ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal2k11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL451005.9| Human DNA sequence from clone RP11-92B10 on chro... 42 0.13
2gb|AC100740.8| Mus musculus chromosome 1, clone RP24-421N21, com... 38 2.0
3gb|AC166124.4| Mus musculus chromosome 1, clone RP23-105N9, comp... 38 2.0
4gb|AC150866.2| Bos taurus BAC CH240-290G4 (Children's Hospital ... 36 7.7
5ref|XM_418096.1| PREDICTED: Gallus gallus similar to Wnt-9b prot... 36 7.7
6gb|AC129020.4| Mus musculus BAC clone RP23-234A5 from chromosome... 36 7.7
7gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 36 7.7
8gb|AY753294.1| Gallus gallus wingless-type MMTV integration site... 36 7.7
9gb|AC006080.1|AC006080 Homo sapiens chromosome 17, clone hRPK.39... 36 7.7

>emb|AL451005.9| Human DNA sequence from clone RP11-92B10 on chromosome X Contains the
             5' end of a variant of the CUL4B gene for cullin 4B and
             the 5' end of a variant of the gene for MCT-1 protein
             (MCT-1), complete sequence
          Length = 26768

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 32    gggaaacccaggaacgtggat 52
             |||||||||||||||||||||
Sbjct: 17573 gggaaacccaggaacgtggat 17593



to top

>gb|AC100740.8| Mus musculus chromosome 1, clone RP24-421N21, complete sequence
          Length = 146835

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    gggaaacccaggaacgtgg 50
             |||||||||||||||||||
Sbjct: 61480 gggaaacccaggaacgtgg 61498



to top

>gb|AC166124.4| Mus musculus chromosome 1, clone RP23-105N9, complete sequence
          Length = 226615

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 32     gggaaacccaggaacgtgg 50
              |||||||||||||||||||
Sbjct: 163737 gggaaacccaggaacgtgg 163755



to top

>gb|AC150866.2| Bos taurus  BAC CH240-290G4 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 170911

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 33     ggaaacccaggaacgtgg 50
              ||||||||||||||||||
Sbjct: 102567 ggaaacccaggaacgtgg 102584



to top

>ref|XM_418096.1| PREDICTED: Gallus gallus similar to Wnt-9b protein precursor
           (Wnt-15) (Wnt-14b) (LOC419973), mRNA
          Length = 2734

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 17  cgtctccgccaagccggg 34
           ||||||||||||||||||
Sbjct: 516 cgtctccgccaagccggg 499



to top

>gb|AC129020.4| Mus musculus BAC clone RP23-234A5 from chromosome 16, complete sequence
          Length = 192668

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 24    gccaagccgggaaacccaggaa 45
             ||||||| ||||||||||||||
Sbjct: 98359 gccaagcagggaaacccaggaa 98380



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 33      ggaaacccaggaacgtgg 50
               ||||||||||||||||||
Sbjct: 1276710 ggaaacccaggaacgtgg 1276693



to top

>gb|AY753294.1| Gallus gallus wingless-type MMTV integration site family member 9b
           (WNT9b) mRNA, partial cds
          Length = 980

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 17  cgtctccgccaagccggg 34
           ||||||||||||||||||
Sbjct: 123 cgtctccgccaagccggg 106



to top

>gb|AC006080.1|AC006080 Homo sapiens chromosome 17, clone hRPK.394_K_10, complete sequence
          Length = 191111

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 33     ggaaacccaggaacgtgg 50
              ||||||||||||||||||
Sbjct: 132688 ggaaacccaggaacgtgg 132705


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 230,758
Number of Sequences: 3902068
Number of extensions: 230758
Number of successful extensions: 52031
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51985
Number of HSP's gapped (non-prelim): 46
length of query: 55
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 35
effective length of database: 17,155,003,908
effective search space: 600425136780
effective search space used: 600425136780
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top