ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal2g09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF513974.1| Pennisetum glaucum isolate RGPM 209 disease resis... 188 1e-44
2ref|XM_465455.1| Oryza sativa (japonica cultivar-group), mRNA 172 8e-40
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 172 8e-40
4dbj|AP005696.2| Oryza sativa (japonica cultivar-group) genomic D... 172 8e-40
5dbj|AK066598.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 8e-40
6emb|AJ307886.1|ZMA307886 Zea mays partial mRNA for pollen signal... 135 2e-28
7emb|AJ507101.1|HVU507101 Hordeum vulgare partial mRNA for NBS-LR... 52 0.002
8emb|AJ507092.1|HVU507092 Hordeum vulgare partial mRNA for NBS-LR... 52 0.002
9emb|AJ507089.1|HVU507089 Hordeum vulgare partial mRNA for NBS-LR... 52 0.002
10emb|AJ506142.1|HVU506142 Hordeum vulgare partial rga S-T21 gene ... 52 0.002
11emb|AJ506135.1|HVU506135 Hordeum vulgare partial rga S-372 gene ... 52 0.002
12gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genom... 48 0.033
13gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 48 0.033
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.033
15emb|AL353748.13| Human DNA sequence from clone RP11-317B17 on ch... 44 0.51
16emb|AJ234592.1|HVU234592 Hordeum vulgare genomic DNA fragment; c... 44 0.51
17gb|AC153728.1| Mus musculus BAC RP23-83N17 (Roswell Park Cancer... 42 2.0
18ref|NM_196317.1| Oryza sativa (japonica cultivar-group) putative... 42 2.0
19gb|AC102151.8| Mus musculus chromosome 18, clone RP23-312L17, co... 42 2.0
20emb|CR661427.2|CNS0F9BT Tetraodon nigroviridis full-length cDNA 42 2.0
21gb|AC139034.7| Mus musculus chromosome 6, clone RP23-350J11, com... 42 2.0
22emb|AL139383.14| Human DNA sequence from clone RP11-87G1 on chro... 42 2.0
23gb|AC092388.5| Oryza sativa chromosome 10 BAC OSJNBa0011L09 geno... 42 2.0
24gb|AC073882.4| Mus musculus strain 129/SvES Cell Line CJ7 chromo... 42 2.0
25gb|AC068952.10| Mus musculus strain 129/Sv ES cell line CJ7 chro... 42 2.0
26gb|AC068903.11| Mus musculus strain 129/Sv ES cell line CJ7 chro... 42 2.0
27dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
28emb|BX649317.5| Mouse DNA sequence from clone RP23-415G15 on chr... 42 2.0
29dbj|AK100807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
30gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
31emb|BX088557.2| Mouse DNA sequence from clone RP23-173C23 on chr... 42 2.0
32gb|AC132480.5| Mus musculus BAC clone RP23-11I14 from 6, complet... 42 2.0
33ref|XM_470199.1| Oryza sativa (japonica cultivar-group), predic... 40 7.9
34gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 7.9
35gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence 40 7.9
36gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence 40 7.9
37gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence 40 7.9
38gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 7.9
39ref|XM_454864.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E20273g ... 40 7.9
40gb|AC123850.3| Mus musculus BAC clone RP23-319K22 from chromosom... 40 7.9
41gb|AC127351.3| Mus musculus BAC clone RP23-66K20 from chromosome... 40 7.9
42gb|AC022559.12| Homo sapiens chromosome 8, clone RP11-404E12, co... 40 7.9
43emb|CR671367.2|CNS0FGZX Tetraodon nigroviridis full-length cDNA 40 7.9
44gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 7.9
45emb|AL136218.26| Human DNA sequence from clone RP11-101D11 on ch... 40 7.9
46emb|AL023773.1|HS406C18 Human DNA sequence from clone RP3-406C18... 40 7.9
47ref|XM_790218.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.9
48emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 7.9
49emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 7.9
50gb|AE012089.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 7.9
51gb|AC026396.8| Homo sapiens chromosome 10 clone RP11-89K18, comp... 40 7.9
52gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 7.9
53gb|AC007848.11| Homo sapiens 12 BAC RPCI11-1038A11 (Roswell Park... 40 7.9
54gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 40 7.9
55gb|AC012665.8| Homo sapiens BAC clone RP11-19E11 from 2, complet... 40 7.9
56gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.9
57dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome 40 7.9
58dbj|AK122034.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.9
59gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 40 7.9
60gb|AC121845.3| Mus musculus BAC clone RP24-82B23 from 5, complet... 40 7.9
61emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on ch... 40 7.9
62emb|AL773583.9| Mouse DNA sequence from clone RP23-384O2 on chro... 40 7.9 
>gb|AF513974.1| Pennisetum glaucum isolate RGPM 209 disease resistance protein-like
           protein gene, partial sequence
          Length = 693

 Score =  188 bits (95), Expect = 1e-44
 Identities = 189/219 (86%), Gaps = 1/219 (0%)
 Strand = Plus / Minus

                                                                       
Query: 358 cagagaacaagaaggaacttctcag-cctcctcagctctgctctttcaaagaggtttctc 416
           ||||||||||| ||||||| ||| | ||||||||| | ||| ||||||||||||||||| 
Sbjct: 586 cagagaacaaggaggaactcctcgggcctcctcagttgtgccctttcaaagaggtttctg 527

                                                                       
Query: 417 attgtcttggatgacctggacagcccggggatatgggacgatctgctgaaagatcctctg 476
           ||||||||||||||| || |||||||||| ||||||||| ||||||| ||||||||  ||
Sbjct: 526 attgtcttggatgacttgaacagcccgggcatatgggacaatctgctcaaagatccgatg 467

                                                                       
Query: 477 ggagacggcgtggcacgaggcagaatactggtcacgacacgggacgaggaagtggcgaca 536
           ||||| ||||||||  |||||||||||||| |||||||| || ||||||||||||| |||
Sbjct: 466 ggagatggcgtggcgagaggcagaatactgatcacgacaaggaacgaggaagtggcaaca 407

                                                  
Query: 537 ggcttgaaggcagtcgtccaccgtgtcgacaaaatggac 575
            || ||||||||   |||||||| || || |||||||||
Sbjct: 406 agcatgaaggcaactgtccaccgagttgaaaaaatggac 368



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 55/64 (85%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 260 ccccatctgcgtgtgggtgaag-atgtccaaggatctgtccgaggttgccttcttgaaga 318
           |||||| || |||||||||||| |||||||||||| | || ||||| || || |||||||
Sbjct: 682 ccccatatgtgtgtgggtgaaggatgtccaaggatttatcagaggtagcttttttgaaga 623

               
Query: 319 agat 322
           ||||
Sbjct: 622 agat 619
to top
>ref|XM_465455.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3938

 Score =  172 bits (87), Expect = 8e-40
 Identities = 162/187 (86%)
 Strand = Plus / Plus

                                                                        
Query: 388  tcagctctgctctttcaaagaggtttctcattgtcttggatgacctggacagcccgggga 447
            |||| ||| ||||||| ||||||||||||||||| ||||||||| |||||| ||| || |
Sbjct: 1229 tcagttctactctttcgaagaggtttctcattgtattggatgacttggacaacccaggta 1288

                                                                        
Query: 448  tatgggacgatctgctgaaagatcctctgggagacggcgtggcacgaggcagaatactgg 507
            ||||||| |||||||| |||||||| |||||||| || ||||| ||||||||||||||  
Sbjct: 1289 tatgggatgatctgctcaaagatccactgggagatggtgtggcccgaggcagaatactaa 1348

                                                                        
Query: 508  tcacgacacgggacgaggaagtggcgacaggcttgaaggcagtcgtccaccgtgtcgaca 567
            |||| ||||||  |||||||||||| |||||| |||||||  | |||||||| |||||||
Sbjct: 1349 tcacaacacggagcgaggaagtggcaacaggcatgaaggccatggtccaccgcgtcgaca 1408

                   
Query: 568  aaatgga 574
            |||||||
Sbjct: 1409 aaatgga 1415



 Score =  121 bits (61), Expect = 3e-24
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                        
Query: 153  gagggcaagaagaaggtggaagtcttcgccatcgtcggcgcggtggggatcggcaagacc 212
            |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 991  gagggcaagaagaaggtggatgtcttggccatcgtcggcgcagtggggatcggcaagaca 1050

                                                                        
Query: 213  acgcttgccagggagatattcactgatgagaggatgaacgaaaacttccccatctgcgtg 272
            | |||||| |||||||| | ||  || |||||||||| |||||  || || ||  | |||
Sbjct: 1051 atgcttgctagggagatttacaacgacgagaggatgaccgaaacatttccaattcgtgtg 1110

                                                                 
Query: 273  tgggtgaagatgtccaaggatctgtccgaggttgccttcttgaagaagatcat 325
            |||||||||||| | |||||| || | || || |  |||||||||||||||||
Sbjct: 1111 tgggtgaagatgacaaaggatttgacagatgtggatttcttgaagaagatcat 1163
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  172 bits (87), Expect = 8e-40
 Identities = 162/187 (86%)
 Strand = Plus / Plus

                                                                            
Query: 388      tcagctctgctctttcaaagaggtttctcattgtcttggatgacctggacagcccgggga 447
                |||| ||| ||||||| ||||||||||||||||| ||||||||| |||||| ||| || |
Sbjct: 15293683 tcagttctactctttcgaagaggtttctcattgtattggatgacttggacaacccaggta 15293742

                                                                            
Query: 448      tatgggacgatctgctgaaagatcctctgggagacggcgtggcacgaggcagaatactgg 507
                ||||||| |||||||| |||||||| |||||||| || ||||| ||||||||||||||  
Sbjct: 15293743 tatgggatgatctgctcaaagatccactgggagatggtgtggcccgaggcagaatactaa 15293802

                                                                            
Query: 508      tcacgacacgggacgaggaagtggcgacaggcttgaaggcagtcgtccaccgtgtcgaca 567
                |||| ||||||  |||||||||||| |||||| |||||||  | |||||||| |||||||
Sbjct: 15293803 tcacaacacggagcgaggaagtggcaacaggcatgaaggccatggtccaccgcgtcgaca 15293862

                       
Query: 568      aaatgga 574
                |||||||
Sbjct: 15293863 aaatgga 15293869



 Score =  121 bits (61), Expect = 3e-24
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                            
Query: 153      gagggcaagaagaaggtggaagtcttcgccatcgtcggcgcggtggggatcggcaagacc 212
                |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 15293445 gagggcaagaagaaggtggatgtcttggccatcgtcggcgcagtggggatcggcaagaca 15293504

                                                                            
Query: 213      acgcttgccagggagatattcactgatgagaggatgaacgaaaacttccccatctgcgtg 272
                | |||||| |||||||| | ||  || |||||||||| |||||  || || ||  | |||
Sbjct: 15293505 atgcttgctagggagatttacaacgacgagaggatgaccgaaacatttccaattcgtgtg 15293564

                                                                     
Query: 273      tgggtgaagatgtccaaggatctgtccgaggttgccttcttgaagaagatcat 325
                |||||||||||| | |||||| || | || || |  |||||||||||||||||
Sbjct: 15293565 tgggtgaagatgacaaaggatttgacagatgtggatttcttgaagaagatcat 15293617
to top
>dbj|AP005696.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0063K04
          Length = 158792

 Score =  172 bits (87), Expect = 8e-40
 Identities = 162/187 (86%)
 Strand = Plus / Plus

                                                                          
Query: 388    tcagctctgctctttcaaagaggtttctcattgtcttggatgacctggacagcccgggga 447
              |||| ||| ||||||| ||||||||||||||||| ||||||||| |||||| ||| || |
Sbjct: 104804 tcagttctactctttcgaagaggtttctcattgtattggatgacttggacaacccaggta 104863

                                                                          
Query: 448    tatgggacgatctgctgaaagatcctctgggagacggcgtggcacgaggcagaatactgg 507
              ||||||| |||||||| |||||||| |||||||| || ||||| ||||||||||||||  
Sbjct: 104864 tatgggatgatctgctcaaagatccactgggagatggtgtggcccgaggcagaatactaa 104923

                                                                          
Query: 508    tcacgacacgggacgaggaagtggcgacaggcttgaaggcagtcgtccaccgtgtcgaca 567
              |||| ||||||  |||||||||||| |||||| |||||||  | |||||||| |||||||
Sbjct: 104924 tcacaacacggagcgaggaagtggcaacaggcatgaaggccatggtccaccgcgtcgaca 104983

                     
Query: 568    aaatgga 574
              |||||||
Sbjct: 104984 aaatgga 104990



 Score =  121 bits (61), Expect = 3e-24
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                          
Query: 153    gagggcaagaagaaggtggaagtcttcgccatcgtcggcgcggtggggatcggcaagacc 212
              |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 104566 gagggcaagaagaaggtggatgtcttggccatcgtcggcgcagtggggatcggcaagaca 104625

                                                                          
Query: 213    acgcttgccagggagatattcactgatgagaggatgaacgaaaacttccccatctgcgtg 272
              | |||||| |||||||| | ||  || |||||||||| |||||  || || ||  | |||
Sbjct: 104626 atgcttgctagggagatttacaacgacgagaggatgaccgaaacatttccaattcgtgtg 104685

                                                                   
Query: 273    tgggtgaagatgtccaaggatctgtccgaggttgccttcttgaagaagatcat 325
              |||||||||||| | |||||| || | || || |  |||||||||||||||||
Sbjct: 104686 tgggtgaagatgacaaaggatttgacagatgtggatttcttgaagaagatcat 104738
to top
>dbj|AK066598.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013072E17, full
            insert sequence
          Length = 3939

 Score =  172 bits (87), Expect = 8e-40
 Identities = 162/187 (86%)
 Strand = Plus / Plus

                                                                        
Query: 388  tcagctctgctctttcaaagaggtttctcattgtcttggatgacctggacagcccgggga 447
            |||| ||| ||||||| ||||||||||||||||| ||||||||| |||||| ||| || |
Sbjct: 1229 tcagttctactctttcgaagaggtttctcattgtattggatgacttggacaacccaggta 1288

                                                                        
Query: 448  tatgggacgatctgctgaaagatcctctgggagacggcgtggcacgaggcagaatactgg 507
            ||||||| |||||||| |||||||| |||||||| || ||||| ||||||||||||||  
Sbjct: 1289 tatgggatgatctgctcaaagatccactgggagatggtgtggcccgaggcagaatactaa 1348

                                                                        
Query: 508  tcacgacacgggacgaggaagtggcgacaggcttgaaggcagtcgtccaccgtgtcgaca 567
            |||| ||||||  |||||||||||| |||||| |||||||  | |||||||| |||||||
Sbjct: 1349 tcacaacacggagcgaggaagtggcaacaggcatgaaggccatggtccaccgcgtcgaca 1408

                   
Query: 568  aaatgga 574
            |||||||
Sbjct: 1409 aaatgga 1415



 Score =  121 bits (61), Expect = 3e-24
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                        
Query: 153  gagggcaagaagaaggtggaagtcttcgccatcgtcggcgcggtggggatcggcaagacc 212
            |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 991  gagggcaagaagaaggtggatgtcttggccatcgtcggcgcagtggggatcggcaagaca 1050

                                                                        
Query: 213  acgcttgccagggagatattcactgatgagaggatgaacgaaaacttccccatctgcgtg 272
            | |||||| |||||||| | ||  || |||||||||| |||||  || || ||  | |||
Sbjct: 1051 atgcttgctagggagatttacaacgacgagaggatgaccgaaacatttccaattcgtgtg 1110

                                                                 
Query: 273  tgggtgaagatgtccaaggatctgtccgaggttgccttcttgaagaagatcat 325
            |||||||||||| | |||||| || | || || |  |||||||||||||||||
Sbjct: 1111 tgggtgaagatgacaaaggatttgacagatgtggatttcttgaagaagatcat 1163
to top
>emb|AJ307886.1|ZMA307886 Zea mays partial mRNA for pollen signalling protein with adenylyl
           cyclase activity (psiP gene)
          Length = 3051

 Score =  135 bits (68), Expect = 2e-28
 Identities = 143/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 123 gtgggcggcctcgtgccgaggctgctcagggagggcaagaagaaggtggaagtcttcgcc 182
           ||||| ||||| ||||| ||| |||| || |||||||||||||||||||| |||||||||
Sbjct: 7   gtgggtggccttgtgccaaggatgcttagagagggcaagaagaaggtggatgtcttcgcc 66

                                                                       
Query: 183 atcgtcggcgcggtggggatcggcaagaccacgcttgccagggagatattcactgatgag 242
           ||||| || ||||||||||| |||||||| || ||||| |||||||| | || |||||| 
Sbjct: 67  atcgttggtgcggtggggattggcaagactacacttgctagggagatctacaatgatgac 126

                                                           
Query: 243 aggatgaacgaaaacttccccatctgcgtgtgggtgaagatgtccaag 290
           |||||||  ||||| |||||||| || ||||||||  | |||||||||
Sbjct: 127 aggatgactgaaaatttccccatttgtgtgtgggttgacatgtccaag 174



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Plus

                                                                       
Query: 358 cagagaacaagaaggaacttctcagcctcctcagctctgctctttcaaagaggtttctca 417
           |||| |||||| ||||||| |||| |||||||   ||||| ||||| || ||||| ||| 
Sbjct: 239 cagaaaacaaggaggaactcctcatcctcctcgcttctgccctttccaaaaggttcctcc 298

                                                                       
Query: 418 ttgtcttggatgacctggacagcccggggatatgggacgatctgctgaaagatcctctgg 477
           ||||| |||||||| |||| |||||| | ||||||||| ||||||| |||||| |  |||
Sbjct: 299 ttgtcctggatgacttggagagcccgagcatatgggacaatctgctcaaagattcattgg 358

                                                                       
Query: 478 gagacggcgtggcacgaggcagaatactggtcacgacacgggacgaggaagtggcgacag 537
           |||| || || |   |||| ||||||||| |||| || ||| ||||||||||||| ||| 
Sbjct: 359 gagatggtgttgtcagaggaagaatactgatcacaactcggaacgaggaagtggcaacaa 418

                                                 
Query: 538 gcttgaaggcagtcgtccaccgtgtcgacaaaatggac 575
           || ||||||||    |||||| ||| ||||||||||||
Sbjct: 419 gcatgaaggcaactatccaccatgttgacaaaatggac 456
to top
>emb|AJ507101.1|HVU507101 Hordeum vulgare partial mRNA for NBS-LRR disease resistance protein
            homologue (rga S-T21 gene)
          Length = 4711

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 405  aagaggtttctcattgtcttggatga 430
            ||||||||||||||||||||||||||
Sbjct: 1135 aagaggtttctcattgtcttggatga 1160
to top
>emb|AJ507092.1|HVU507092 Hordeum vulgare partial mRNA for NBS-LRR disease resistance protein
            homologue (rga S-372 gene)
          Length = 4748

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 405  aagaggtttctcattgtcttggatga 430
            ||||||||||||||||||||||||||
Sbjct: 1047 aagaggtttctcattgtcttggatga 1072
to top
>emb|AJ507089.1|HVU507089 Hordeum vulgare partial mRNA for NBS-LRR disease resistance protein
            homologue (rga S-197-4 gene)
          Length = 4901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 405  aagaggtttctcattgtcttggatga 430
            ||||||||||||||||||||||||||
Sbjct: 1133 aagaggtttctcattgtcttggatga 1158
to top
>emb|AJ506142.1|HVU506142 Hordeum vulgare partial rga S-T21 gene for NBS-LRR disease
           resistance protein homologue
          Length = 445

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 405 aagaggtttctcattgtcttggatga 430
           ||||||||||||||||||||||||||
Sbjct: 196 aagaggtttctcattgtcttggatga 221
to top
>emb|AJ506135.1|HVU506135 Hordeum vulgare partial rga S-372 gene for NBS-LRR disease
           resistance protein homologue
          Length = 466

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 405 aagaggtttctcattgtcttggatga 430
           ||||||||||||||||||||||||||
Sbjct: 193 aagaggtttctcattgtcttggatga 218
to top
>gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete
             sequence
          Length = 150155

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 197   ggggatcggcaagaccacgcttgccagg 224
             |||||| |||||||||||||||||||||
Sbjct: 58348 ggggataggcaagaccacgcttgccagg 58321
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 197      ggggatcggcaagaccacgcttgccagg 224
                |||||| |||||||||||||||||||||
Sbjct: 27246047 ggggataggcaagaccacgcttgccagg 27246074



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 130     gcctcgtgccgaggctgctc 149
               ||||||||||||||||||||
Sbjct: 2454307 gcctcgtgccgaggctgctc 2454326
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 197      ggggatcggcaagaccacgcttgccagg 224
                |||||| |||||||||||||||||||||
Sbjct: 27337370 ggggataggcaagaccacgcttgccagg 27337397



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 130     gcctcgtgccgaggctgctc 149
               ||||||||||||||||||||
Sbjct: 2454417 gcctcgtgccgaggctgctc 2454436
to top
>emb|AL353748.13| Human DNA sequence from clone RP11-317B17 on chromosome 9 Contains the
             SPIN gene for spindlin, a heterogeneous nuclear
             ribonucleoprotein A1 (HNRPA1) pseudogene and a CpG island,
             complete sequence
          Length = 179155

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 141   aggctgctcagggagggcaagaagaa 166
             ||||||||||| ||||||||||||||
Sbjct: 12717 aggctgctcagagagggcaagaagaa 12742
to top
>emb|AJ234592.1|HVU234592 Hordeum vulgare genomic DNA fragment; clone MWG0851.rev
          Length = 552

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 405 aagaggtttctcattgtcttggatga 430
           ||||||||||| ||||||||||||||
Sbjct: 465 aagaggtttctaattgtcttggatga 440
to top
>gb|AC153728.1| Mus musculus  BAC RP23-83N17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 226417

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    ttctcattgtcttggatgacc 432
              |||||||||||||||||||||
Sbjct: 153327 ttctcattgtcttggatgacc 153347
to top
>ref|NM_196317.1| Oryza sativa (japonica cultivar-group) putative NBS-LRR type
           resistance protein (OSJNBa0011L09.18), mRNA
          Length = 1209

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 198 gggatcggcaagaccacgcttgcca 222
           ||||||||||||||||| |||||||
Sbjct: 631 gggatcggcaagaccacccttgcca 655
to top
>gb|AC102151.8| Mus musculus chromosome 18, clone RP23-312L17, complete sequence
          Length = 175398

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 343    atgttggggatgatgcagaga 363
              |||||||||||||||||||||
Sbjct: 109438 atgttggggatgatgcagaga 109458
to top
>emb|CR661427.2|CNS0F9BT Tetraodon nigroviridis full-length cDNA
          Length = 1132

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 302 ggttgccttcttgaagaagat 322
           |||||||||||||||||||||
Sbjct: 95  ggttgccttcttgaagaagat 115
to top
>gb|AC139034.7| Mus musculus chromosome 6, clone RP23-350J11, complete sequence
          Length = 247394

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    ttctcattgtcttggatgacc 432
              |||||||||||||||||||||
Sbjct: 104254 ttctcattgtcttggatgacc 104274
to top
>emb|AL139383.14| Human DNA sequence from clone RP11-87G1 on chromosome 13q12.2-13.2
              Contains part of a novel gene and a CpG island, complete
              sequence
          Length = 182917

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 222    agggagatattcactgatgag 242
              |||||||||||||||||||||
Sbjct: 180263 agggagatattcactgatgag 180243
to top
>gb|AC092388.5| Oryza sativa chromosome 10 BAC OSJNBa0011L09 genomic sequence, complete
              sequence
          Length = 177565

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 198    gggatcggcaagaccacgcttgcca 222
              ||||||||||||||||| |||||||
Sbjct: 105693 gggatcggcaagaccacccttgcca 105669
to top
>gb|AC073882.4| Mus musculus strain 129/SvES Cell Line CJ7 chromosome 2 clone
             ct7-305f12, complete sequence
          Length = 130734

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 158   caagaagaaggtggaagtctt 178
             |||||||||||||||||||||
Sbjct: 78552 caagaagaaggtggaagtctt 78572
to top
>gb|AC068952.10| Mus musculus strain 129/Sv ES cell line CJ7 chromosome 2 clone
             ct7-254f1, complete sequence
          Length = 95292

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   caagaagaaggtggaagtctt 178
             |||||||||||||||||||||
Sbjct: 63177 caagaagaaggtggaagtctt 63157
to top
>gb|AC068903.11| Mus musculus strain 129/Sv ES cell line CJ7 chromosome 2 clone
             ct7-196d19, complete sequence
          Length = 82033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   caagaagaaggtggaagtctt 178
             |||||||||||||||||||||
Sbjct: 48399 caagaagaaggtggaagtctt 48379
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 198      gggatcggcaagaccacgcttgcca 222
                ||||||||||||||||| |||||||
Sbjct: 12657869 gggatcggcaagaccacccttgcca 12657893
to top
>emb|BX649317.5| Mouse DNA sequence from clone RP23-415G15 on chromosome 2, complete
             sequence
          Length = 199584

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   caagaagaaggtggaagtctt 178
             |||||||||||||||||||||
Sbjct: 59324 caagaagaaggtggaagtctt 59304
to top
>dbj|AK100807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023121L16, full
            insert sequence
          Length = 4867

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 198  gggatcggcaagaccacgcttgcca 222
            ||||||||||||||||| |||||||
Sbjct: 1939 gggatcggcaagaccacccttgcca 1963
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 198      gggatcggcaagaccacgcttgcca 222
                ||||||||||||||||| |||||||
Sbjct: 12665209 gggatcggcaagaccacccttgcca 12665233
to top
>emb|BX088557.2| Mouse DNA sequence from clone RP23-173C23 on chromosome 2, complete
             sequence
          Length = 80320

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   caagaagaaggtggaagtctt 178
             |||||||||||||||||||||
Sbjct: 21433 caagaagaaggtggaagtctt 21413
to top
>gb|AC132480.5| Mus musculus BAC clone RP23-11I14 from 6, complete sequence
          Length = 230313

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    ttctcattgtcttggatgacc 432
              |||||||||||||||||||||
Sbjct: 133552 ttctcattgtcttggatgacc 133532
to top
>ref|XM_470199.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1554

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 130  gcctcgtgccgaggctgctc 149
            ||||||||||||||||||||
Sbjct: 1361 gcctcgtgccgaggctgctc 1380
to top
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 121     ccgtgggcggcctcgtgccgaggctgct 148
               |||| |||||||||||||||| ||||||
Sbjct: 1968376 ccgtcggcggcctcgtgccgatgctgct 1968349
to top
>gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence
          Length = 103167

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 203   cggcaagaccacgcttgccagggagatattca 234
             ||||||||||||||| |||| |||||| ||||
Sbjct: 22795 cggcaagaccacgctcgccatggagatcttca 22826
to top
>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence
          Length = 125927

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 203   cggcaagaccacgcttgccagggagatattca 234
             ||||||||||||||| |||| |||||| ||||
Sbjct: 89440 cggcaagaccacgctcgccatggagatcttca 89471
to top
>gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence
          Length = 279448

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 203    cggcaagaccacgcttgccagggagatattca 234
              ||||||||||||||| |||| |||||| ||||
Sbjct: 278028 cggcaagaccacgctcgccatggagatcttca 278059
to top
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 121     ccgtgggcggcctcgtgccgaggctgct 148
               |||| |||||||||||||||| ||||||
Sbjct: 1463998 ccgtcggcggcctcgtgccgatgctgct 1464025
to top
>ref|XM_454864.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E20273g predicted mRNA
          Length = 321

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 299 cgaggttgccttcttgaagaagatcatt 326
           ||||| |||| |||||||||||||||||
Sbjct: 246 cgaggatgccatcttgaagaagatcatt 273
to top
>gb|AC123850.3| Mus musculus BAC clone RP23-319K22 from chromosome 5, complete sequence
          Length = 200934

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 396   gctctttcaaagaggtttctcatt 419
             |||||||| |||||||||||||||
Sbjct: 32863 gctctttctaagaggtttctcatt 32840
to top
>gb|AC127351.3| Mus musculus BAC clone RP23-66K20 from chromosome 5, complete sequence
          Length = 238781

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 396    gctctttcaaagaggtttctcatt 419
              |||||||| |||||||||||||||
Sbjct: 115698 gctctttctaagaggtttctcatt 115675
to top
>gb|AC022559.12| Homo sapiens chromosome 8, clone RP11-404E12, complete sequence
          Length = 151033

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tgctcagggagggcaagaag 164
             ||||||||||||||||||||
Sbjct: 65205 tgctcagggagggcaagaag 65224
to top
>emb|CR671367.2|CNS0FGZX Tetraodon nigroviridis full-length cDNA
          Length = 1152

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 377 tctcagcctcctcagctctgctct 400
           ||||||||| ||||||||||||||
Sbjct: 170 tctcagcctgctcagctctgctct 147
to top
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 64      gctgccaggacgacgcagccaagc 87
               |||| |||||||||||||||||||
Sbjct: 1823432 gctggcaggacgacgcagccaagc 1823455
to top
>emb|AL136218.26| Human DNA sequence from clone RP11-101D11 on chromosome 13 Contains the
              5' end of a novel gene (FLJ12577), the 5' end of the gene
              for CLLL8 protein (CLLD8) and 2 CpG islands, complete
              sequence
          Length = 159863

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    tcagggagggcaagaagaag 167
              ||||||||||||||||||||
Sbjct: 153075 tcagggagggcaagaagaag 153094
to top
>emb|AL023773.1|HS406C18 Human DNA sequence from clone RP3-406C18 on chromosome Xq27.1-27.3
             Contains two MAGE (Melanoma Associated Antigen) family
             pseudogenes, complete sequence
          Length = 116210

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    agtactgaaatgtccaggag 64
             ||||||||||||||||||||
Sbjct: 40427 agtactgaaatgtccaggag 40408
to top
>ref|XM_790218.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2615-PB,
           isoform B (LOC590620), mRNA
          Length = 2886

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 385 tcctcagctctgctctttcaaaga 408
           |||||||| |||||||||||||||
Sbjct: 664 tcctcagcactgctctttcaaaga 641
to top
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 299     cgaggttgccttcttgaagaagatcatt 326
               ||||| |||| |||||||||||||||||
Sbjct: 1795090 cgaggatgccatcttgaagaagatcatt 1795117
to top
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 121     ccgtgggcggcctcgtgccgaggctgct 148
               |||| |||||||||||||||| ||||||
Sbjct: 1351092 ccgtcggcggcctcgtgccgatgctgct 1351119
to top
>gb|AE012089.1| Xanthomonas axonopodis pv. citri str. 306,  section 467 of 469 of the
             complete genome
          Length = 11996

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 453   gacgatctgctgaaagatcc 472
             ||||||||||||||||||||
Sbjct: 10003 gacgatctgctgaaagatcc 9984
to top
>gb|AC026396.8| Homo sapiens chromosome 10 clone RP11-89K18, complete sequence
          Length = 162057

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 377    tctcagcctcctcagctctg 396
              ||||||||||||||||||||
Sbjct: 136018 tctcagcctcctcagctctg 135999
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 179     cgccatcgtcggcgcggtgg 198
               ||||||||||||||||||||
Sbjct: 2236931 cgccatcgtcggcgcggtgg 2236912
to top
>gb|AC007848.11| Homo sapiens 12 BAC RPCI11-1038A11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 104630

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 340   taaatgttggggatgatgcagaga 363
             ||||||||||||| ||||||||||
Sbjct: 27185 taaatgttggggaagatgcagaga 27162
to top
>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 408   aggtttctcattgtcttggatgac 431
             |||||||| |||||||||||||||
Sbjct: 96300 aggtttcttattgtcttggatgac 96277
to top
>gb|AC012665.8| Homo sapiens BAC clone RP11-19E11 from 2, complete sequence
          Length = 126039

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   ctcagcctcctcagctctgc 397
             ||||||||||||||||||||
Sbjct: 65813 ctcagcctcctcagctctgc 65794
to top
>gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1172F09,
             complete sequence
          Length = 106057

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   gcctcgtgccgaggctgctc 149
             ||||||||||||||||||||
Sbjct: 26803 gcctcgtgccgaggctgctc 26822
to top
>dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome
          Length = 1738505

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 370     aggaacttctcagcctcctc 389
               ||||||||||||||||||||
Sbjct: 1065279 aggaacttctcagcctcctc 1065298
to top
>dbj|AK122034.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112K10, full
            insert sequence
          Length = 1541

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 130  gcctcgtgccgaggctgctc 149
            ||||||||||||||||||||
Sbjct: 1150 gcctcgtgccgaggctgctc 1169
to top
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 121     ccgtgggcggcctcgtgccgaggctgct 148
               |||| |||||||||||||||| ||||||
Sbjct: 1158130 ccgtcggcggcctcgtgccgatgctgct 1158157
to top
>gb|AC121845.3| Mus musculus BAC clone RP24-82B23 from 5, complete sequence
          Length = 217530

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     tactgaaatgtccaggagct 66
              ||||||||||||||||||||
Sbjct: 104325 tactgaaatgtccaggagct 104306
to top
>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete
              sequence
          Length = 220242

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 380    cagcctcctcagctctgctc 399
              ||||||||||||||||||||
Sbjct: 175346 cagcctcctcagctctgctc 175327
to top
>emb|AL773583.9| Mouse DNA sequence from clone RP23-384O2 on chromosome X, complete
            sequence
          Length = 131402

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 370  aggaacttctcagcctcctc 389
            ||||||||||||||||||||
Sbjct: 9539 aggaacttctcagcctcctc 9558


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,060,374
Number of Sequences: 3902068
Number of extensions: 5060374
Number of successful extensions: 110087
Number of sequences better than 10.0: 62
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109386
Number of HSP's gapped (non-prelim): 690
length of query: 584
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 561
effective length of database: 17,143,297,704
effective search space: 9617390011944
effective search space used: 9617390011944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top