ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal2d16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY625683.1| Triticum aestivum NAC domain transcription factor... 127 2e-26
2emb|AL160169.12| Human DNA sequence from clone RP11-405C6 on chr... 46 0.045
3gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 0.69
4gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome... 40 2.7
5gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosom... 40 2.7

>gb|AY625683.1| Triticum aestivum NAC domain transcription factor (NAC2) mRNA,
            complete cds
          Length = 1450

 Score =  127 bits (64), Expect = 2e-26
 Identities = 105/119 (88%), Gaps = 6/119 (5%)
 Strand = Plus / Minus

                                                                        
Query: 9    attctactactgaggagngagaagagaagagagctacntccgcnttgagagtncaa---a 65
            ||||||||| ||||||| ||||||| |   ||||||| ||||| |||||||| |||   |
Sbjct: 1372 attctactagtgaggagtgagaagaaa---gagctacatccgcattgagagtacaaggta 1316

                                                                       
Query: 66   gtaagaacgaaagaatcaacccagccggccaggccccggcgccgggctntccatgtaca 124
            |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1315 gtaagaacaaaagaatcaacccagccggccaggccccggcgccgggctctccatgtaca 1257



 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 184  cctccctcccgtttcctatgctgtatttacact 216
            |||||||||||||||||||||||||||||||||
Sbjct: 1207 cctccctcccgtttcctatgctgtatttacact 1175



to top

>emb|AL160169.12| Human DNA sequence from clone RP11-405C6 on chromosome 9 Contains the
             3' end of the gene for a novel protein (KIAA1993), the 5'
             end of the RALGPS1A gene for Ral guanine nucleotide
             exchange factor RalGPS1A (RALGEF2, KIAA0351) and a CpG
             island, complete sequence
          Length = 124025

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 90    ccggccaggccccggcgccgggc 112
             |||||||||||||||||||||||
Sbjct: 31481 ccggccaggccccggcgccgggc 31459



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 85     cccagccggccaggccccggc 105
              |||||||||||||||||||||
Sbjct: 353745 cccagccggccaggccccggc 353765



to top

>gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome 9, complete sequence
          Length = 221000

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 21     aggagngagaagagaagagagct 43
              ||||| |||||||||||||||||
Sbjct: 141210 aggagagagaagagaagagagct 141232



to top

>gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosome 9, complete sequence
          Length = 213468

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 21     aggagngagaagagaagagagct 43
              ||||| |||||||||||||||||
Sbjct: 165402 aggagagagaagagaagagagct 165380


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,260,392
Number of Sequences: 3902068
Number of extensions: 1260392
Number of successful extensions: 190337
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 190260
Number of HSP's gapped (non-prelim): 77
length of query: 216
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 194
effective length of database: 17,147,199,772
effective search space: 3326556755768
effective search space used: 3326556755768
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top