 34831 gcaaaatggaggctgcaaaa 34812
to top
>emb|AL357500.17| Human DNA sequence from clone RP11-242O24 on chromosome 1 Contains the
             3' end of the EPB41 gene for erythrocyte membrane protein
             band 4.1 (elliptocytosis 1, RH-linked), three novel genes,
             the 3' end of the SFRS4 gene for splicing factor
             arginine/serine-rich 4 and a CpG island, complete sequence
          Length = 112392

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 92644 gcaaaatggaggctgcaaaa 92663
to top
>emb|AL358253.16| Human DNA sequence from clone RP11-460G22 on chromosome 1 Contains the
             3' end of the gene for a novel protein (KIAA0459), the
             PLA2G2E gene for phospholipase A2 group IIE and the
             PLA2G2A gene for phospholipase A2 group IIA (platelets,
             synovial fluid), complete sequence
          Length = 101824

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 25724 gcaaaatggaggctgcaaaa 25743



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 20432 gcaaaatggaggctgcaaaa 20451
to top
>emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on chromosome 1, complete
             sequence
          Length = 171635

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 348   gttttctttcacattgattt 367
             ||||||||||||||||||||
Sbjct: 89489 gttttctttcacattgattt 89470
to top
>emb|AL162734.15| Human DNA sequence from clone RP11-243J18 on chromosome 1 Contains the
             5' end of the YAP gene for YY1 associated protein, a novel
             gene, the DAP3 gene for death associated protein 3, a
             novel pseudogene, the 3' end of the gene for a novel
             protein (FLJ20203) and a CpG island, complete sequence
          Length = 107661

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 41264 gcaaaatggaggctgcaaaa 41283



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 34115 gcaaaatggaggctgcaaaa 34134
to top
>emb|AL160270.19| Human DNA sequence from clone RP11-296L22 on chromosome 9 Contains the 5'
              end of the C9orf25 gene for chromosome 9 open reading frame
              25 (FLJ39031), the DNAI1 gene for dynein axonemal
              intermediate polypeptide 1, the CNTFR gene for ciliary
              neurotrophic factor receptor, a novel pseudogene, three
              novel genes, the 3' end of the DCTN3 gene for dynactin
              (p22) and five CpG islands, complete sequence
          Length = 199114

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 124582 gcaaaatggaggctgcaaaa 124601
to top
>emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on chromosome 9 Contains
            the CRAT gene for carnitine acetyltransferase (CAT1), the
            PPP2R4 gene for protein phosphatase 2A, regulatory
            subunit B' (PR 53) (PTPA), the IER5L gene for immediate
            early response 5-like, a novel gene and three CpG
            islands, complete sequence
          Length = 162445

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 9204 gcaaaatggaggctgcaaaa 9185
to top
>emb|AL161734.12| Human DNA sequence from clone RP11-33M22 on chromosome 1q25.2-31.2
             Contains the 3' end of the CACNA1E gene for calcium
             channel voltage-dependent alpha 1E subunit, complete
             sequence
          Length = 167099

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 315   ttttgtatagcaactaagag 334
             ||||||||||||||||||||
Sbjct: 54678 ttttgtatagcaactaagag 54697
to top
>emb|AL157932.21| Human DNA sequence from clone RP11-187A9 on chromosome 13 Contains part
             of a novel gene, the 5' end of the DGKH gene for
             diacylglycerol kinase eta, a mitogen-activated protein
             kinase 6 (MAPK6) pseudogene and 2 CpG islands, complete
             sequence
          Length = 67309

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   ctctcctggttctttcaggt 165
             ||||||||||||||||||||
Sbjct: 18669 ctctcctggttctttcaggt 18650
to top
>emb|AL121932.19|HSA373N24 Human DNA sequence from clone RP11-373N24 on chromosome 6 Contains
            part of a putative novel gene, ESTs, STSs, GSSs and two
            CpG islands, complete sequence
          Length = 85952

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 2829 gcaaaatggaggctgcaaaa 2810
to top
>emb|AL121934.18|HSBA209A2 Human DNA sequence from clone RP11-209A2 on chromosome 6 Contains a 60S
             ribosomal protein L10 (RPL10) pseudogene, STSs and GSSs,
             complete sequence
          Length = 49261

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 30554 gcaaaatggaggctgcaaaa 30535



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 22346 gcaaaatggaggctgcaaaa 22327
to top
>emb|AL117327.5|HSJ421I20 Human DNA sequence from clone RP3-421I20 on chromosome Xq22.1-23,
             complete sequence
          Length = 52597

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 41584 gcaaaatggaggctgcaaaa 41603
to top
>emb|CR753845.11| Human DNA sequence from clone DADB-112B14 on chromosome 6, complete
             sequence
          Length = 96090

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 35744 gcaaaatggaggctgcaaaa 35763



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 29930 gcaaaatggaggctgcaaaa 29949
to top
>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16
          Length = 347137

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    ccccgacaacacgatccagc 211
              ||||||||||||||||||||
Sbjct: 207491 ccccgacaacacgatccagc 207510
to top
>emb|BX640433.1| Bordetella parapertussis strain 12822, complete genome; segment 11/14
          Length = 349305

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    ccccgacaacacgatccagc 211
              ||||||||||||||||||||
Sbjct: 143980 ccccgacaacacgatccagc 143999
to top
>emb|BX640421.1| Bordetella pertussis strain Tohama I, complete genome; segment 11/12
          Length = 349726

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    ccccgacaacacgatccagc 211
              ||||||||||||||||||||
Sbjct: 284545 ccccgacaacacgatccagc 284526
to top
>emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chromosome 9; segment 4/5
          Length = 254050

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 391    atgcaagtatgtacatcattaaat 414
              ||||||||||||||| ||||||||
Sbjct: 129996 atgcaagtatgtacaacattaaat 130019
to top
>emb|AL645922.11| Human DNA sequence from clone XXbac-116M5 on chromosome 6 contains the C2
              gene for complement component 2 (C2, CO2), the Bf gene for
              B-factor, properdin (Bf, GBG, CFAB, PBF2), the RDBP gene
              for RD RNA-binding protein (RDBP, RD, RDP, D6S45, NELF-E),
              the SKIV2L gene for superkiller viralicidic activity 2-like
              (S. cerevisiae) (SKIV2L, HLP, SKI2, DDX13, SKI2W, SKIV2),
              the DOM3Z gene for dom-3 homolog Z (C. elegans) (DOM3Z,
              NG6, DOM3L), the STK19 gene for serine/threonine kinase 19
              (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1), the C4A gene for
              complement component 4A (C4A, C4S, CO4), a cytochrome P450,
              subfamily XXIA (steroid 21-hydroxylase), polypeptide 1
              pseudogene (CYP21A1P), a tenascin XA pseudogene (TNXA, XA,
              XB, TNX, HXBL, D6S103E), a serine/threonine kinase 19
              (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1) pseudogene, the
              C4B gene for complement component 4B (C4B, C4F, CO4), the
              CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid
              21-hydroxylase, congenital adrenal hyperplasia),
              polypeptide 2 (CYP21A2, CAH1, CPS1, CA21H, CYP21, CYP21B,
              P450c21B), the 3' end of the TNXB gene for tenascin XB
              (TNXB, XB, TNX, XBS, HXBL, TENX, TNXB1, TNXB2, TNXBS) and
              four CpG islands, complete sequence
          Length = 180559

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 119621 gcaaaatggaggctgcaaaa 119640



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 113808 gcaaaatggaggctgcaaaa 113827



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 86884 gcaaaatggaggctgcaaaa 86903



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 81071 gcaaaatggaggctgcaaaa 81090
to top
>emb|CR936924.2| Human DNA sequence from clone DAMC-258G8 on chromosome 6, complete
             sequence
          Length = 42131

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 15453 gcaaaatggaggctgcaaaa 15472



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 9640 gcaaaatggaggctgcaaaa 9659
to top
>gb|AC107913.7| Homo sapiens chromosome 17, clone CTD-3051C7, complete sequence
          Length = 128953

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 40482 gcaaaatggaggctgcaaaa 40501
to top
>gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, complete sequence
          Length = 162678

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 77610 gcaaaatggaggctgcaaaa 77591
to top
>gb|AC119424.2| Homo sapiens chromosome 3 clone RP11-475O23, complete sequence
          Length = 208015

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 178270 gcaaaatggaggctgcaaaa 178251
to top
>gb|AY122899.1| Arabidopsis thaliana AT5g36790/f5h8_20 mRNA, complete cds
          Length = 1089

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 79  cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
           |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 898 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 953
to top
>dbj|AP008234.1| Sodalis glossinidius str. 'morsitans' plasmid pSG2, complete sequence
          Length = 27240

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 148   ctcctggttctttcaggtgt 167
             ||||||||||||||||||||
Sbjct: 20843 ctcctggttctttcaggtgt 20824
to top
>gb|DQ438980.1| Trypanosoma cruzi antigenic lectin-2 gene, complete cds
          Length = 2253

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  aacagcagcagtatgaacag 274
            ||||||||||||||||||||
Sbjct: 1203 aacagcagcagtatgaacag 1222
to top
>gb|AC105751.2| Homo sapiens chromosome 3 clone RP11-908O9, complete sequence
          Length = 168835

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 9359 gcaaaatggaggctgcaaaa 9378
to top
>gb|AY094446.1| Arabidopsis thaliana AT5g36790/f5h8_20 mRNA, complete cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 79  cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
           |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 932 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 987
to top
>gb|AC024288.9| Homo sapiens, clone RP11-23B5, complete sequence
          Length = 169540

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   ttctttcaggtgtgacttct 174
             ||||||||||||||||||||
Sbjct: 89120 ttctttcaggtgtgacttct 89101
to top
>ref|NG_004658.1| Homo sapiens MHC class III complement gene cluster, bimodular haplotype
             (MCGC2@) on chromosome 6
          Length = 201523

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 96139 gcaaaatggaggctgcaaaa 96158



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 90326 gcaaaatggaggctgcaaaa 90345



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 63402 gcaaaatggaggctgcaaaa 63421



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 57589 gcaaaatggaggctgcaaaa 57608
to top
>gb|S80811.1| C4A=fourth component of complement {ancient retroviral insertion
            sequence, intron 9} [human, Genomic, 6787 nt]
          Length = 6787

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 6213 gcaaaatggaggctgcaaaa 6232



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 402 gcaaaatggaggctgcaaaa 421
to top
>gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex BAC MMU235E11, complete
              sequence
          Length = 159875

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 110302 gcaaaatggaggctgcaaaa 110321
to top
>gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex BAC MMU007F01, complete
             sequence
          Length = 176267

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 65584 gcaaaatggaggctgcaaaa 65603
to top
>gb|AC008383.8|AC008383 Homo sapiens chromosome 5 clone CTC-222O22, complete sequence
          Length = 209114

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 349   ttttctttcacattgatttg 368
             ||||||||||||||||||||
Sbjct: 39279 ttttctttcacattgatttg 39260
to top
>emb|BX679671.7| Human DNA sequence from clone DASS-307J8 on chromosome 6, complete
             sequence
          Length = 96335

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 51247 gcaaaatggaggctgcaaaa 51266



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 45434 gcaaaatggaggctgcaaaa 45453



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 18509 gcaaaatggaggctgcaaaa 18528



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 12696 gcaaaatggaggctgcaaaa 12715
to top
>emb|BX936373.1| Human DNA sequence from clone DASS-307J8 on chromosome 6, complete
             sequence
          Length = 36539

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 18509 gcaaaatggaggctgcaaaa 18528



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 12696 gcaaaatggaggctgcaaaa 12715
to top
>emb|BX826485.1|CNS0A467 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB2ZG09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1313

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 121 tttgggcaaaatggaggctgcaaaactctcct 152
           |||||||| ||||  |||||||||||||||||
Sbjct: 852 tttgggcagaatgctggctgcaaaactctcct 883
to top
>gb|AC161476.3| Pan troglodytes BAC clone CH251-284F7 from chromosome unknown, complete
             sequence
          Length = 153003

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 17325 gcaaaatggaggctgcaaaa 17344
to top
>gb|AC007215.49| Homo sapiens 12 BAC RP11-59H1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 122001

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 37444 gcaaaatggaggctgcaaaa 37425
to top
>gb|AC092646.2| Homo sapiens BAC clone RP11-415D20 from 2, complete sequence
          Length = 176982

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    ctacacaaaccaaatttctg 238
              ||||||||||||||||||||
Sbjct: 155742 ctacacaaaccaaatttctg 155761
to top
>gb|BT005294.1| Arabidopsis thaliana At5g47760 mRNA, complete cds
          Length = 906

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 121 tttgggcaaaatggaggctgcaaaactctcct 152
           |||||||| ||||  |||||||||||||||||
Sbjct: 760 tttgggcagaatgctggctgcaaaactctcct 791
to top
>gb|AC009408.4| Homo sapiens BAC clone RP11-227I18 from 2, complete sequence
          Length = 169765

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 144496 gcaaaatggaggctgcaaaa 144515
to top
>gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, complete sequence
          Length = 205069

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gcaaaatggaggctgcaaaa 145
              ||||||||||||||||||||
Sbjct: 173338 gcaaaatggaggctgcaaaa 173319
to top
>gb|AC006565.4|AC006565 Homo sapiens chromosome Y, clone CTC-484O7, complete sequence
          Length = 46879

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 42300 gcaaaatggaggctgcaaaa 42281
to top
>gb|AC010251.3|AC010251 Homo sapiens chromosome 5 clone CTC-426D19, complete sequence
          Length = 175191

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 351    ttctttcacattgatttgta 370
              ||||||||||||||||||||
Sbjct: 102848 ttctttcacattgatttgta 102829
to top
>dbj|AP002029.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F24C7
          Length = 73663

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 79    cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
             |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 42598 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 42543
to top
>dbj|AB025605.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F5H8
          Length = 70098

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 79    cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
             |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 11337 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 11282
to top
>dbj|AB016886.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23
          Length = 82503

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 121   tttgggcaaaatggaggctgcaaaactctcct 152
             |||||||| ||||  |||||||||||||||||
Sbjct: 20609 tttgggcagaatgctggctgcaaaactctcct 20578
to top
>dbj|D10909.1|ATHPK5 Arabidopsis thaliana gene for serine/threonine protein kinase,
           complete cds
          Length = 4059

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 121 tttgggcaaaatggaggctgcaaaactctcct 152
           |||||||| ||||  |||||||||||||||||
Sbjct: 521 tttgggcagaatgctggctgcaaaactctcct 552
to top
>dbj|AK118640.1| Arabidopsis thaliana At5g47760 mRNA for putative
           4-nitrophenylphosphatase, complete cds, clone:
           RAFL19-90-G08
          Length = 1095

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 121 tttgggcaaaatggaggctgcaaaactctcct 152
           |||||||| ||||  |||||||||||||||||
Sbjct: 775 tttgggcagaatgctggctgcaaaactctcct 806
to top
>dbj|AK117908.1| Arabidopsis thaliana At5g36790 mRNA for putative
           p-nitrophenylphosphatase, complete cds, clone:
           RAFL19-09-D04
          Length = 1193

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 79  cagatatgcatggtaggtgaccgtttggatactgacgttctatttgggcaaaatgg 134
           |||||||||||||| |||||  | ||||| |||||| || |||| ||||| |||||
Sbjct: 857 cagatatgcatggttggtgatagattggacactgacattttattcgggcagaatgg 912
to top
>emb|X80240.1|HSERVKC4 Homo sapiens endogenous retrovirus HERV-KC4 DNA
          Length = 6369

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 6251 gcaaaatggaggctgcaaaa 6232



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 440 gcaaaatggaggctgcaaaa 421
to top
>gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E subunit (CACNA1E) gene, exons 7-49,
              and partial cds, alternatively spliced
          Length = 316704

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 315    ttttgtatagcaactaagag 334
              ||||||||||||||||||||
Sbjct: 212429 ttttgtatagcaactaagag 212448
to top
>gb|AC007868.2|AC007868 Genomic Sequence for Homo sapiens clone 344N5, chromosome 8, complete
             sequence
          Length = 89820

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 54646 gcaaaatggaggctgcaaaa 54665
to top
>gb|U07856.1|HSU07856 Human endogenous retrovirus in complement C4A gene, A3 allele,
            HERV-K(C4) (gag), (pol), reverse transcriptase, integrase
            and (env) genes, complete cds
          Length = 6372

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 6253 gcaaaatggaggctgcaaaa 6234



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 441 gcaaaatggaggctgcaaaa 422
to top
>emb|AJ305027.1|HSA305027 Homo sapiens partial ALOX12B gene for arachidonate
           12R-lipoxygenase, exons 3 to 14 and partial ALOX15P
           pseudogene for arachidonate 15-lipoxygenase, exons 11 to
           14
          Length = 13652

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 792 gcaaaatggaggctgcaaaa 811
to top
>gb|AF012327.1|AF012327 Human Endogenous Retrovirus K1,2-1 5' retroviral regulatory
           terminal end
          Length = 250

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 134 gcaaaatggaggctgcaaaa 115
to top
>gb|AC005204.1|AC005204 Homo sapiens chromosome 19, cosmid F24083, complete sequence
          Length = 38449

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gcaaaatggaggctgcaaaa 145
             ||||||||||||||||||||
Sbjct: 16642 gcaaaatggaggctgcaaaa 16661
to top
>gb|AE015925.1| Chlamydophila caviae GPIC, complete genome
          Length = 1173390

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 322    tagcaactaagagatcaccc 341
              ||||||||||||||||||||
Sbjct: 146306 tagcaactaagagatcaccc 146287
to top
>gb|L38804.1|ORAGAG Pongo pygmaeus gag protein (gag) gene, long terminal repeat
          Length = 1288

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 435 gcaaaatggaggctgcaaaa 416
to top
>gb|L38803.1|ORAENVE Pongo pygmaeus envelope protein (env) gene, long terminal repeat
          Length = 710

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 597 gcaaaatggaggctgcaaaa 578
to top
>gb|L38796.1|AGMENV Cercopithecus aethiops envelope protein (env) gene, long terminal
           repeat
          Length = 712

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 gcaaaatggaggctgcaaaa 145
           ||||||||||||||||||||
Sbjct: 603 gcaaaatggaggctgcaaaa 584
to top
>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   atgaacagaaatgtgaatgt 286
             ||||||||||||||||||||
Sbjct: 67268 atgaacagaaatgtgaatgt 67287
to top
>gb|M28671.1|RATIGG2B Rattus norvegicus rearranged IgG-2b gene, last 4 exons
          Length = 1885

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 138  ctgcaaaactctcctggttctttc 161
            |||||||||| |||||||||||||
Sbjct: 1756 ctgcaaaactgtcctggttctttc 1779
to top
>gb|M59816.1|HUMC4AA1 Human complement component C4A gene, exons 1 through 9
          Length = 2946

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  gcaaaatggaggctgcaaaa 145
            ||||||||||||||||||||
Sbjct: 2877 gcaaaatggaggctgcaaaa 2896
to top
>gb|M13802.1|RATIGCG2 Rat Ig germline gamma-2b H-chain C-region gene, exon 3
          Length = 572

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 138 ctgcaaaactctcctggttctttc 161
           |||||||||| |||||||||||||
Sbjct: 443 ctgcaaaactgtcctggttctttc 466
to top
>emb|AJ005342.1|ALAJ5342 Alternaria linicola mRNA for nitrophenylphosphatase-like protein
          Length = 391

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 205 atccagccagatttctacac 224
           ||||||||||||||||||||
Sbjct: 137 atccagccagatttctacac 156


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,286,367
Number of Sequences: 3902068
Number of extensions: 4286367
Number of successful extensions: 80172
Number of sequences better than 10.0: 160
Number of HSP's better than 10.0 without gapping: 160
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79895
Number of HSP's gapped (non-prelim): 277
length of query: 431
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 409
effective length of database: 17,147,199,772
effective search space: 7013204706748
effective search space used: 7013204706748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top