>emb|AL626763.11| Human DNA sequence from clone RP11-17H4 on chromosome 1 Contains the
3' end of the TSNAX gene for translin-associated factor
X, a novel gene, the 5' end of the DISC1 gene for
disrupted in schizophrenia 1 and a CpG island, complete
sequence
Length = 69203
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 83 ctgtgtatcaaaatgaaaat 102
||||||||||||||||||||
Sbjct: 1291 ctgtgtatcaaaatgaaaat 1310
>emb|AL445524.28| Human DNA sequence from clone RP11-295G20 on chromosome 1 Contains the 5'
end of the EGLN1 gene for egl nine homolog 1 (C. elegans),
a small nuclear ribonucleoprotein D2 polypeptide 16.5kDa
(SNRPD2) pseudogene, a novel gene, the 5' end of the TSNAX
gene for translin-associated factor X and a CpG island,
complete sequence
Length = 154073
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 83 ctgtgtatcaaaatgaaaat 102
||||||||||||||||||||
Sbjct: 153362 ctgtgtatcaaaatgaaaat 153381
>emb|AL160060.11| Human DNA sequence from clone RP11-207K8 on chromosome 10 Contains part
of the SVIL gene for supervillin (archvillin), complete
sequence
Length = 171800
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 553 attagtgatgctgagattgc 572
||||||||||||||||||||
Sbjct: 108700 attagtgatgctgagattgc 108719
>ref|XM_789278.1| PREDICTED: Strongylocentrotus purpuratus similar to zn-finger, CCHC
type and RNA-directed DNA polymerase and Integrase,
catalytic domain containing protein family member (1E419)
(LOC589642), partial mRNA
Length = 3390
Score = 40.1 bits (20), Expect = 8.5
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 243 tcagcacaatatcatctgcagtga 266
||||||||||||||||| ||||||
Sbjct: 2539 tcagcacaatatcatcttcagtga 2516
>ref|XM_789251.1| PREDICTED: Strongylocentrotus purpuratus similar to zn-finger, CCHC
type and RNA-directed DNA polymerase and Integrase,
catalytic domain containing protein family member (1E419)
(LOC589613), mRNA
Length = 3525
Score = 40.1 bits (20), Expect = 8.5
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 243 tcagcacaatatcatctgcagtga 266
||||||||||||||||| ||||||
Sbjct: 2398 tcagcacaatatcatcttcagtga 2375
>ref|XM_789232.1| PREDICTED: Strongylocentrotus purpuratus similar to zn-finger, CCHC
type and RNA-directed DNA polymerase and Integrase,
catalytic domain containing protein family member (1E419)
(LOC589593), mRNA
Length = 2832
Score = 40.1 bits (20), Expect = 8.5
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 243 tcagcacaatatcatctgcagtga 266
||||||||||||||||| ||||||
Sbjct: 1792 tcagcacaatatcatcttcagtga 1769
>ref|XM_791894.1| PREDICTED: Strongylocentrotus purpuratus similar to zn-finger, CCHC
type and RNA-directed DNA polymerase and Integrase,
catalytic domain containing protein family member (1E419)
(LOC592368), partial mRNA
Length = 1488
Score = 40.1 bits (20), Expect = 8.5
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 243 tcagcacaatatcatctgcagtga 266
||||||||||||||||| ||||||
Sbjct: 1327 tcagcacaatatcatcttcagtga 1304
>emb|AL713995.11| Mouse DNA sequence from clone RP23-423L9 on chromosome 4, complete
sequence
Length = 103260
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 216 tttacagagagatgttcctg 235
||||||||||||||||||||
Sbjct: 16144 tttacagagagatgttcctg 16125
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,900,983
Number of Sequences: 3902068
Number of extensions: 5900983
Number of successful extensions: 115629
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 115457
Number of HSP's gapped (non-prelim): 169
length of query: 625
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 602
effective length of database: 17,143,297,704
effective search space: 10320265217808
effective search space used: 10320265217808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)