| Clone Name | baal2d16 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AY625683.1| Triticum aestivum NAC domain transcription factor... | 127 | 2e-26 | 2 | emb|AL160169.12| Human DNA sequence from clone RP11-405C6 on chr... | 46 | 0.045 | 3 | gb|CP000316.1| Polaromonas sp. JS666, complete genome | 42 | 0.69 | 4 | gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome... | 40 | 2.7 | 5 | gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosom... | 40 | 2.7 |
|---|
>gb|AY625683.1| Triticum aestivum NAC domain transcription factor (NAC2) mRNA, complete cds Length = 1450 Score = 127 bits (64), Expect = 2e-26 Identities = 105/119 (88%), Gaps = 6/119 (5%) Strand = Plus / Minus Query: 9 attctactactgaggagngagaagagaagagagctacntccgcnttgagagtncaa---a 65 ||||||||| ||||||| ||||||| | ||||||| ||||| |||||||| ||| | Sbjct: 1372 attctactagtgaggagtgagaagaaa---gagctacatccgcattgagagtacaaggta 1316 Query: 66 gtaagaacgaaagaatcaacccagccggccaggccccggcgccgggctntccatgtaca 124 |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 1315 gtaagaacaaaagaatcaacccagccggccaggccccggcgccgggctctccatgtaca 1257 Score = 65.9 bits (33), Expect = 5e-08 Identities = 33/33 (100%) Strand = Plus / Minus Query: 184 cctccctcccgtttcctatgctgtatttacact 216 ||||||||||||||||||||||||||||||||| Sbjct: 1207 cctccctcccgtttcctatgctgtatttacact 1175
>emb|AL160169.12| Human DNA sequence from clone RP11-405C6 on chromosome 9 Contains the 3' end of the gene for a novel protein (KIAA1993), the 5' end of the RALGPS1A gene for Ral guanine nucleotide exchange factor RalGPS1A (RALGEF2, KIAA0351) and a CpG island, complete sequence Length = 124025 Score = 46.1 bits (23), Expect = 0.045 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 ccggccaggccccggcgccgggc 112 ||||||||||||||||||||||| Sbjct: 31481 ccggccaggccccggcgccgggc 31459
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 85 cccagccggccaggccccggc 105 ||||||||||||||||||||| Sbjct: 353745 cccagccggccaggccccggc 353765
>gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome 9, complete sequence Length = 221000 Score = 40.1 bits (20), Expect = 2.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 21 aggagngagaagagaagagagct 43 ||||| ||||||||||||||||| Sbjct: 141210 aggagagagaagagaagagagct 141232
>gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosome 9, complete sequence Length = 213468 Score = 40.1 bits (20), Expect = 2.7 Identities = 22/23 (95%) Strand = Plus / Minus Query: 21 aggagngagaagagaagagagct 43 ||||| ||||||||||||||||| Sbjct: 165402 aggagagagaagagaagagagct 165380 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,260,392 Number of Sequences: 3902068 Number of extensions: 1260392 Number of successful extensions: 190337 Number of sequences better than 10.0: 5 Number of HSP's better than 10.0 without gapping: 5 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 190260 Number of HSP's gapped (non-prelim): 77 length of query: 216 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 194 effective length of database: 17,147,199,772 effective search space: 3326556755768 effective search space used: 3326556755768 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)