| Clone Name | baal1o09 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK121949.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107J07, full insert sequence Length = 2462 Score = 418 bits (211), Expect = e-114 Identities = 503/600 (83%), Gaps = 2/600 (0%) Strand = Plus / Plus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 ||||||||||||||||||||||| || |||||||||||||| ||||| |||| ||||||| Sbjct: 236 aggtggtggggatcgacctcggg-acgaccaactccgcggtggcggcgatgg-agggcgg 293 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 ||||| ||| || ||||||||||||||||| |||||| ||||| || || ||||| || Sbjct: 294 gaagccgacggtcatcaccaacgccgagggccagcggacgacgccctccgtggtggcgta 353 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 |||||||| ||| || ||| |||| ||||||||||||||| ||||||| || |||||||| Sbjct: 354 caccaagggcggggagcggctggtcgggcagatcgccaagcggcaggccgtcgtcaaccc 413 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccga 258 |||||||||||||||||| |||||| | ||||||||||| |||||| |||||||| ||| Sbjct: 414 ggagaacaccttcttctccgtcaagcgcttcatcggccgcaagatggccgaggtcgacga 473 Query: 259 ggagtccaagcaggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcga 318 ||| |||||||||| ||||||| | | ||||| ||||| |||||||| ||||||||||| Sbjct: 474 cgaggccaagcaggtctcctaccacgtcgtccgcgacgacaacggcaacgtcaagctcga 533 Query: 319 ttgcccggcaatcggcaagcagttcgctgccgaggagatctctgcacaggtcctgagaaa 378 ||||| || ||||||||||||||||| ||||||||||| || || |||||| |||| || Sbjct: 534 ctgccccgccatcggcaagcagttcgccgccgaggagatttccgcgcaggtcttgaggaa 593 Query: 379 gttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaaggcagtgatcacagt 438 |||||| || ||||| || |||||||| ||||||||| | ||||| |||||| | || || Sbjct: 594 gttggtggacgatgcatctaagtttttgaatgacaaaattaccaaagcagtggttactgt 653 Query: 439 tcctgcttatttcaatgactcccagaggacggctacaaaagatgctgggcgcattgcagg 498 |||||| || ||||||||||| |||||||| || |||||||||||||| || |||||||| Sbjct: 654 tcctgcatacttcaatgactcacagaggacagcaacaaaagatgctggacgtattgcagg 713 Query: 499 gttggatgttcttcgtatcataaacgagcctaccgcggcatcgttggcatatggtttcgn 558 ||||| ||||| || || ||||| ||||| || || ||||| | || |||||||| | Sbjct: 714 attggaagttctccgcattataaatgagccgactgctgcatcccttgcttatggttttga 773 Query: 559 nnnnnngaacaatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctc 618 ||||| ||||| ||||| || ||||| ||||||| || |||||||||||||| Sbjct: 774 gaagaaaaacaacgaaacgattcttgtgtttgacttgggaggcggtacctttgatgtctc 833
>gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OJ1234_D05, complete sequence Length = 107476 Score = 402 bits (203), Expect = e-109 Identities = 316/351 (90%), Gaps = 2/351 (0%) Strand = Plus / Plus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 ||||||| ||||||||||||||| ||||||||||||||||| |||||||||| ||||||| Sbjct: 32641 aggtggtcgggatcgacctcggg-accaccaactccgcggtggcggccatgg-agggcgg 32698 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 |||||| |||||||||||||||||||||||||| || ||||||||||||||||| ||||| Sbjct: 32699 caagccgacgatcgtcaccaacgccgagggcgcccgcaccacgccgtcggtcgtcgccta 32758 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 ||||||| |||| |||||| |||||||||||||||||||| | |||||||| |||||||| Sbjct: 32759 caccaagtccggtgaccggctggtggggcagatcgccaagcgacaggcggtcgtcaaccc 32818 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccga 258 |||||||||||||||||| |||||| | ||||||||||| ||||||||||| |||| ||| Sbjct: 32819 ggagaacaccttcttctccgtcaagcgcttcatcggccgcaagatgaacgaagtcgacga 32878 Query: 259 ggagtccaagcaggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcga 318 ||||||||||||||| ||||||||| | || ||||||| |||||||| ||||||||||| Sbjct: 32879 ggagtccaagcaggtctcctaccgcgtcatcagggacgacaacggcaacgtcaagctcga 32938 Query: 319 ttgcccggcaatcggcaagcagttcgctgccgaggagatctctgcacaggt 369 || || || || |||||||||||||| |||||||||||||| || ||||| Sbjct: 32939 ctgtcccgccattggcaagcagttcgccgccgaggagatctccgcccaggt 32989 Score = 196 bits (99), Expect = 6e-47 Identities = 215/256 (83%) Strand = Plus / Plus Query: 365 caggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaag 424 ||||| || |||||| |||| |||||||| |||||||| || || || |||||||| ||| Sbjct: 33754 caggtgcttagaaagctggtggatgatgcatcaaagttcttgaacgataaagtcacaaag 33813 Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 |||||||||||||| || || |||||||||||||| || ||||| || |||||||||||| Sbjct: 33814 gcagtgatcacagtcccagcatatttcaatgactcacaaaggacagcaacaaaagatgct 33873 Query: 485 gggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgttg 544 || || ||||| |||||||| ||||| || ||||||||||||||||| || ||||| ||| Sbjct: 33874 ggccggattgctgggttggaagttctccgcatcataaacgagcctactgcagcatctttg 33933 Query: 545 gcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggaggc 604 |||||||| || | ||||||||| || ||||| |||||||| |||||||||||| Sbjct: 33934 gcatatgggtttgaaaagaagaacaatgagaccattcttgtttttgacctgggaggaggc 33993 Query: 605 acctttgatgtctcag 620 || |||||||| |||| Sbjct: 33994 acatttgatgtttcag 34009
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 402 bits (203), Expect = e-109 Identities = 316/351 (90%), Gaps = 2/351 (0%) Strand = Plus / Plus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 ||||||| ||||||||||||||| ||||||||||||||||| |||||||||| ||||||| Sbjct: 13488595 aggtggtcgggatcgacctcggg-accaccaactccgcggtggcggccatgg-agggcgg 13488652 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 |||||| |||||||||||||||||||||||||| || ||||||||||||||||| ||||| Sbjct: 13488653 caagccgacgatcgtcaccaacgccgagggcgcccgcaccacgccgtcggtcgtcgccta 13488712 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 ||||||| |||| |||||| |||||||||||||||||||| | |||||||| |||||||| Sbjct: 13488713 caccaagtccggtgaccggctggtggggcagatcgccaagcgacaggcggtcgtcaaccc 13488772 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccga 258 |||||||||||||||||| |||||| | ||||||||||| ||||||||||| |||| ||| Sbjct: 13488773 ggagaacaccttcttctccgtcaagcgcttcatcggccgcaagatgaacgaagtcgacga 13488832 Query: 259 ggagtccaagcaggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcga 318 ||||||||||||||| ||||||||| | || ||||||| |||||||| ||||||||||| Sbjct: 13488833 ggagtccaagcaggtctcctaccgcgtcatcagggacgacaacggcaacgtcaagctcga 13488892 Query: 319 ttgcccggcaatcggcaagcagttcgctgccgaggagatctctgcacaggt 369 || || || || |||||||||||||| |||||||||||||| || ||||| Sbjct: 13488893 ctgtcccgccattggcaagcagttcgccgccgaggagatctccgcccaggt 13488943 Score = 196 bits (99), Expect = 6e-47 Identities = 215/256 (83%) Strand = Plus / Plus Query: 365 caggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaag 424 ||||| || |||||| |||| |||||||| |||||||| || || || |||||||| ||| Sbjct: 13489708 caggtgcttagaaagctggtggatgatgcatcaaagttcttgaacgataaagtcacaaag 13489767 Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 |||||||||||||| || || |||||||||||||| || ||||| || |||||||||||| Sbjct: 13489768 gcagtgatcacagtcccagcatatttcaatgactcacaaaggacagcaacaaaagatgct 13489827 Query: 485 gggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgttg 544 || || ||||| |||||||| ||||| || ||||||||||||||||| || ||||| ||| Sbjct: 13489828 ggccggattgctgggttggaagttctccgcatcataaacgagcctactgcagcatctttg 13489887 Query: 545 gcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggaggc 604 |||||||| || | ||||||||| || ||||| |||||||| |||||||||||| Sbjct: 13489888 gcatatgggtttgaaaagaagaacaatgagaccattcttgtttttgacctgggaggaggc 13489947 Query: 605 acctttgatgtctcag 620 || |||||||| |||| Sbjct: 13489948 acatttgatgtttcag 13489963
>dbj|AK072071.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111L16, full insert sequence Length = 2201 Score = 381 bits (192), Expect = e-102 Identities = 477/573 (83%), Gaps = 1/573 (0%) Strand = Plus / Plus Query: 46 accaactccgcggtcgcggccatggnagggcggcaagcccacgatcgtcaccaacgccga 105 |||||||||||||| ||||| |||| ||||||| ||||| ||| || ||||||||||||| Sbjct: 7 accaactccgcggtggcggcgatgg-agggcgggaagccgacggtcatcaccaacgccga 65 Query: 106 gggcgcgcggaccacgccgtcggtcgtggcctacaccaaggccggagaccggttggtggg 165 || | |||||| ||||| || || ||||| |||||||||| ||| || ||| |||| || Sbjct: 66 ggaccagcggacgacgccctccgtggtggcgtacaccaagggcggggagcggctggtcgg 125 Query: 166 gcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaagag 225 ||||||||||||| ||||||| || |||||||||||||||||||||||||| |||||| | Sbjct: 126 gcagatcgccaagcggcaggccgtcgtcaacccggagaacaccttcttctccgtcaagcg 185 Query: 226 gttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggtttcctaccgcct 285 ||||||||||| |||||| |||||||| ||| ||| |||||||||| ||||||| | | Sbjct: 186 cttcatcggccgcaagatggccgaggtcgacgacgaggccaagcaggtctcctaccacgt 245 Query: 286 tgtccgggacgataacggcaatgtcaagctcgattgcccggcaatcggcaagcagttcgc 345 ||||| ||||| |||||||| ||||||||||| ||||| || ||||||||||||||||| Sbjct: 246 cgtccgcgacgacaacggcaacgtcaagctcgactgccccgccatcggcaagcagttcgc 305 Query: 346 tgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttttt 405 ||||||||||| || || |||||| |||| |||||||| || ||||| || |||||||| Sbjct: 306 cgccgaggagatttccgcgcaggtcttgaggaagttggtggacgatgcatctaagttttt 365 Query: 406 aaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 ||||||||| | ||||| |||||| | || |||||||| || ||||||||||| ||||| Sbjct: 366 gaatgacaaaattaccaaagcagtggttactgttcctgcatacttcaatgactcacagag 425 Query: 466 gacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaacga 525 ||| || |||||||||||||| || |||||||| ||||| ||||| || || ||||| || Sbjct: 426 gacagcaacaaaagatgctggacgtattgcaggattggaagttctccgcattataaatga 485 Query: 526 gcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctggt 585 ||| || || ||||| | || |||||||| | ||||| ||||| ||||| || Sbjct: 486 gccgactgctgcatcccttgcttatggttttgagaagaaaaacaacgaaacgattcttgt 545 Query: 586 ttttgatctgggaggaggcacctttgatgtctc 618 ||||| ||||||| || |||||||||||||| Sbjct: 546 gtttgacttgggaggcggtacctttgatgtctc 578
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 307 bits (155), Expect = 2e-80 Identities = 295/339 (87%), Gaps = 2/339 (0%) Strand = Plus / Plus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 ||||||||||||||||||||||| || |||||||||||||| ||||| |||| ||||||| Sbjct: 7985443 aggtggtggggatcgacctcggg-acgaccaactccgcggtggcggcgatgg-agggcgg 7985500 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 ||||| ||| || ||||||||||||||||| |||||| ||||| || || ||||| || Sbjct: 7985501 gaagccgacggtcatcaccaacgccgagggccagcggacgacgccctccgtggtggcgta 7985560 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 |||||||| ||| || ||| |||| ||||||||||||||| ||||||| || |||||||| Sbjct: 7985561 caccaagggcggggagcggctggtcgggcagatcgccaagcggcaggccgtcgtcaaccc 7985620 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccga 258 |||||||||||||||||| |||||| | ||||||||||| |||||| |||||||| ||| Sbjct: 7985621 ggagaacaccttcttctccgtcaagcgcttcatcggccgcaagatggccgaggtcgacga 7985680 Query: 259 ggagtccaagcaggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcga 318 ||| |||||||||| ||||||| | | ||||| ||||| |||||||| ||||||||||| Sbjct: 7985681 cgaggccaagcaggtctcctaccacgtcgtccgcgacgacaacggcaacgtcaagctcga 7985740 Query: 319 ttgcccggcaatcggcaagcagttcgctgccgaggagat 357 ||||| || ||||||||||||||||| ||||||||||| Sbjct: 7985741 ctgccccgccatcggcaagcagttcgccgccgaggagat 7985779 Score = 123 bits (62), Expect = 7e-25 Identities = 205/255 (80%) Strand = Plus / Plus Query: 364 acaggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaa 423 ||||||| |||| |||||||| || ||||| || |||||||| ||||||||| | ||||| Sbjct: 7986632 acaggtcttgaggaagttggtggacgatgcatctaagtttttgaatgacaaaattaccaa 7986691 Query: 424 ggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgc 483 |||||| | || |||||||| || ||||||||||| |||||||| || ||||||||||| Sbjct: 7986692 agcagtggttactgttcctgcatacttcaatgactcacagaggacagcaacaaaagatgc 7986751 Query: 484 tgggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgtt 543 ||| || |||||||| ||||| ||||| || || ||||| ||||| || || ||||| | Sbjct: 7986752 tggacgtattgcaggattggaagttctccgcattataaatgagccgactgctgcatccct 7986811 Query: 544 ggcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggagg 603 || |||||||| | ||||| ||||| ||||| || ||||| ||||||| || Sbjct: 7986812 tgcttatggttttgagaagaaaaacaacgaaacgattcttgtgtttgacttgggaggcgg 7986871 Query: 604 cacctttgatgtctc 618 |||||||||||||| Sbjct: 7986872 tacctttgatgtctc 7986886
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 307 bits (155), Expect = 2e-80 Identities = 295/339 (87%), Gaps = 2/339 (0%) Strand = Plus / Plus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 ||||||||||||||||||||||| || |||||||||||||| ||||| |||| ||||||| Sbjct: 7985324 aggtggtggggatcgacctcggg-acgaccaactccgcggtggcggcgatgg-agggcgg 7985381 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 ||||| ||| || ||||||||||||||||| |||||| ||||| || || ||||| || Sbjct: 7985382 gaagccgacggtcatcaccaacgccgagggccagcggacgacgccctccgtggtggcgta 7985441 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 |||||||| ||| || ||| |||| ||||||||||||||| ||||||| || |||||||| Sbjct: 7985442 caccaagggcggggagcggctggtcgggcagatcgccaagcggcaggccgtcgtcaaccc 7985501 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccga 258 |||||||||||||||||| |||||| | ||||||||||| |||||| |||||||| ||| Sbjct: 7985502 ggagaacaccttcttctccgtcaagcgcttcatcggccgcaagatggccgaggtcgacga 7985561 Query: 259 ggagtccaagcaggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcga 318 ||| |||||||||| ||||||| | | ||||| ||||| |||||||| ||||||||||| Sbjct: 7985562 cgaggccaagcaggtctcctaccacgtcgtccgcgacgacaacggcaacgtcaagctcga 7985621 Query: 319 ttgcccggcaatcggcaagcagttcgctgccgaggagat 357 ||||| || ||||||||||||||||| ||||||||||| Sbjct: 7985622 ctgccccgccatcggcaagcagttcgccgccgaggagat 7985660 Score = 123 bits (62), Expect = 7e-25 Identities = 205/255 (80%) Strand = Plus / Plus Query: 364 acaggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaa 423 ||||||| |||| |||||||| || ||||| || |||||||| ||||||||| | ||||| Sbjct: 7986513 acaggtcttgaggaagttggtggacgatgcatctaagtttttgaatgacaaaattaccaa 7986572 Query: 424 ggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgc 483 |||||| | || |||||||| || ||||||||||| |||||||| || ||||||||||| Sbjct: 7986573 agcagtggttactgttcctgcatacttcaatgactcacagaggacagcaacaaaagatgc 7986632 Query: 484 tgggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgtt 543 ||| || |||||||| ||||| ||||| || || ||||| ||||| || || ||||| | Sbjct: 7986633 tggacgtattgcaggattggaagttctccgcattataaatgagccgactgctgcatccct 7986692 Query: 544 ggcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggagg 603 || |||||||| | ||||| ||||| ||||| || ||||| ||||||| || Sbjct: 7986693 tgcttatggttttgagaagaaaaacaacgaaacgattcttgtgtttgacttgggaggcgg 7986752 Query: 604 cacctttgatgtctc 618 |||||||||||||| Sbjct: 7986753 tacctttgatgtctc 7986767
>emb|AL831810.4|CNS08CAN Oryza sativa chromosome 12, . BAC OSJNBa0077B14 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 153111 Score = 307 bits (155), Expect = 2e-80 Identities = 295/339 (87%), Gaps = 2/339 (0%) Strand = Plus / Minus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 ||||||||||||||||||||||| || |||||||||||||| ||||| |||| ||||||| Sbjct: 14727 aggtggtggggatcgacctcggg-acgaccaactccgcggtggcggcgatgg-agggcgg 14670 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 ||||| ||| || ||||||||||||||||| |||||| ||||| || || ||||| || Sbjct: 14669 gaagccgacggtcatcaccaacgccgagggccagcggacgacgccctccgtggtggcgta 14610 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 |||||||| ||| || ||| |||| ||||||||||||||| ||||||| || |||||||| Sbjct: 14609 caccaagggcggggagcggctggtcgggcagatcgccaagcggcaggccgtcgtcaaccc 14550 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccga 258 |||||||||||||||||| |||||| | ||||||||||| |||||| |||||||| ||| Sbjct: 14549 ggagaacaccttcttctccgtcaagcgcttcatcggccgcaagatggccgaggtcgacga 14490 Query: 259 ggagtccaagcaggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcga 318 ||| |||||||||| ||||||| | | ||||| ||||| |||||||| ||||||||||| Sbjct: 14489 cgaggccaagcaggtctcctaccacgtcgtccgcgacgacaacggcaacgtcaagctcga 14430 Query: 319 ttgcccggcaatcggcaagcagttcgctgccgaggagat 357 ||||| || ||||||||||||||||| ||||||||||| Sbjct: 14429 ctgccccgccatcggcaagcagttcgccgccgaggagat 14391 Score = 123 bits (62), Expect = 7e-25 Identities = 205/255 (80%) Strand = Plus / Minus Query: 364 acaggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaa 423 ||||||| |||| |||||||| || ||||| || |||||||| ||||||||| | ||||| Sbjct: 13538 acaggtcttgaggaagttggtggacgatgcatctaagtttttgaatgacaaaattaccaa 13479 Query: 424 ggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgc 483 |||||| | || |||||||| || ||||||||||| |||||||| || ||||||||||| Sbjct: 13478 agcagtggttactgttcctgcatacttcaatgactcacagaggacagcaacaaaagatgc 13419 Query: 484 tgggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgtt 543 ||| || |||||||| ||||| ||||| || || ||||| ||||| || || ||||| | Sbjct: 13418 tggacgtattgcaggattggaagttctccgcattataaatgagccgactgctgcatccct 13359 Query: 544 ggcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggagg 603 || |||||||| | ||||| ||||| ||||| || ||||| ||||||| || Sbjct: 13358 tgcttatggttttgagaagaaaaacaacgaaacgattcttgtgtttgacttgggaggcgg 13299 Query: 604 cacctttgatgtctc 618 |||||||||||||| Sbjct: 13298 tacctttgatgtctc 13284
>gb|BT024111.1| Zea mays clone EL01N0516B01 mRNA sequence Length = 2060 Score = 238 bits (120), Expect = 2e-59 Identities = 425/529 (80%) Strand = Plus / Plus Query: 90 tcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggcctacaccaaggccg 149 ||||||||||||||||||||||||| || || || || || ||||| ||||||| | | Sbjct: 6 tcgtcaccaacgccgagggcgcgcgcacaactccctccgtagtggcgtacaccattacag 65 Query: 150 gagaccggttggtggggcagatcgccaagaggcaggcggtggtcaacccggagaacacct 209 | || || |||||||||||||||| ||| | |||||||| || ||||| |||||||||| Sbjct: 66 gggagcgcctggtggggcagatcgctaagcgccaggcggtcgtgaaccccgagaacacct 125 Query: 210 tcttctcagtcaagaggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagc 269 ||||||| |||||| | ||||||||||| |||||| ||||||| ||| ||| |||||| Sbjct: 126 tcttctctgtcaagcgcttcatcggccgcaagatgtctgaggtcgacgacgaggccaagc 185 Query: 270 aggtttcctaccgccttgtccgggacgataacggcaatgtcaagctcgattgcccggcaa 329 |||| || ||| || ||||| ||||| |||||||| ||||| ||||| ||||| || | Sbjct: 186 aggtctcgtacggcgttgtcaaagacgagaacggcaacgtcaaactcgactgccccgcta 245 Query: 330 tcggcaagcagttcgctgccgaggagatctctgcacaggtcctgagaaagttggttgatg 389 | ||||| ||||| |||||||||||||||||||| | || |||| |||||||| |||| Sbjct: 246 ttggcaaacagtttgctgccgaggagatctctgcgcttgttttgaggaagttggtggatg 305 Query: 390 atgcgtcaaagtttttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatt 449 |||| || |||||| | ||||| ||| | || || |||||| | ||||| || || || | Sbjct: 306 atgcatctaagtttcttaatgagaaaattacaaaagcagtggttacagtaccagcatact 365 Query: 450 tcaatgactcccagaggacggctacaaaagatgctgggcgcattgcagggttggatgttc 509 ||||||| || || ||||| || || ||||||||||| ||||||||||| |||| |||| Sbjct: 366 tcaatgattcacaaaggacagcaactaaagatgctggccgcattgcaggactggaagttc 425 Query: 510 ttcgtatcataaacgagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaaca 569 | || || ||||| || || || || ||||| ||||| ||||| |||| || | Sbjct: 426 tccgaattataaatgaaccaactgctgcatcattggcctatgggttcgagaagaaaaata 485 Query: 570 atgaaacaattctggtttttgatctgggaggaggcacctttgatgtctc 618 ||||||||||||| || |||||| ||||||| || |||||||||||||| Sbjct: 486 atgaaacaattctagtgtttgatttgggaggtggtacctttgatgtctc 534
>gb|M99565.1|SPI80HSP Spinach 80 kDa heat shock protein (HSP80) mRNA, 3' end Length = 2040 Score = 172 bits (87), Expect = 9e-40 Identities = 260/320 (81%) Strand = Plus / Plus Query: 305 aatgtcaagctcgattgcccggcaatcggcaagcagttcgctgccgaggagatctctgca 364 ||||||||||| || ||||| || || || || ||||| ||||| || ||||||||||| Sbjct: 130 aatgtcaagcttgagtgccctgctattggtaaacagtttgctgcggaagagatctctgct 189 Query: 365 caggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaag 424 || ||| ||||||| | ||||||||||| ||||||||||| ||||||||||| || ||| Sbjct: 190 caagtcttgagaaaacttgttgatgatgcatcaaagtttttgaatgacaaagtaactaag 249 Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 || || ||||||| ||||| ||||||||||| || || ||||| || ||||| ||||| Sbjct: 250 gccgtagtcacagtgcctgcgtatttcaatgattctcaaaggacagcaacaaaggatgca 309 Query: 485 gggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgttg 544 ||||||||||| || ||||| || ||||| ||||| ||||||||||| || || || ||| Sbjct: 310 gggcgcattgctggtttggaagtccttcgaatcatcaacgagcctactgctgcctctttg 369 Query: 545 gcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggaggc 604 || ||||| || | |||||||||||| ||| |||| ||||| || ||||| || Sbjct: 370 gcttatgggtttgaaaagaagaacaatgaaactattttggtgtttgaccttggaggtggt 429 Query: 605 acctttgatgtctcagttct 624 ||||||||||| |||||||| Sbjct: 430 acctttgatgtgtcagttct 449
>gb|AF035456.1|AF035456 Spinacia oleracea heat shock 70 protein (HSC70-9) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 2574 Score = 165 bits (83), Expect = 2e-37 Identities = 259/320 (80%) Strand = Plus / Plus Query: 305 aatgtcaagctcgattgcccggcaatcggcaagcagttcgctgccgaggagatctctgca 364 ||||||||||| || ||||| || || || || ||||| ||||| || ||||||||||| Sbjct: 671 aatgtcaagcttgagtgccctgctattggtaaacagtttgctgcggaagagatctctgct 730 Query: 365 caggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtcaccaag 424 || || ||||||| | ||||||||||| ||||||||||| ||||||||||| || ||| Sbjct: 731 caagtgttgagaaaacttgttgatgatgcatcaaagtttttgaatgacaaagtaactaag 790 Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 || || ||||||| ||||| ||||||||||| || || ||||| || ||||| ||||| Sbjct: 791 gccgtagtcacagtgcctgcgtatttcaatgattctcaaaggacagcaacaaaggatgca 850 Query: 485 gggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcgttg 544 ||||||||||| || ||||| || ||||| ||||| ||||||||||| || || || ||| Sbjct: 851 gggcgcattgctggtttggaagtccttcgaatcatcaacgagcctactgctgcctctttg 910 Query: 545 gcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggaggaggc 604 || ||||| || | |||||||||||| ||| |||| ||||| || ||||| || Sbjct: 911 gcttatgggtttgaaaagaagaacaatgaaactattttggtgtttgaccttggaggtggt 970 Query: 605 acctttgatgtctcagttct 624 ||||||||||| |||||||| Sbjct: 971 acctttgatgtgtcagttct 990
>gb|AY104911.1| Zea mays PCO138533 mRNA sequence Length = 1751 Score = 155 bits (78), Expect = 2e-34 Identities = 170/203 (83%) Strand = Plus / Plus Query: 422 aaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagat 481 ||||||||||||||||| |||||||| ||||| || || || ||||| || || |||||| Sbjct: 2 aaggcagtgatcacagtccctgcttacttcaacgattcacaaaggacagcaaccaaagat 61 Query: 482 gctgggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggcatcg 541 ||||| |||||||| ||| |||| ||||| ||||| ||||| ||||||||||| ||||| Sbjct: 62 gctggccgcattgctgggctggaggttctgcgtattataaatgagcctaccgccgcatca 121 Query: 542 ttggcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctgggagga 601 | ||||||||||| | ||||||||||||||||||||||||||| || ||||| Sbjct: 122 ctagcatatggttttgagaaaaagaacaatgaaacaattctggtttttgacctcggaggt 181 Query: 602 ggcacctttgatgtctcagttct 624 |||||||| ||||| |||||||| Sbjct: 182 ggcaccttcgatgtttcagttct 204
>gb|BT016772.1| Zea mays clone Contig605 mRNA sequence Length = 1938 Score = 149 bits (75), Expect = 1e-32 Identities = 257/320 (80%) Strand = Plus / Plus Query: 299 aacggcaatgtcaagctcgattgcccggcaatcggcaagcagttcgctgccgaggagatc 358 |||||||| ||||| ||||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 51 aacggcaacgtcaaactcgactgccccgctattggcaaacagtttgctgccgaggagatc 110 Query: 359 tctgcacaggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaagtc 418 ||||| ||||| |||| |||||||| |||||||| || |||||| | ||||| ||| | Sbjct: 111 tctgcgcaggttttgaggaagttggtggatgatgcatctaagtttcttaatgagaaaatt 170 Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 || || |||||| | ||||| || || || |||||||| || || ||||| || || ||| Sbjct: 171 acaaaagcagtggttacagtaccagcatacttcaatgattcacaaaggacagcaactaaa 230 Query: 479 gatgctgggcgcattgcagggttggatgttcttcgtatcataaacgagcctaccgcggca 538 |||||||| ||||||||||| |||| ||||| || || ||||| || || || || ||| Sbjct: 231 gatgctggccgcattgcaggactggaagttctccgaattataaatgaaccaactgctgca 290 Query: 539 tcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctggtttttgatctggga 598 || ||||| ||||| |||| || |||||||||||||| || |||||| ||||| Sbjct: 291 tcattggcctatgggttcgagaagaaaaataatgaaacaattctagtgtttgatttggga 350 Query: 599 ggaggcacctttgatgtctc 618 || || |||||||||||||| Sbjct: 351 ggtggtacctttgatgtctc 370
>gb|AF039083.1|AF039083 Spinacia oleracea heat shock 70 protein (HSC70-9) gene, nuclear gene encoding chloroplast protein, complete cds Length = 4316 Score = 137 bits (69), Expect = 5e-29 Identities = 194/238 (81%) Strand = Plus / Plus Query: 383 gttgatgatgcgtcaaagtttttaaatgacaaagtcaccaaggcagtgatcacagttcct 442 ||||||||||| ||||||||||| ||||||||||| || ||||| || ||||||| ||| Sbjct: 1366 gttgatgatgcatcaaagtttttgaatgacaaagtaactaaggccgtagtcacagtgcct 1425 Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatgctgggcgcattgcagggttg 502 || ||||||||||| || || ||||| || ||||| ||||| ||||||||||| || ||| Sbjct: 1426 gcgtatttcaatgattctcaaaggacagcaacaaaggatgcagggcgcattgctggtttg 1485 Query: 503 gatgttcttcgtatcataaacgagcctaccgcggcatcgttggcatatggtttcgnnnnn 562 || || ||||| ||||| ||||||||||| || || || ||||| ||||| || | Sbjct: 1486 gaagtccttcgaatcatcaacgagcctactgctgcctctttggcttatgggtttgaaaag 1545 Query: 563 nngaacaatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcag 620 |||||||||||| ||| |||| ||||| || ||||| || ||||||||||| |||| Sbjct: 1546 aagaacaatgaaactattttggtgtttgaccttggaggtggtacctttgatgtgtcag 1603
>gb|AY072744.1| Dunaliella salina heat shock protein 70B (hsp70B) mRNA, complete cds Length = 2732 Score = 113 bits (57), Expect = 7e-22 Identities = 162/196 (82%), Gaps = 1/196 (0%) Strand = Plus / Plus Query: 39 gggnaccaccaactccgcggtcgcggccatggnagggcggcaagcccacgatcgtcacca 98 ||| |||||||||||||| || || || |||| |||| ||||||||||||||| || ||| Sbjct: 168 gggaaccaccaactccgctgtggcagcgatgg-agggaggcaagcccacgatcatcgcca 226 Query: 99 acgccgagggcgcgcggaccacgccgtcggtcgtggcctacaccaaggccggagaccggt 158 |||||||||| || ||||| || || || ||||||| |||||||| ||| ||||| Sbjct: 227 acgccgagggtagccgcaccaccccctccgtggtggccttcaccaagggcggtgaccgcc 286 Query: 159 tggtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcag 218 |||| || |||||||||||| | || || ||||| ||||| ||||||||||||||||| | Sbjct: 287 tggttggacagatcgccaagcgccaagccgtggtgaacccagagaacaccttcttctccg 346 Query: 219 tcaagaggttcatcgg 234 ||||| | |||||||| Sbjct: 347 tcaagcgtttcatcgg 362
>emb|AJ271605.2|DSA271605 Dunaliella salina mRNA for chloroplast-localised heat shock protein (hsp70B gene) Length = 2764 Score = 105 bits (53), Expect = 2e-19 Identities = 177/216 (81%), Gaps = 2/216 (0%) Strand = Plus / Plus Query: 19 aggtggtggggatcgacctcgggnaccaccaactccgcggtcgcggccatggnagggcgg 78 |||||||||| |||||| | ||| |||||||||||||| || || || |||| |||| || Sbjct: 205 aggtggtgggcatcgactt-gggaaccaccaactccgctgtggcagcgatgg-agggagg 262 Query: 79 caagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtggccta 138 |||||| || ||| |||||||||| ||||| || ||||| || || || ||||||| Sbjct: 263 caagccgaccatcatcaccaacgctgagggtagccgcaccaccccctccgtggtggcctt 322 Query: 139 caccaaggccggagaccggttggtggggcagatcgccaagaggcaggcggtggtcaaccc 198 |||||||| ||| ||||| |||| || |||||||||||| | || || ||||| ||||| Sbjct: 323 caccaagggcggtgaccgcctggttggacagatcgccaagcgccaagccgtggtgaaccc 382 Query: 199 ggagaacaccttcttctcagtcaagaggttcatcgg 234 ||||||||||||||||| |||||| | |||||||| Sbjct: 383 agagaacaccttcttctccgtcaagcgtttcatcgg 418
>ref|NM_118561.2| Arabidopsis thaliana CPHSC70-1; ATP binding AT4G24280 (CPHSC70-1) mRNA, complete cds Length = 2456 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 410 gacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacg 469 |||||||| |||||||| || ||||| || |||||||| ||||| || || |||||||| Sbjct: 731 gacaaagtaaccaaggctgtcatcactgtgcctgcttacttcaacgattcacagaggaca 790 Query: 470 gctacaaaagatgctgggcgcattgcagggttggatgttcttcgtat 516 ||||||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 791 gctacaaaagatgctggtcgaattgctgggttggaagttcttcgtat 837 Score = 58.0 bits (29), Expect = 4e-05 Identities = 92/113 (81%) Strand = Plus / Plus Query: 164 gggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaag 223 |||||||| || |||||||| || || || || || ||||| || ||||||||||| ||| Sbjct: 485 gggcagattgcgaagaggcaagctgttgttaatcccgagaatactttcttctcagtgaag 544 Query: 224 aggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggtttc 276 ||||| || || | |||||||||||||| | || ||||| ||||||||||| Sbjct: 545 aggtttattggtaggaagatgaacgaggttgatgaagagtctaagcaggtttc 597 Score = 44.1 bits (22), Expect = 0.54 Identities = 46/54 (85%) Strand = Plus / Plus Query: 568 caatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagt 621 |||||||||||| || || || ||||| || || || ||||||||||||||||| Sbjct: 889 caatgaaacaatcctagtcttcgatcttggtggtggtacctttgatgtctcagt 942
>gb|AY072138.1| Arabidopsis thaliana putative hsp 70 protein (At4g24280) mRNA, complete cds Length = 2495 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 410 gacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacg 469 |||||||| |||||||| || ||||| || |||||||| ||||| || || |||||||| Sbjct: 732 gacaaagtaaccaaggctgtcatcactgtgcctgcttacttcaacgattcacagaggaca 791 Query: 470 gctacaaaagatgctgggcgcattgcagggttggatgttcttcgtat 516 ||||||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 792 gctacaaaagatgctggtcgaattgctgggttggaagttcttcgtat 838 Score = 58.0 bits (29), Expect = 4e-05 Identities = 92/113 (81%) Strand = Plus / Plus Query: 164 gggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaag 223 |||||||| || |||||||| || || || || || ||||| || ||||||||||| ||| Sbjct: 486 gggcagattgcgaagaggcaagctgttgttaatcccgagaatactttcttctcagtgaag 545 Query: 224 aggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggtttc 276 ||||| || || | |||||||||||||| | || ||||| ||||||||||| Sbjct: 546 aggtttattggtaggaagatgaacgaggttgatgaagagtctaagcaggtttc 598 Score = 44.1 bits (22), Expect = 0.54 Identities = 46/54 (85%) Strand = Plus / Plus Query: 568 caatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagt 621 |||||||||||| || || || ||||| || || || ||||||||||||||||| Sbjct: 890 caatgaaacaatcctagtcttcgatcttggtggtggtacctttgatgtctcagt 943
>emb|AL078637.1|ATT22A6 Arabidopsis thaliana DNA chromosome 4, BAC clone T22A6 (ESSA project) Length = 108459 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 410 gacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacg 469 |||||||| |||||||| || ||||| || |||||||| ||||| || || |||||||| Sbjct: 42098 gacaaagtaaccaaggctgtcatcactgtgcctgcttacttcaacgattcacagaggaca 42157 Query: 470 gctacaaaagatgctgggcgcattgcagggttggatgttcttcgtat 516 ||||||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 42158 gctacaaaagatgctggtcgaattgctgggttggaagttcttcgtat 42204 Score = 58.0 bits (29), Expect = 4e-05 Identities = 92/113 (81%) Strand = Plus / Plus Query: 164 gggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaag 223 |||||||| || |||||||| || || || || || ||||| || ||||||||||| ||| Sbjct: 41523 gggcagattgcgaagaggcaagctgttgttaatcccgagaatactttcttctcagtgaag 41582 Query: 224 aggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggtttc 276 ||||| || || | |||||||||||||| | || ||||| ||||||||||| Sbjct: 41583 aggtttattggtaggaagatgaacgaggttgatgaagagtctaagcaggtttc 41635 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Plus Query: 568 caatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcag 620 |||||||||||| || || || ||||| || || || |||||||||||||||| Sbjct: 42256 caatgaaacaatcctagtcttcgatcttggtggtggtacctttgatgtctcag 42308
>emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 61 Length = 198402 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 410 gacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacg 469 |||||||| |||||||| || ||||| || |||||||| ||||| || || |||||||| Sbjct: 58755 gacaaagtaaccaaggctgtcatcactgtgcctgcttacttcaacgattcacagaggaca 58814 Query: 470 gctacaaaagatgctgggcgcattgcagggttggatgttcttcgtat 516 ||||||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 58815 gctacaaaagatgctggtcgaattgctgggttggaagttcttcgtat 58861 Score = 58.0 bits (29), Expect = 4e-05 Identities = 92/113 (81%) Strand = Plus / Plus Query: 164 gggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaag 223 |||||||| || |||||||| || || || || || ||||| || ||||||||||| ||| Sbjct: 58180 gggcagattgcgaagaggcaagctgttgttaatcccgagaatactttcttctcagtgaag 58239 Query: 224 aggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggtttc 276 ||||| || || | |||||||||||||| | || ||||| ||||||||||| Sbjct: 58240 aggtttattggtaggaagatgaacgaggttgatgaagagtctaagcaggtttc 58292 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Plus Query: 568 caatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcag 620 |||||||||||| || || || ||||| || || || |||||||||||||||| Sbjct: 58913 caatgaaacaatcctagtcttcgatcttggtggtggtacctttgatgtctcag 58965
>gb|BT001950.1| Arabidopsis thaliana clone U19959 putative hsp 70 protein (At4g24280) mRNA, complete cds Length = 2188 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 410 gacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacg 469 |||||||| |||||||| || ||||| || |||||||| ||||| || || |||||||| Sbjct: 625 gacaaagtaaccaaggctgtcatcactgtgcctgcttacttcaacgattcacagaggaca 684 Query: 470 gctacaaaagatgctgggcgcattgcagggttggatgttcttcgtat 516 ||||||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 685 gctacaaaagatgctggtcgaattgctgggttggaagttcttcgtat 731 Score = 58.0 bits (29), Expect = 4e-05 Identities = 92/113 (81%) Strand = Plus / Plus Query: 164 gggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaag 223 |||||||| || |||||||| || || || || || ||||| || ||||||||||| ||| Sbjct: 379 gggcagattgcgaagaggcaagctgttgttaatcccgagaatactttcttctcagtgaag 438 Query: 224 aggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggtttc 276 ||||| || || | |||||||||||||| | || ||||| ||||||||||| Sbjct: 439 aggtttattggtaggaagatgaacgaggttgatgaagagtctaagcaggtttc 491 Score = 44.1 bits (22), Expect = 0.54 Identities = 46/54 (85%) Strand = Plus / Plus Query: 568 caatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagt 621 |||||||||||| || || || ||||| || || || ||||||||||||||||| Sbjct: 783 caatgaaacaatcctagtcttcgatcttggtggtggtacctttgatgtctcagt 836
>gb|L03299.1|PEA70HSP Pisum sativum chloroplast stromal 70 kDa heat shock protein (hsp70) mRNA, complete cds Length = 2474 Score = 101 bits (51), Expect = 3e-18 Identities = 291/371 (78%) Strand = Plus / Plus Query: 116 accacgccgtcggtcgtggcctacaccaaggccggagaccggttggtggggcagatcgcc 175 |||||||| || || ||||| ||||||||| ||| || ||||||| || || || ||| Sbjct: 346 accacgccatctgtggtggcgtacaccaagaacggtgataggttggtcggtcaaattgcc 405 Query: 176 aagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaagaggttcatcggc 235 ||| |||||||||| || || || |||||||| || ||||| ||||||||||| || || Sbjct: 406 aagcggcaggcggttgtgaatcccgagaacacgtttttctccgtcaagaggtttattgga 465 Query: 236 cgaaagatgaacgaggtcgccgaggagtccaagcaggtttcctaccgccttgtccgggac 295 || |||||| ||||| | ||| ||||| |||||||| || ||| | || || | ||| Sbjct: 466 cggaagatgtctgaggttgacgaagagtcaaagcaggtctcttacagagttatcagagac 525 Query: 296 gataacggcaatgtcaagctcgattgcccggcaatcggcaagcagttcgctgccgaggag 355 ||||||||||| || || |||||||| || || ||||| || || || || || || Sbjct: 526 gataacggcaacgttaaactcgattgtcctgctatcggtaaatcttttgcagctgaagaa 585 Query: 356 atctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagtttttaaatgacaaa 415 || ||||| ||||| | || ||| | ||||||||||| ||||| ||||| ||||| ||| Sbjct: 586 atttctgctcaggttttaaggaagcttgttgatgatgcttcaaaatttttgaatgataaa 645 Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 || |||||||| ||| | || || |||||||| |||||||| || || ||||| |||||| Sbjct: 646 gtaaccaaggctgtggttactgtgcctgcttacttcaatgattcacaaaggactgctaca 705 Query: 476 aaagatgctgg 486 || |||||||| Sbjct: 706 aaggatgctgg 716 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Plus Query: 566 aacaatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| ||| |||| ||||| || ||||| || || |||||||||||||| Sbjct: 796 aacaatgaaactattttggtatttgaccttggaggtggtacttttgatgtctcagt 851
>ref|NM_124369.2| Arabidopsis thaliana cpHSC70-2 (HEAT SHOCK PROTEIN 70-7); ATP binding AT5G49910 (cpHSC70-2) mRNA, complete cds Length = 2731 Score = 89.7 bits (45), Expect = 1e-14 Identities = 218/278 (78%) Strand = Plus / Plus Query: 344 gctgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttt 403 ||||| |||||||| ||||| ||||| |||| ||| | || |||||||| || | ||| Sbjct: 615 gctgctgaggagatttctgctcaggttttgaggaagcttgtggatgatgcttcgagattt 674 Query: 404 ttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 || ||||| ||||| || || || || ||||| || |||||||| |||||||| || || Sbjct: 675 ttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattcacaa 734 Query: 464 aggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaac 523 ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || || Sbjct: 735 aggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattattaat 794 Query: 524 gagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctg 583 |||||||| || || || ||||| ||||| || | | ||||||||| ||||| Sbjct: 795 gagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactattctt 854 Query: 584 gtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| || || || || |||||||||||||| Sbjct: 855 gtttttgatcttggtggtggtacttttgatgtctcagt 892
>gb|BT000919.1| Arabidopsis thaliana clone C105236 putative heat shock protein 70 (At5g49910) mRNA, complete cds Length = 2187 Score = 89.7 bits (45), Expect = 1e-14 Identities = 218/278 (78%) Strand = Plus / Plus Query: 344 gctgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttt 403 ||||| |||||||| ||||| ||||| |||| ||| | || |||||||| || | ||| Sbjct: 559 gctgctgaggagatttctgctcaggttttgaggaagcttgtggatgatgcttcgagattt 618 Query: 404 ttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 || ||||| ||||| || || || || ||||| || |||||||| |||||||| || || Sbjct: 619 ttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattcacaa 678 Query: 464 aggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaac 523 ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || || Sbjct: 679 aggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattattaat 738 Query: 524 gagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctg 583 |||||||| || || || ||||| ||||| || | | ||||||||| ||||| Sbjct: 739 gagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactattctt 798 Query: 584 gtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| || || || || |||||||||||||| Sbjct: 799 gtttttgatcttggtggtggtacttttgatgtctcagt 836
>gb|BT008452.1| Arabidopsis thaliana At5g49910 gene, complete cds Length = 1116 Score = 89.7 bits (45), Expect = 1e-14 Identities = 218/278 (78%) Strand = Plus / Plus Query: 344 gctgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttt 403 ||||| |||||||| ||||| ||||| |||| ||| | || |||||||| || | ||| Sbjct: 559 gctgctgaggagatttctgctcaggttttgaggaagcttgtggatgatgcttcgagattt 618 Query: 404 ttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 || ||||| ||||| || || || || ||||| || |||||||| |||||||| || || Sbjct: 619 ttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattcacaa 678 Query: 464 aggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaac 523 ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || || Sbjct: 679 aggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattattaat 738 Query: 524 gagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctg 583 |||||||| || || || ||||| ||||| || | | ||||||||| ||||| Sbjct: 739 gagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactattctt 798 Query: 584 gtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| || || || || |||||||||||||| Sbjct: 799 gtttttgatcttggtggtggtacttttgatgtctcagt 836
>gb|AY081331.1| Arabidopsis thaliana heat shock protein 70 (At5g49910) mRNA, complete cds Length = 1925 Score = 89.7 bits (45), Expect = 1e-14 Identities = 218/278 (78%) Strand = Plus / Plus Query: 344 gctgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttt 403 ||||| |||||||| ||||| ||||| |||| ||| | || |||||||| || | ||| Sbjct: 615 gctgctgaggagatttctgctcaggttttgaggaagcttgtggatgatgcttcgagattt 674 Query: 404 ttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 || ||||| ||||| || || || || ||||| || |||||||| |||||||| || || Sbjct: 675 ttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattcacaa 734 Query: 464 aggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaac 523 ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || || Sbjct: 735 aggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattattaat 794 Query: 524 gagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctg 583 |||||||| || || || ||||| ||||| || | | ||||||||| ||||| Sbjct: 795 gagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactattctt 854 Query: 584 gtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| || || || || |||||||||||||| Sbjct: 855 gtttttgatcttggtggtggtacttttgatgtctcagt 892
>gb|AF217459.1|AF217459 Arabidopsis thaliana heat shock protein 70 (Hsc70-7) mRNA, complete cds; nuclear gene for chloroplast product Length = 2157 Score = 89.7 bits (45), Expect = 1e-14 Identities = 218/278 (78%) Strand = Plus / Plus Query: 344 gctgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttt 403 ||||| |||||||| ||||| ||||| |||| ||| | || |||||||| || | ||| Sbjct: 559 gctgctgaggagatttctgctcaggttttgaggaagcttgtggatgatgcttcgagattt 618 Query: 404 ttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 || ||||| ||||| || || || || ||||| || |||||||| |||||||| || || Sbjct: 619 ttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattcacaa 678 Query: 464 aggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaac 523 ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || || Sbjct: 679 aggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattattaat 738 Query: 524 gagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctg 583 |||||||| || || || ||||| ||||| || | | ||||||||| ||||| Sbjct: 739 gagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactattctt 798 Query: 584 gtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| || || || || |||||||||||||| Sbjct: 799 gtttttgatcttggtggtggtacttttgatgtctcagt 836
>gb|AY080761.1| Arabidopsis thaliana At5g49910 mRNA sequence Length = 2331 Score = 81.8 bits (41), Expect = 2e-12 Identities = 217/278 (78%) Strand = Plus / Plus Query: 344 gctgccgaggagatctctgcacaggtcctgagaaagttggttgatgatgcgtcaaagttt 403 ||||| |||||||| ||||| |||| |||| ||| | || |||||||| || | ||| Sbjct: 615 gctgctgaggagatttctgcttaggttttgaggaagcttgtggatgatgcttcgagattt 674 Query: 404 ttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 || ||||| ||||| || || || || ||||| || |||||||| |||||||| || || Sbjct: 675 ttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattcacaa 734 Query: 464 aggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaac 523 ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || || Sbjct: 735 aggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattattaat 794 Query: 524 gagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaattctg 583 |||||||| || || || ||||| ||||| || | | ||||||||| ||||| Sbjct: 795 gagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactattctt 854 Query: 584 gtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| || || || || |||||||||||||| Sbjct: 855 gtttttgatcttggtggtggtacttttgatgtctcagt 892
>emb|X69213.1|PSST70 P.sativum Psst70 gene for heat-shock protein Length = 4974 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Plus Query: 383 gttgatgatgcgtcaaagtttttaaatgacaaagtcaccaaggcagtgatcacagttcct 442 ||||||||||| ||||| ||||| ||||| ||||| |||||||| ||| | || || ||| Sbjct: 1471 gttgatgatgcttcaaaatttttgaatgataaagtaaccaaggctgtggttactgtgcct 1530 Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||| |||||||| || || ||||| |||||||| |||||||| Sbjct: 1531 gcttacttcaatgattcacaaaggactgctacaaaggatgctgg 1574 Score = 67.9 bits (34), Expect = 4e-08 Identities = 163/206 (79%) Strand = Plus / Plus Query: 116 accacgccgtcggtcgtggcctacaccaaggccggagaccggttggtggggcagatcgcc 175 |||||||| || || ||||| ||||||||| ||| || ||||||| || || || ||| Sbjct: 1075 accacgccatctgtggtggcgtacaccaagaacggtgataggttggtcggtcaaattgcc 1134 Query: 176 aagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaagaggttcatcggc 235 ||| |||||||||| || || || |||||||| || ||||| ||||||||||| || || Sbjct: 1135 aagcggcaggcggttgtgaatcccgagaacacgtttttctccgtcaagaggtttattgga 1194 Query: 236 cgaaagatgaacgaggtcgccgaggagtccaagcaggtttcctaccgccttgtccgggac 295 || |||||| ||||| | ||| ||||| |||||||| || ||| | || || | ||| Sbjct: 1195 cggaagatgtctgaggttgacgaagagtcaaagcaggtctcttacagagttatcagagac 1254 Query: 296 gataacggcaatgtcaagctcgattg 321 ||||||||||| || || |||||||| Sbjct: 1255 gataacggcaacgttaaactcgattg 1280 Score = 46.1 bits (23), Expect = 0.14 Identities = 47/55 (85%) Strand = Plus / Plus Query: 566 aacaatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcag 620 ||||||||||| ||| |||| ||||| || ||||| || || ||||||||||||| Sbjct: 1654 aacaatgaaactattttggtatttgaccttggaggtggtacttttgatgtctcag 1708
>dbj|AB024032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9P8 Length = 70670 Score = 77.8 bits (39), Expect = 4e-11 Identities = 173/220 (78%) Strand = Plus / Plus Query: 401 tttttaaatgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcc 460 ||||| ||||| ||||| || || || || ||||| || |||||||| |||||||| || Sbjct: 34122 tttttgaatgataaagtaacgaaagctgtcatcactgtgcctgcttacttcaatgattca 34181 Query: 461 cagaggacggctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcata 520 || ||||||||||| ||||||||||| || ||||| || ||||| |||||| | || || Sbjct: 34182 caaaggacggctactaaagatgctggtcgtattgctggattggaagttcttaggattatt 34241 Query: 521 aacgagcctaccgcggcatcgttggcatatggtttcgnnnnnnngaacaatgaaacaatt 580 || |||||||| || || || ||||| ||||| || | | ||||||||| ||| Sbjct: 34242 aatgagcctactgctgcttctttggcttatgggtttgagaggaaaagcaatgaaactatt 34301 Query: 581 ctggtttttgatctgggaggaggcacctttgatgtctcag 620 || ||||||||||| || || || || ||||||||||||| Sbjct: 34302 cttgtttttgatcttggtggtggtacttttgatgtctcag 34341
>dbj|AK060410.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-D10, full insert sequence Length = 1581 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 565 gaacaatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||| || ||||| |||||||| |||||||||||||| |||||||| |||||||| Sbjct: 8 gaacaatgagaccattcttgtttttgacctgggaggaggcacatttgatgtttcagttct 67
>gb|AY147870.1| Rhizopus stolonifer 70 kDa heat shock protein 2 gene, complete cds Length = 3080 Score = 67.9 bits (34), Expect = 4e-08 Identities = 37/38 (97%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactccca 462 ||||| |||||||||||||||||||||||||||||||| Sbjct: 1068 gcagtcatcacagttcctgcttatttcaatgactccca 1105
>emb|Y17862.1|MTH17862 Methanosarcina thermophila hsp70 (dnaK) gene Length = 2200 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 434 acagttcctgcttatttcaatgactcccagaggacggctacaaaagatgc 483 |||||||||||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 688 acagttcctgcttatttcaatgacgcccagaggcaggctacaaaggatgc 737
>emb|X77458.1|SCDNAJ S.coelicolor dnaK, grpE and dnaJ genes Length = 5611 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 72 agggcggcaagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcg 131 |||||||| ||||||| || ||||||||||||||||||| ||||||||||||| |||| Sbjct: 1934 agggcggcgagcccaccgtcatcaccaacgccgagggcgccaggaccacgccgtccgtcg 1993 Query: 132 tggcct 137 | |||| Sbjct: 1994 tcgcct 1999
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 72 agggcggcaagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcg 131 |||||||| ||||||| || ||||||||||||||||||| ||||||||||||| |||| Sbjct: 134685 agggcggcgagcccaccgtcatcaccaacgccgagggcgccaggaccacgccgtccgtcg 134626 Query: 132 tggcct 137 | |||| Sbjct: 134625 tcgcct 134620
>gb|AF188289.2| Rhizopus stolonifer Hsp70 protein 2 mRNA, partial cds Length = 2068 Score = 67.9 bits (34), Expect = 4e-08 Identities = 37/38 (97%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactccca 462 ||||| |||||||||||||||||||||||||||||||| Sbjct: 411 gcagtcatcacagttcctgcttatttcaatgactccca 448
>gb|L46700.1|STMDNAK Streptomyces coelicolor DnaK (dnaK), GrpE (grpE), DnaJ (dnaJ), and heat shock protein (hspR) genes, complete cds Length = 4648 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 72 agggcggcaagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcg 131 |||||||| ||||||| || ||||||||||||||||||| ||||||||||||| |||| Sbjct: 258 agggcggcgagcccaccgtcatcaccaacgccgagggcgccaggaccacgccgtccgtcg 317 Query: 132 tggcct 137 | |||| Sbjct: 318 tcgcct 323
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 72 agggcggcaagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcg 131 |||||||| ||||||| || ||||||||||||||||||| ||||||||||||| |||| Sbjct: 5479112 agggcggcgagcccaccgtcatcaccaacgccgagggcgccaggaccacgccgtccgtcg 5479171 Query: 132 tggcct 137 | |||| Sbjct: 5479172 tcgcct 5479177
>gb|AF074969.1|AF074969 Triticum aestivum heat shock protein 70 (HSP70) mRNA, HSP70-S allele, complete cds Length = 1569 Score = 67.9 bits (34), Expect = 4e-08 Identities = 47/50 (94%), Gaps = 1/50 (2%) Strand = Plus / Plus Query: 576 caattctggtttttgatctggg-aggaggcacctttgatgtctcagttct 624 |||||||||||||||| ||||| |||||||||||||||||| |||||||| Sbjct: 9 caattctggtttttgacctggggaggaggcacctttgatgtttcagttct 58
>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7 Length = 344615 Score = 65.9 bits (33), Expect = 1e-07 Identities = 102/125 (81%) Strand = Plus / Minus Query: 113 cggaccacgccgtcggtcgtggcctacaccaaggccggagaccggttggtggggcagatc 172 ||||||||||| || |||||||| ||||||||| | |||| |||||| || |||||| Sbjct: 325190 cggaccacgccctccgtcgtggcttacaccaagaaccaggaccagttggtcggtcagatc 325131 Query: 173 gccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaagaggttcatc 232 |||||| | ||||||||| | || ||||| |||||||| | || |||||| | |||||| Sbjct: 325130 gccaagcgtcaggcggtgatgaatccggacaacaccttttattccgtcaagcgcttcatc 325071 Query: 233 ggccg 237 ||||| Sbjct: 325070 ggccg 325066
>dbj|AB092839.1| Carassius auratus HSP70 mRNA for heat shock protein 70 kDa, partial cds Length = 1958 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagag 465 ||||| |||||||||||||| |||||||||||||||||||| Sbjct: 372 gcagttatcacagttcctgcctatttcaatgactcccagag 412 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgt 615 ||||| ||||||||||||||||||||||| Sbjct: 540 tttgacctgggaggaggcacctttgatgt 568
>gb|AF227986.1|AF227986 Rivulus marmoratus HSC71 gene, complete cds Length = 11037 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactccca 462 ||||| ||||| ||||||||||||||||| |||||||||||||| Sbjct: 6778 accaatgcagttatcacagttcctgcttacttcaatgactccca 6821
>gb|AC140550.31| Medicago truncatula clone mth2-54a24, complete sequence Length = 129388 Score = 61.9 bits (31), Expect = 2e-06 Identities = 183/236 (77%) Strand = Plus / Plus Query: 386 gatgatgcgtcaaagtttttaaatgacaaagtcaccaaggcagtgatcacagttcctgct 445 |||||||| ||||||||||| ||||| ||||| || ||||| || |||| || ||||| Sbjct: 26947 gatgatgcttcaaagtttttgaatgataaagtaactaaggctgtagtcactgtacctgca 27006 Query: 446 tatttcaatgactcccagaggacggctacaaaagatgctgggcgcattgcagggttggat 505 || |||||||| || || ||||| ||||| || ||||| || | ||||| || | || Sbjct: 27007 tacttcaatgattcacaaaggactgctaccaaggatgcaggcaggattgctggtcttgaa 27066 Query: 506 gttcttcgtatcataaacgagcctaccgcggcatcgttggcatatggtttcgnnnnnnng 565 |||||||| || || || || || || || ||||| ||||| |||||||||| Sbjct: 27067 gttcttcgaattatcaatgaaccaactgctgcatccttggcttatggtttcgaaaggaaa 27126 Query: 566 aacaatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagt 621 ||||||||||| ||| |||| ||||| || ||||| || || |||||||||||||| Sbjct: 27127 aacaatgaaaccattttggtctttgaccttggaggtggtacttttgatgtctcagt 27182 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 293 gacgataacggcaatgtcaagctcgattg 321 |||||||||||||| ||||| |||||||| Sbjct: 26769 gacgataacggcaacgtcaaactcgattg 26797 Score = 42.1 bits (21), Expect = 2.2 Identities = 54/65 (83%) Strand = Plus / Plus Query: 167 cagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaagagg 226 ||||| |||||| | ||||| || || || || ||||||||||||||||| || ||||| Sbjct: 26643 cagattgccaagcgtcaggccgtcgttaatcccgagaacaccttcttctctgtgaagaga 26702 Query: 227 ttcat 231 ||||| Sbjct: 26703 ttcat 26707
>emb|X96502.1|CRHSP70B C.reinhardtii hsp70b gene Length = 5598 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 167 cagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtcaagagg 226 ||||| |||||| | ||||| ||||||||||| |||||||| |||||||| || ||| | Sbjct: 1985 cagattgccaagcgccaggctgtggtcaaccccgagaacactttcttctccgtaaagcgc 2044 Query: 227 ttcatcggccg 237 ||||||||||| Sbjct: 2045 ttcatcggccg 2055
>emb|X62240.1|PUDNAK P.purpurea genes dnaK and trnG(GCC) Length = 2175 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 569 aatgaaacaattctggtttttgatctgggaggaggcacctttgatgt 615 |||||||| ||||| ||||||||||| ||||||||||| |||||||| Sbjct: 637 aatgaaactattcttgtttttgatcttggaggaggcacatttgatgt 683
>gb|AF288978.2| Leptinotarsa decemlineata inducible heat shock 70 kDa protein mRNA, partial cds Length = 1863 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgggcgca 491 |||||||||| || ||||||||||| |||||| || ||||||||||||||| ||| || Sbjct: 161 tcacagttccagcatatttcaatgattcccagcggcaggctacaaaagatgcaggggcca 220 Query: 492 ttgcagg 498 ||||||| Sbjct: 221 ttgcagg 227
>gb|U38804.1|PPU38804 Porphyra purpurea chloroplast, complete genome Length = 191028 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 569 aatgaaacaattctggtttttgatctgggaggaggcacctttgatgt 615 |||||||| ||||| ||||||||||| ||||||||||| |||||||| Sbjct: 106768 aatgaaactattcttgtttttgatcttggaggaggcacatttgatgt 106814
>gb|AY120894.1| Cyprinus carpio heat shock protein Hsp70 mRNA, partial cds Length = 1879 Score = 60.0 bits (30), Expect = 9e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagagg 466 ||||| |||||||||||||| || |||||||||||||||||| Sbjct: 400 gcagttatcacagttcctgcctacttcaatgactcccagagg 441 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgt 615 ||||| ||||||||||||||||||||||| Sbjct: 568 tttgacctgggaggaggcacctttgatgt 596
>emb|Y08955.1|CCHSP70PR Ceratitis capitata hsp70 gene for HSP70 protein Length = 3005 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 431 atcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgggcgc 490 |||||||| |||||||||||||||||||| ||| | ||||||||| |||||||| || Sbjct: 1099 atcacagtgcctgcttatttcaatgactcacagcgacaggctacaaaggatgctggtcga 1158 Query: 491 attgc 495 ||||| Sbjct: 1159 attgc 1163
>emb|AJ719486.1| Gallus gallus mRNA for hypothetical protein, clone 2m8 Length = 3084 Score = 58.0 bits (29), Expect = 4e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctggg 487 ||||| ||||||||||||||||||||||| || ||||| ||| || |||||||||||| Sbjct: 930 gtgattacagttcctgcttatttcaatgattctcagagacaggcgacgaaagatgctggg 989 Query: 488 c 488 | Sbjct: 990 c 990
>ref|NM_001006147.1| Gallus gallus heat shock 70kDa protein 9B (mortalin-2) (HSPA9B), mRNA Length = 3084 Score = 58.0 bits (29), Expect = 4e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctggg 487 ||||| ||||||||||||||||||||||| || ||||| ||| || |||||||||||| Sbjct: 930 gtgattacagttcctgcttatttcaatgattctcagagacaggcgacgaaagatgctggg 989 Query: 488 c 488 | Sbjct: 990 c 990
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 58.0 bits (29), Expect = 4e-05 Identities = 83/101 (82%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctggg 487 |||||||| ||||||||||| || |||||||| ||| || ||| || |||||||| || Sbjct: 2877022 gtgatcacggttcctgcttactttaatgactcgcagcggcaggccaccaaagatgcgggc 2877081 Query: 488 cgcattgcagggttggatgttcttcgtatcataaacgagcc 528 |||||||| || ||||| || || || ||||| |||||||| Sbjct: 2877082 cgcattgccggtttggaagtgctgcgcatcatcaacgagcc 2877122 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 578 attctggtttttgatctgggaggaggcacctttgatgtctc 618 ||||||||||| ||| |||| || |||||||| |||||||| Sbjct: 3036788 attctggttttcgatttgggtggcggcaccttcgatgtctc 3036828
>ref|NM_131397.2| Danio rerio heat shock cognate 70-kd protein (hsp70), mRNA Length = 2770 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 1090 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 1149 Query: 479 gatgctgg 486 |||||||| Sbjct: 1150 gatgctgg 1157
>gb|BC056709.1| Danio rerio heat shock cognate 70-kd protein, mRNA (cDNA clone MGC:65778 IMAGE:6789418), complete cds Length = 2375 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 548 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 607 Query: 479 gatgctgg 486 |||||||| Sbjct: 608 gatgctgg 615
>emb|CR383684.7| Zebrafish DNA sequence from clone DKEYP-69E1 in linkage group 3, complete sequence Length = 111124 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 110813 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 110754 Query: 479 gatgctgg 486 |||||||| Sbjct: 110753 gatgctgg 110746 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 ||||| ||||| ||||||||||| || |||||||| ||||||||||| Sbjct: 103982 accaacgcagttatcacagttccagcctatttcaacgactcccagag 103936
>emb|BX323451.12| Zebrafish DNA sequence from clone DKEY-49H9 in linkage group 8, complete sequence Length = 211489 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 114460 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 114401 Query: 479 gatgctgg 486 |||||||| Sbjct: 114400 gatgctgg 114393
>ref|XM_683601.1| PREDICTED: Danio rerio similar to Hsp70 protein (LOC560210), mRNA Length = 2246 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 506 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 565 Query: 479 gatgctgg 486 |||||||| Sbjct: 566 gatgctgg 573
>ref|XM_702504.1| PREDICTED: Danio rerio similar to Hsp70 protein, transcript variant 2 (LOC559123), mRNA Length = 1961 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 424 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 483 Query: 479 gatgctgg 486 |||||||| Sbjct: 484 gatgctgg 491
>ref|XM_679567.1| PREDICTED: Danio rerio similar to Hsp70 protein, transcript variant 1 (LOC559123), mRNA Length = 2051 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 424 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 483 Query: 479 gatgctgg 486 |||||||| Sbjct: 484 gatgctgg 491
>gb|S78556.1| grp75=75 kda glucose regulated protein [rats, Sprague-Dawley, brain, mRNA, 3001 nt] Length = 3001 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactc 459 ||||||||||| |||||||||||||||||||| Sbjct: 611 gtgatcacagtccctgcttatttcaatgactc 642
>gb|S75280.1| Rattus sp. pre-mtHSP70 mRNA, complete cds; nuclear gene for mitochondrial product Length = 2090 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactc 459 ||||||||||| |||||||||||||||||||| Sbjct: 618 gtgatcacagtccctgcttatttcaatgactc 649
>gb|U92313.1|CGU92313 Cricetulus griseus 70 kDa heat shock protein precursor mRNA, nuclear gene encoding mitochondrial protein, complete cds Length = 2732 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactc 459 ||||||||||| |||||||||||||||||||| Sbjct: 568 gtgatcacagtccctgcttatttcaatgactc 599
>emb|BX511232.6| Zebrafish DNA sequence from clone CH211-11K18 in linkage group 3, complete sequence Length = 171843 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 5611 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 5670 Query: 479 gatgctgg 486 |||||||| Sbjct: 5671 gatgctgg 5678 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 1689 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 1630 Query: 479 gatgctgg 486 |||||||| Sbjct: 1629 gatgctgg 1622
>gb|AF210640.1|AF210640 Danio rerio Hsp70 gene, complete cds Length = 2770 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 419 accaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaa 478 ||||| ||||| ||||||||||| || |||||||| ||||||||||| ||| || ||| Sbjct: 1090 accaacgcagttatcacagttccagcctatttcaacgactcccagagacaggccactaaa 1149 Query: 479 gatgctgg 486 |||||||| Sbjct: 1150 gatgctgg 1157
>ref|XM_214583.3| PREDICTED: Rattus norvegicus heat shock protein, A (predicted) (Hspa9a_predicted), mRNA Length = 3045 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactc 459 ||||||||||| |||||||||||||||||||| Sbjct: 667 gtgatcacagtccctgcttatttcaatgactc 698
>gb|AF079360.1|AF079360 Setaria digitata heat shock protein 70 gene, complete cds Length = 3893 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactc 459 |||||||||||||| ||||||||||||||||| Sbjct: 1436 gtgatcacagttccagcttatttcaatgactc 1467
>dbj|D14499.1|STMHSP70 S.griseus hsp70 gene for HSP70, complete cds Length = 2113 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 74 ggcggcaagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcgtg 133 |||||| ||||||| || |||||||||| |||||||| ||||||||||||| ||||| Sbjct: 183 ggcggcgagcccaccgtcatcaccaacgcagagggcgccaggaccacgccgtccgtcgtc 242 Query: 134 gcct 137 |||| Sbjct: 243 gcct 246
>gb|AY316177.1| Biomphalaria glabrata heat shock protein 70 variant 1 mRNA, partial cds Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 90 gtgatcacagtgcctgcttatttcaacgattcacagaggcgagccacaaaagatgctgg 148
>gb|AY316178.1| Biomphalaria glabrata heat shock protein 70 variant 2 mRNA, partial cds Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 90 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 148
>gb|AY316179.1| Biomphalaria glabrata heat shock protein 70 variant 3 mRNA, partial cds Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 90 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 148
>gb|AY316180.1| Biomphalaria glabrata heat shock protein 70 variant 4 mRNA, partial cds Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 90 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 148
>gb|AY316181.1| Biomphalaria glabrata heat shock protein 70 variant 5 gene, partial cds Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 90 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 148
>gb|AY316182.1| Biomphalaria glabrata heat shock protein 70 variant 2 gene, partial cds Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 90 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 148
>gb|AF025477.1| Biomphalaria glabrata heat-shock protein 70 (HSP70) gene, complete cds Length = 3353 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 1495 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 1553
>gb|CP000110.1| Synechococcus sp. CC9605, complete genome Length = 2510659 Score = 54.0 bits (27), Expect = 6e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 159 tggtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcag 218 ||||||| ||||||||||| | ||||||||| | ||||| || |||||||||| || | Sbjct: 2488932 tggtgggtcagatcgccaaacgtcaggcggtgatgaacccagacaacaccttctattccg 2488873 Query: 219 tcaagaggttcatcggccg 237 ||||| | ||||||||||| Sbjct: 2488872 tcaagcgtttcatcggccg 2488854 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Minus Query: 428 gtgatcacagttcctgcttatttcaatgactcccag 463 |||||||| ||||| ||||||||||| ||||||||| Sbjct: 2488666 gtgatcaccgttccggcttatttcaacgactcccag 2488631
>ref|XM_517960.1| PREDICTED: Pan troglodytes heat shock 70kDa protein 9B (LOC462099), mRNA Length = 2385 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 913 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 971
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence Length = 4837408 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 431 atcacagttcctgcttatttcaatgactcccagag 465 ||||| ||||||||||||||||||||| ||||||| Sbjct: 4401781 atcacggttcctgcttatttcaatgacgcccagag 4401747
>gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669, complete cds Length = 2723 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgt 615 |||||||||| |||||||||||||||||||| Sbjct: 618 tttttgatcttggaggaggcacctttgatgt 648
>gb|BC024034.2| Homo sapiens heat shock 70kDa protein 9B (mortalin-2), mRNA (cDNA clone MGC:4500 IMAGE:2964588), complete cds Length = 2802 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 610 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 668
>ref|NM_004134.4| Homo sapiens heat shock 70kDa protein 9B (mortalin-2) (HSPA9B), nuclear gene encoding mitochondrial protein, mRNA Length = 2883 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 676 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 734
>gb|AC101093.9| Mus musculus chromosome 3, clone RP23-90B11, complete sequence Length = 167727 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||| || ||||| ||||||||||||||| || ||| |||||||||||||| Sbjct: 93241 tcacagtgccagcttacttcaatgactcccagtggcaggcaacaaaagatgctgg 93295
>ref|XM_657641.1| Aspergillus nidulans FGSC A4 heat shock 70 kDa protein (AN5129.2), mRNA Length = 1935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 87/107 (81%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 ||||| ||||| || |||||||| ||||| ||||||||| | ||| ||||| |||||| Sbjct: 418 gcagtcatcactgtccctgcttacttcaacgactcccagcgtcaggccacaaaggatgct 477 Query: 485 gggcgcattgcagggttggatgttcttcgtatcataaacgagcctac 531 || | |||||| || || | ||||| |||||||| ||||||||||| Sbjct: 478 ggtctcattgccggtctgaacgttctccgtatcatcaacgagcctac 524
>gb|BT014578.1| Lycopersicon esculentum clone 134033R, mRNA sequence Length = 2411 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctggg 487 |||||||| ||||| ||||||||||||||| | |||||| ||| ||||| || |||||| Sbjct: 661 gtgatcactgttccagcttatttcaatgacgctcagaggcaggcaacaaaggacgctggg 720 Query: 488 cgcattgcagg 498 | |||||||| Sbjct: 721 agaattgcagg 731
>emb|CR861074.1| Pongo pygmaeus mRNA; cDNA DKFZp459G2015 (from clone DKFZp459G2015) Length = 2447 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 668 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 726
>gb|BC030634.1| Homo sapiens, heat shock 70kD protein 9B (mortalin-2), clone IMAGE:3941210, mRNA, partial cds Length = 2782 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 574 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 632
>gb|L44127.1|BIOHSP70K Biomphalaria glabrata heat shock protein 70 (HSP70) mRNA, complete cds Length = 2454 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| |||||||||||||| || || |||||| || |||||||||||||| Sbjct: 596 gtgatcacagtgcctgcttatttcaacgattcacagaggcaagccacaaaagatgctgg 654
>gb|DQ185038.1| Homo sapiens heat shock 70 kDa protein 9B mRNA, partial cds Length = 529 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 172 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 230
>dbj|AK222758.1| Homo sapiens mRNA for heat shock 70kDa protein 9B precursor variant, clone: HEP01066 Length = 2386 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 601 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 659
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 54.0 bits (27), Expect = 6e-04 Identities = 147/187 (78%) Strand = Plus / Plus Query: 96 ccaacgccgagggcgcgcggaccacgccgtcggtcgtggcctacaccaaggccggagacc 155 ||||||| || ||| |||| |||||||||||||| ||||||| ||||||| | |||| Sbjct: 4484561 ccaacgcggaaggctcgcgcaccacgccgtcggtggtggccttcaccaagaaccacgacc 4484620 Query: 156 ggttggtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttct 215 ||||||| |||||| | ||| | ||||| || ||||||| |||||||| |||| | Sbjct: 4484621 ggttggtcgggcagttggcccgccgtcaggccgttctcaaccccgagaacacgttctatt 4484680 Query: 216 cagtcaagaggttcatcggccgaaagatgaacgaggtcgccgaggagtccaagcaggttt 275 | |||||| | ||||||||||| ||| ||||| || |||| ||| |||||||||| Sbjct: 4484681 cggtcaagcgcttcatcggccgcaagtacgacgagatcaccgatgaggccaagcaggtgg 4484740 Query: 276 cctaccg 282 ||||||| Sbjct: 4484741 cctaccg 4484747
>gb|BC000478.2| Homo sapiens heat shock 70kDa protein 9B (mortalin-2), mRNA (cDNA clone MGC:8684 IMAGE:2964588), complete cds Length = 2802 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 610 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 668
>gb|AY105690.1| Zea mays PCO065072 mRNA sequence Length = 1632 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 572 gaaacaattctggtttttgatctgggaggaggcacctttgatgtctc 618 ||||||||||| || |||||| ||||||| || |||||||||||||| Sbjct: 11 gaaacaattctagtgtttgatttgggaggtggtacctttgatgtctc 57
>emb|AJ629247.1| Streptomyces fradiae neomycin biosynthesis gene cluster, strain DSM 40063 Length = 50466 Score = 54.0 bits (27), Expect = 6e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 72 agggcggcaagcccacgatcgtcaccaacgccgagggcgcgcggaccacgccgtcggtcg 131 ||||||| ||||| || ||||||| ||| | ||||||||| ||||||||||||| |||| Sbjct: 46337 agggcggtgagcccgcggtcgtcacgaacacggagggcgcgaggaccacgccgtccgtcg 46396 Query: 132 tgg 134 ||| Sbjct: 46397 tgg 46399
>gb|L15189.1|HUMGRP75 Homo sapiens mitochondrial HSP75 mRNA, complete cds Length = 2131 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 597 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 655
>gb|AC148774.4| Mus musculus chromosome 3, clone RP24-400J22, complete sequence Length = 135817 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 432 tcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||| || ||||| ||||||||||||||| || ||| |||||||||||||| Sbjct: 99680 tcacagtgccagcttacttcaatgactcccagtggcaggcaacaaaagatgctgg 99626
>gb|L11066.1|HUMPBP Human mRNA sequence Length = 2845 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 ||||||||||| || ||||||||||||||||| ||||| ||| || ||||||||||| Sbjct: 658 gtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctgg 716
>gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete genome Length = 1709204 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 569 aatgaaacaattctggtttttgatctgggaggaggcacctttgatgtctcagtt 622 ||||||| |||||| ||||||||| | || ||||| || ||||||||||||||| Sbjct: 1694084 aatgaaaaaattcttgtttttgatttaggtggaggaacatttgatgtctcagtt 1694031 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Minus Query: 434 acagttcctgcttatttcaatgactcccagaggacggctacaaaaga 480 |||||||| |||||||| |||||||| || ||| |||||||||||| Sbjct: 1694216 acagttccagcttattttaatgactctcaaaggcaggctacaaaaga 1694170
>ref|XM_468043.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2332 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgtctcagttct 624 ||||| ||||||||||| ||||||||||||||| |||| Sbjct: 810 tttgacctgggaggaggtacctttgatgtctcaattct 847
>gb|DQ531046.1| Homo sapiens heat shock 70kDa protein 9B (mortalin-2) (HSPA9B) gene, complete cds Length = 23453 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 ||||||||||| || ||||||||||||||||| ||||| Sbjct: 9710 gtgatcacagtcccagcttatttcaatgactcgcagag 9747
>ref|XM_858776.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 22 (LOC474697), mRNA Length = 2215 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858752.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 21 (LOC474697), mRNA Length = 2404 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858735.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 20 (LOC474697), mRNA Length = 2389 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858712.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 19 (LOC474697), mRNA Length = 2392 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858690.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 18 (LOC474697), mRNA Length = 2380 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858665.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 17 (LOC474697), mRNA Length = 2380 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858642.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 16 (LOC474697), mRNA Length = 2380 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858617.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 15 (LOC474697), mRNA Length = 2383 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858597.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 14 (LOC474697), mRNA Length = 2377 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858580.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 13 (LOC474697), mRNA Length = 2386 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858555.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 12 (LOC474697), mRNA Length = 2380 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858538.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 11 (LOC474697), mRNA Length = 2380 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858515.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 10 (LOC474697), mRNA Length = 2380 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858489.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 9 (LOC474697), mRNA Length = 2362 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858468.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 8 (LOC474697), mRNA Length = 2386 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>ref|XM_858443.1| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 7 (LOC474697), mRNA Length = 1764 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 53 gtgatcactgttccagcttatttcaatgactctcagag 90
>ref|XM_531923.2| PREDICTED: Canis familiaris similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT), transcript variant 6 (LOC474697), mRNA Length = 2392 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 681 gtgatcactgttccagcttatttcaatgactctcagag 718
>gb|AC144722.11| Medicago truncatula clone mth2-26h11, complete sequence Length = 122089 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 ||||||||||| || ||||||||||| ||||| || ||| ||| || |||||||||||| Sbjct: 62599 gcagtgatcactgtgcctgcttattttaatgattctcagcggaaagccacaaaagatgct 62658 Query: 485 gg 486 || Sbjct: 62659 gg 62660 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 |||||||| ||||| || ||||||| ||||| ||||||||||| Sbjct: 81896 gcttattttaatgattctcagaggaaagctaccaaagatgctgg 81939
>gb|AC137996.33| Medicago truncatula clone mth2-19k16, complete sequence Length = 122085 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgct 484 ||||||||||| || ||||||||||| ||||| || ||| ||| || |||||||||||| Sbjct: 62598 gcagtgatcactgtgcctgcttattttaatgattctcagcggaaagccacaaaagatgct 62657 Query: 485 gg 486 || Sbjct: 62658 gg 62659 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 |||||||| ||||| || ||||||| ||||| ||||||||||| Sbjct: 81895 gcttattttaatgattctcagaggaaagctaccaaagatgctgg 81938
>emb|X77209.1|RNHSP703 R.norvegicus Hsp70-3 gene Length = 3913 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| || |||||||| || || || |||||||||||||||||||| Sbjct: 1801 gtcaccaacgctgtgatcaccgtgccagcctatttcaatgactcccagag 1850
>emb|BX883045.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 4/11 Length = 346406 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| || |||||||| || || || |||||||||||||||||||| Sbjct: 169778 gtcaccaacgctgtgatcaccgtgccagcctatttcaatgactcccagag 169827
>gb|AC011385.6| Homo sapiens chromosome 5 clone CTB-15L17, complete sequence Length = 134599 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 ||||||||||| || ||||||||||||||||| ||||| Sbjct: 80820 gtgatcacagtcccagcttatttcaatgactcgcagag 80857
>dbj|AB168862.1| Macaca fascicularis testis cDNA, clone: QtsA-15441, similar to human heat shock 70kDa protein 9B (mortalin-2) (HSPA9B),nuclear gene encoding mitochondrial protein, mRNA, RefSeq: NM_004134.4 Length = 2840 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 ||||||||||| || ||||||||||||||||| ||||| Sbjct: 651 gtgatcacagtcccagcttatttcaatgactcgcagag 688
>gb|BC102334.1| Bos taurus heat shock 70kDa protein 9B (mortalin-2), mRNA (cDNA clone MGC:127342 IMAGE:7951701), complete cds Length = 2323 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 ||||||||||| || ||||||||||||||||| ||||| Sbjct: 643 gtgatcacagtcccagcttatttcaatgactctcagag 680
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 587 tttgatctgggaggaggcacctttgatgtctcagttct 624 ||||| ||||||||||| ||||||||||||||| |||| Sbjct: 32709245 tttgacctgggaggaggtacctttgatgtctcaattct 32709208
>dbj|AP004853.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1448_G06 Length = 136823 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 587 tttgatctgggaggaggcacctttgatgtctcagttct 624 ||||| ||||||||||| ||||||||||||||| |||| Sbjct: 37480 tttgacctgggaggaggtacctttgatgtctcaattct 37443
>dbj|AK065228.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H04, full insert sequence Length = 2397 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgtctcagttct 624 ||||| ||||||||||| ||||||||||||||| |||| Sbjct: 810 tttgacctgggaggaggtacctttgatgtctcaattct 847
>dbj|AK060740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-D07, full insert sequence Length = 1675 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgtctcagttct 624 ||||| ||||||||||| ||||||||||||||| |||| Sbjct: 130 tttgacctgggaggaggtacctttgatgtctcaattct 167
>gb|BC108294.1| Rattus norvegicus heat shock 70kD protein 1-like (mapped), mRNA (cDNA clone MGC:112562 IMAGE:7111250), complete cds Length = 2288 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| || |||||||| || || || |||||||||||||||||||| Sbjct: 444 gtcaccaacgctgtgatcaccgtgccagcctatttcaatgactcccagag 493
>gb|BC108297.1| Rattus norvegicus heat shock 70kD protein 1-like (mapped), mRNA (cDNA clone MGC:114222 IMAGE:7115041), complete cds Length = 2434 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| || |||||||| || || || |||||||||||||||||||| Sbjct: 582 gtcaccaacgctgtgatcaccgtgccagcctatttcaatgactcccagag 631
>ref|NM_212546.1| Rattus norvegicus heat shock 70kD protein 1-like (mapped) (Hspa1l_mapped), mRNA Length = 2615 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagag 465 |||||||| || |||||||| || || || |||||||||||||||||||| Sbjct: 565 gtcaccaacgctgtgatcaccgtgccagcctatttcaatgactcccagag 614
>gb|AF026513.1|AF026513 Asbestopluma hypogea heat-shock protein Hsp70 mRNA, partial cds Length = 1401 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 437 gttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 |||||||| || ||||||||||| ||| || |||||||||||||||||| Sbjct: 334 gttcctgcctacttcaatgactcgcagcggcaggctacaaaagatgctgg 383
>ref|NM_001034524.1| Bos taurus heat shock 70kDa protein 9B (mortalin-2) (HSPA9B), mRNA Length = 2323 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagag 465 ||||||||||| || ||||||||||||||||| ||||| Sbjct: 643 gtgatcacagtcccagcttatttcaatgactctcagag 680
>dbj|AB070346.1| Tetragenococcus halophilus genes for ORF1, HrcA, GrpE, DnaK and DnaJ, complete cds Length = 6608 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 434 acagttcctgcttatttcaatgactc 459 |||||||||||||||||||||||||| Sbjct: 3618 acagttcctgcttatttcaatgactc 3643
>gb|AY035309.1| Cyprinus carpio heat shock protein HSP70 mRNA, partial cds Length = 636 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgt 615 ||||| ||||||||||||||||||||||| Sbjct: 122 tttgacctgggaggaggcacctttgatgt 150
>ref|NM_010481.1| Mus musculus heat shock protein 9A (Hspa9a), mRNA Length = 2997 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 641 gtgatcacagtccctgcttatttcaatga 669
>gb|AC131675.4| Mus musculus BAC clone RP23-328L1 from chromosome 18, complete sequence Length = 191085 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 185798 gtgatcacagtccctgcttatttcaatga 185826
>emb|Y08577.2|FRHSP702 F.rubripes hsp70-2 gene, complete Length = 2971 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgt 615 ||||| ||||||||||||||||||||||| Sbjct: 1534 tttgacctgggaggaggcacctttgatgt 1562
>emb|Y08578.1|FRHSP7035 F.rubripes hsp70-3 gene, 5' Length = 4135 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgt 615 ||||| ||||||||||||||||||||||| Sbjct: 3631 tttgacctgggaggaggcacctttgatgt 3659
>gb|AF502495.1| Cetorhinus maximus isolate Cema7 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Plus Query: 411 acaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 |||| |||||||| || || ||||| |||||||| || ||||||||||||||| Sbjct: 293 acaaggtcaccaatgctgttatcacggttcctgcctacttcaatgactcccag 345
>gb|AY738621.1| Natronococcus occultus DnaK gene, partial cds Length = 1359 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 96 ccaacgccgagggcgcgcggaccacgccgtcggtcgt 132 ||||||| ||||||| |||||| |||||||||||||| Sbjct: 35 ccaacgcggagggcgagcggacgacgccgtcggtcgt 71
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome Length = 2696255 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 161 gtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtc 220 ||||| || |||||||| | ||||||||| | ||||| ||||||||||||| ||| || Sbjct: 1768016 gtgggtcaaatcgccaaacgccaggcggtgatgaaccccgagaacaccttctactcggtt 1767957 Query: 221 aagaggttcatcggccg 237 ||| | ||||||||||| Sbjct: 1767956 aagcgcttcatcggccg 1767940 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccag 463 ||||| || ||||| || |||||||||||||||||| Sbjct: 1650491 gtgattacggttccggcctatttcaatgactcccag 1650526
>dbj|AK133501.1| Mus musculus 11 days pregnant adult female ovary and uterus cDNA, RIKEN full-length enriched library, clone:5031438D08 product:heat shock protein, A, full insert sequence Length = 2338 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 671 gtgatcacagtccctgcttatttcaatga 699
>dbj|AK137109.1| Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430081J01 product:heat shock protein, A, full insert sequence Length = 1855 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 641 gtgatcacagtccctgcttatttcaatga 669
>dbj|AK145965.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530018K04 product:heat shock protein, A, full insert sequence Length = 3028 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 663 gtgatcacagtccctgcttatttcaatga 691
>dbj|AK159791.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420031E23 product:heat shock protein, A, full insert sequence Length = 2825 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 671 gtgatcacagtccctgcttatttcaatga 699
>dbj|AK167856.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730033D18 product:heat shock protein, A, full insert sequence Length = 2811 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 662 gtgatcacagtccctgcttatttcaatga 690
>dbj|AK165958.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730023H12 product:heat shock protein, A, full insert sequence Length = 2823 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 669 gtgatcacagtccctgcttatttcaatga 697
>dbj|AK002634.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610015J03 product:heat shock protein, 74 kDa, A, full insert sequence Length = 2268 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 601 gtgatcacagtccctgcttatttcaatga 629
>dbj|AK004946.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched library, clone:1300008N06 product:heat shock protein, 74 kDa, A, full insert sequence Length = 3003 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 631 gtgatcacagtccctgcttatttcaatga 659
>dbj|AK030299.1| Mus musculus 11 days pregnant adult female ovary and uterus cDNA, RIKEN full-length enriched library, clone:5031411K10 product:heat shock protein, 74 kDa, A, full insert sequence Length = 2813 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 662 gtgatcacagtccctgcttatttcaatga 690
>dbj|D17666.2| Mus musculus domesticus gene for stress-70 protein (PBP74/CSA), complete cds Length = 9423 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 3214 gtgatcacagtccctgcttatttcaatga 3242
>dbj|AK195063.1| Mus musculus cDNA, clone:Y1G0117E12, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000025217, based on BLAT search Length = 393 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 110 gtgatcacagtccctgcttatttcaatga 138
>dbj|D11089.2|MUSP66 Mus musculus mRNA for p66 mot1, complete cds Length = 2155 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 657 gtgatcacagtccctgcttatttcaatga 685
>dbj|D17556.1|MUSPBP74 Mus musculus PBP74 mRNA for mitochondrial stress-70 protein, complete cds Length = 2997 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 641 gtgatcacagtccctgcttatttcaatga 669
>gb|AF026520.1|AF026520 Petrobiona massiliana heat-shock protein Hsp70 mRNA, partial cds Length = 1401 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagaggacggctacaaaaga 480 |||||||||| || |||||||||||||||||| | ||||||| ||||| Sbjct: 329 tcacagttcccgcctatttcaatgactcccagcgcccggctactaaaga 377
>gb|BC057343.1| Mus musculus heat shock protein 9A, mRNA (cDNA clone MGC:67041 IMAGE:6813991), complete cds Length = 2871 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 669 gtgatcacagtccctgcttatttcaatga 697
>gb|BC052727.1| Mus musculus heat shock protein 9A, mRNA (cDNA clone MGC:64668 IMAGE:6813991), complete cds Length = 2871 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 669 gtgatcacagtccctgcttatttcaatga 697
>gb|L06896.1|MUSPBP Mouse mRNA sequence Length = 2336 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatga 456 ||||||||||| ||||||||||||||||| Sbjct: 654 gtgatcacagtccctgcttatttcaatga 682
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome Length = 2695903 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Plus Query: 161 gtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtc 220 ||||| || |||||||| | ||||||||| | ||||| ||||||||||||| ||| || Sbjct: 2548769 gtgggtcaaatcgccaaacgccaggcggtgatgaaccccgagaacaccttctactcggtt 2548828 Query: 221 aagaggttcatcggccg 237 ||| | ||||||||||| Sbjct: 2548829 aagcgcttcatcggccg 2548845 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 428 gtgatcacagttcctgcttatttcaatgactcccag 463 ||||| || ||||| || |||||||||||||||||| Sbjct: 2666295 gtgattacggttccggcctatttcaatgactcccag 2666260 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccag 463 |||||||| ||||| || || ||||||||||||||| Sbjct: 2549033 gtgatcacggttccggcctacttcaatgactcccag 2549068
>dbj|D28551.1|SYOHSPG1 Synechococcus sp. gene for heat shock protein DnaK homologue, complete cds Length = 3362 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Plus Query: 161 gtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttctcagtc 220 ||||| || |||||||| | ||||||||| | ||||| ||||||||||||| ||| || Sbjct: 271 gtgggtcaaatcgccaaacgccaggcggtgatgaaccccgagaacaccttctactcggtt 330 Query: 221 aagaggttcatcggccg 237 ||| | ||||||||||| Sbjct: 331 aagcgcttcatcggccg 347 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccag 463 |||||||| ||||| || || ||||||||||||||| Sbjct: 535 gtgatcacggttccggcctacttcaatgactcccag 570
>gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, complete cds Length = 3290 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactc 459 |||||||||||||||| ||||||||||| Sbjct: 1633 tcacagttcctgcttacttcaatgactc 1660
>gb|AY651257.1| Bodo saltans heat shock protein 70-B cytosolic isoform gene, partial cds Length = 1912 Score = 48.1 bits (24), Expect = 0.035 Identities = 42/48 (87%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 ||||||||||| || ||||| || ||||| || ||||||||||||||| Sbjct: 359 gtcaccaaggccgtcatcactgtccctgcctacttcaatgactcccag 406
>ref|XM_527345.1| PREDICTED: Pan troglodytes similar to heat shock 70kDa protein 1-like; heat shock 70kD protein-like 1 (LOC471967), mRNA Length = 2469 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 1139 tttttgatctgggtggaggcacatttgatgtgtcaattct 1178 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 964 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 1007
>gb|BT016812.1| Zea mays clone Contig645 mRNA sequence Length = 2327 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctggg 487 ||||||| ||||| || ||||||||||| |||||| ||| ||||| ||||||||| Sbjct: 327 tcacagtccctgcctacttcaatgactcacagaggcaggccacaaaggatgctggg 382 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgtctc 618 |||||||| ||||| || |||||||||||||| Sbjct: 494 tttgatcttggaggtggtacctttgatgtctc 525
>gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG22, G9, HSP70-2, HSP70-1, HSP70-HOM, snRNP, G7A, NG37, NG23, and MutSH5 genes, complete cds Length = 180283 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 106790 tttttgatctgggtggaggcacatttgatgtgtcaattct 106829 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 106615 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 106658
>gb|BC034483.1| Homo sapiens heat shock 70kDa protein 1-like, mRNA (cDNA clone MGC:26463 IMAGE:4824979), complete cds Length = 2418 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 756 tttttgatctgggtggaggcacatttgatgtgtcaattct 795 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 581 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 624
>gb|AY514997.1| Veillonella rodentium 70 kDa heat shock protein gene, partial cds Length = 558 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 470 gctacaaaagatgctgggcgcattgcagggttggatgttcttcgtatcataaacgagcct 529 ||||||||||| ||||| ||||||||| | || |||||||||||||| ||||| ||| Sbjct: 294 gctacaaaagacgctggtgccattgcaggtcttgaagttcttcgtatcatcaacgaacct 353 Query: 530 accgcggc 537 || ||||| Sbjct: 354 acggcggc 361
>gb|BT014546.1| Lycopersicon esculentum clone 133963F, mRNA sequence Length = 2337 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Plus Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatgctgggcgcattgcagg 498 |||||||||||||| | |||||| ||| ||||| ||||||||||| |||||||| Sbjct: 677 gcttatttcaatgatgctcagaggcaggcaacaaaggatgctgggcgaattgcagg 732
>ref|XR_004629.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC674248), mRNA Length = 1920 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatg 482 ||||| |||||||||||||||||| ||| |||||||||| Sbjct: 433 gcttacttcaatgactcccagaggcaggcaacaaaagatg 472
>ref|XR_001757.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC665603), mRNA Length = 1920 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatg 482 ||||| |||||||||||||||||| ||| |||||||||| Sbjct: 433 gcttacttcaatgactcccagaggcaggcaacaaaagatg 472
>ref|NM_005527.2| Homo sapiens heat shock 70kDa protein 1-like (HSPA1L), mRNA Length = 2509 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 751 tttttgatctgggtggaggcacatttgatgtgtcaattct 790 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 576 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 619
>emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chromosome 6 Contains the 5' end of the VARS2 gene for valyl-tRNA synthetase 2, the LSM2 gene for the LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) factor, the HSPA1L gene for the heat shock 10kDa protein 1-like factor, the HSPA1A gene for the heat shock 70kDa protein 1A, the HSPA1B gene for the heat shock 70kDa protein 1B, the C6orf48 gene for chromosome 6 open reading frame 48, and 4 CpG islands, complete sequence Length = 59836 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 23195 tttttgatctgggtggaggcacatttgatgtgtcaattct 23156 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 23370 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 23327
>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the 5' end of the VARS2 gene for valyl-tRNA synthetase 2, the gene for chromosome 6 open reading frame 28, the HSPA1L gene for heat shock 70kDa protein 1-like, the HSPA1A gene for heat shock 70kDa protein 1A, the HSPA1B gene for heat shock 70kDa protein 1B, the gene for chromosome 6 open reading frame 48, the NEU1 gene for sialidase 1 (lysosomal sialidase), the gene forchromosome 6 open reading frame 29, the gene for HLA-B associated transcript 8, the gene for chromosome 6 open reading frame 46 and eight CpG islands, complete sequence Length = 113582 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 19225 tttttgatctgggtggaggcacatttgatgtgtcaattct 19186 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 19400 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 19357
>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23 protein, the gene for chromosome 6 open reading frame 27, the VARS2 gene for valyl-tRNA synthetase 2, the gene for chromosome 6 open reading frame 28, the HSPA1L gene for heat shock 70kDa protein 1-like, the HSPA1A gene for heat shock 70kDa protein 1A, the HSPA1B gene for heat shock 70kDa protein 1B, the gene for chromosome 6 open reading frame 48, the NEU1 gene for sialidase 1 (lysosomal sialidase), the gene for chromosome 6 open reading frame 29, the BAT8 gene for HLA-B associated transcript 8, the gene for chromosome 6 open reading frame 46 and nine CpG islands, complete sequence Length = 179894 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 75263 tttttgatctgggtggaggcacatttgatgtgtcaattct 75224 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 75438 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 75395
>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome Length = 1842899 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Minus Query: 425 gcagtgatcacagttcctgcttatttcaatga 456 ||||| || ||||||||||||||||||||||| Sbjct: 1275705 gcagttattacagttcctgcttatttcaatga 1275674
>gb|AF502487.1| Pseudocarcharias kamoharai isolate Pska4 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 42/48 (87%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccag 463 |||||||| || || |||||||| || ||||| ||||||||||||||| Sbjct: 298 gtcaccaatgctgttatcacagtgccggcttacttcaatgactcccag 345
>gb|AF502476.1| Megachasma pelagios isolate Mepe7 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| ||| Sbjct: 298 gtcaccaatgctgttatcacggtgccggcttacttcaatgactcccagcggcaggcaaca 357 Query: 476 aaagatgc 483 |||||||| Sbjct: 358 aaagatgc 365
>gb|AF502475.1| Megachasma pelagios isolate Mepe6 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| ||| Sbjct: 298 gtcaccaatgctgttatcacggtgccggcttacttcaatgactcccagcggcaggcaaca 357 Query: 476 aaagatgc 483 |||||||| Sbjct: 358 aaagatgc 365
>gb|AF502473.1| Megachasma pelagios isolate Mepe4 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| ||| Sbjct: 298 gtcaccaatgctgttatcacggtgccggcttacttcaatgactcccagcggcaggcaaca 357 Query: 476 aaagatgc 483 |||||||| Sbjct: 358 aaagatgc 365
>gb|AF502472.1| Megachasma pelagios isolate Mepe3 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| ||| Sbjct: 298 gtcaccaatgctgttatcacggtgccggcttacttcaatgactcccagcggcaggcaaca 357 Query: 476 aaagatgc 483 |||||||| Sbjct: 358 aaagatgc 365
>gb|AF502471.1| Megachasma pelagios isolate Mepe2 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| ||| Sbjct: 298 gtcaccaatgctgttatcacggtgccggcttacttcaatgactcccagcggcaggcaaca 357 Query: 476 aaagatgc 483 |||||||| Sbjct: 358 aaagatgc 365
>gb|AF502470.1| Megachasma pelagios isolate Mepe1 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| ||| Sbjct: 298 gtcaccaatgctgttatcacggtgccggcttacttcaatgactcccagcggcaggcaaca 357 Query: 476 aaagatgc 483 |||||||| Sbjct: 358 aaagatgc 365
>emb|CR759915.6| Human DNA sequence from clone DAAP-21F2 on chromosome 6, complete sequence Length = 85491 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 56433 tttttgatctgggtggaggcacatttgatgtgtcaattct 56394 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 56608 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 56565
>emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chromosome 6, complete sequence Length = 80364 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 4462 tttttgatctgggtggaggcacatttgatgtgtcaattct 4423 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 4637 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 4594
>gb|DQ383515.2| Homo sapiens heat shock 70kDa protein 1-like (HSPA1L) gene, complete cds Length = 7745 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 4383 tttttgatctgggtggaggcacatttgatgtgtcaattct 4422 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 4208 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 4251
>gb|AE005675.1| Caulobacter crescentus CB15 section 1 of 359 of the complete genome Length = 10171 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 98 aacgccgagggcgcgcggaccacgccgtcggtcgtggcct 137 |||||||||||||| || ||||| ||||||||||| |||| Sbjct: 8249 aacgccgagggcgctcgcaccaccccgtcggtcgtcgcct 8288
>gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, complete cds Length = 2224 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactc 459 |||||||||||||||| ||||||||||| Sbjct: 499 tcacagttcctgcttacttcaatgactc 526
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 96 ccaacgccgagggcgcgcggaccacgccgtcggtcgtggc 135 |||||||||||||| | ||||| || |||||||||||||| Sbjct: 5197271 ccaacgccgagggctcccggacgaccccgtcggtcgtggc 5197310
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome Length = 3544738 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Minus Query: 491 attgcagggttggatgttcttcgtatcataaacgagcctaccgc 534 ||||||||| | || |||||||||||||| |||||||| ||||| Sbjct: 149742 attgcagggcttgaagttcttcgtatcatcaacgagccgaccgc 149699
>gb|AE002160.2| Chlamydia muridarum Nigg, complete genome Length = 1072950 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 471 ctacaaaagatgctgggcgcattgcagg 498 |||||||||||||||| ||||||||||| Sbjct: 805935 ctacaaaagatgctggacgcattgcagg 805962
>dbj|AB168812.1| Macaca fascicularis testis cDNA, clone: QtsA-15024, similar to human heat shock 70kDa protein 1-like (HSPA1L), mRNA, RefSeq: NM_005527.2 Length = 2449 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 749 tttttgatctgggtggaggcacatttgatgtgtcaattct 788 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 574 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 617
>dbj|AB168570.1| Macaca fascicularis testis cDNA clone: QtsA-13086, similar to human heat shock 70kDa protein 1-like (HSPA1L), mRNA, RefSeq: NM_005527.2 Length = 2422 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 762 tttttgatctgggtggaggcacatttgatgtgtcaattct 801 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 587 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 630
>gb|AC149204.1| Medicago truncatula chromosome 7 BAC clone mth2-77n20, complete sequence Length = 75741 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Minus Query: 425 gcagtgatcacagttcctgcttatttcaatga 456 |||||||||||||| || |||||||||||||| Sbjct: 18598 gcagtgatcacagtgccagcttatttcaatga 18567 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 425 gcagtgatcacagttcctgcttatttcaatga 456 |||||||| || || ||||||||||||||||| Sbjct: 14426 gcagtgattaccgtgcctgcttatttcaatga 14395
>gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex BAC MMU009PO6, complete sequence Length = 191271 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 63449 tttttgatctgggtggaggcacatttgatgtgtcaattct 63410 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 63624 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 63581
>gb|M55224.1|CCRDNAK Caulobacter crescentus heat shock protein (dnaK) gene, complete cds; and heat shock protein (dnaJ) gene, partial cds Length = 3051 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 98 aacgccgagggcgcgcggaccacgccgtcggtcgtggcct 137 |||||||||||||| || ||||| ||||||||||| |||| Sbjct: 511 aacgccgagggcgctcgcaccaccccgtcggtcgtcgcct 550
>dbj|AK223386.1| Homo sapiens mRNA for heat shock 70kDa protein 1-like variant, clone: FCC106F11 Length = 2411 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 753 tttttgatctgggtggaggcacatttgatgtgtcaattct 792 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 578 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 621
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region Length = 2229817 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 132631 tttttgatctgggtggaggcacatttgatgtgtcaattct 132670 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 132456 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 132499
>gb|AY892966.1| Synthetic construct Homo sapiens clone FLH141345.01L heat shock 70kDa protein 1-like (HSPA1L) mRNA, partial cds Length = 1926 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 596 tttttgatctgggtggaggcacatttgatgtgtcaattct 635 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 421 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 464
>gb|AY890508.1| Synthetic construct Homo sapiens clone FLH141349.01X heat shock 70kDa protein 1-like (HSPA1L) mRNA, complete cds Length = 1926 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 596 tttttgatctgggtggaggcacatttgatgtgtcaattct 635 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 421 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 464
>gb|AC154123.9| Mus musculus chromosome 5, clone RP24-324D14, complete sequence Length = 175751 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 443 gcttatttcaatgactcccagaggacggctacaaaagatg 482 ||||| |||||||||||||||||| ||| |||||||||| Sbjct: 25937 gcttacttcaatgactcccagaggcaggcaacaaaagatg 25898
>gb|AY109330.1| Zea mays CL45_1 mRNA sequence Length = 3772 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctggg 487 ||||||| ||||| || ||||||||||| |||||| ||| ||||| ||||||||| Sbjct: 1715 tcacagtccctgcctacttcaatgactcacagaggcaggccacaaaggatgctggg 1770 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttgatgtctc 618 |||||||| ||||| || |||||||||||||| Sbjct: 1882 tttgatcttggaggtggtacctttgatgtctc 1913
>gb|M62819.1|CHTHSPRO Chlamydia muridarum GrpE (grpE) gene, complete cds; and heat shock protein (dnaK) gene, partial cds Length = 1418 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 471 ctacaaaagatgctgggcgcattgcagg 498 |||||||||||||||| ||||||||||| Sbjct: 1159 ctacaaaagatgctggacgcattgcagg 1186
>gb|U83800.1|MXU83800 Myxococcus xanthus unknown protein, GrpS (grpS), and Sglk (sglK), complete cds, and serine-threonine protein kinase (kinS), partial cds Length = 4849 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Plus Query: 159 tggtggggcagatcgccaagaggcaggcggtggtcaacccggagaacaccttcttc 214 ||||||||||||| |||||| ||||||| | |||||||||||||||| ||||| Sbjct: 1827 tggtggggcagattgccaagcggcaggccatcaccaacccggagaacaccgtcttc 1882
>emb|AL132713.11|HSDJ71I17 Human DNA sequence from clone RP1-71I17 on chromosome 6p21.2-22.1, complete sequence Length = 163682 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 353 tttttgatctgggtggaggcacatttgatgtgtcaattct 392 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 178 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 221
>gb|M59829.1|HUMMHHSPHO Human MHC class III HSP70-HOM gene (HLA), complete cds Length = 3330 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 1555 tttttgatctgggtggaggcacatttgatgtgtcaattct 1594 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 1380 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 1423
>dbj|AB061768.1| Hemicentrotus pulcherrimus HpOtxL mRNA for late type orthodenticle-related protein, complete cds Length = 3478 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Plus Query: 401 tttttaaatgacaaagtcaccaag 424 |||||||||||||||||||||||| Sbjct: 2841 tttttaaatgacaaagtcaccaag 2864
>dbj|D85730.1| Homo sapiens HSPA1L mRNA for Heat shock protein 70 testis variant, complete cds Length = 2371 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctcagttct 624 ||||||||||||| |||||||| |||||||| ||| |||| Sbjct: 731 tttttgatctgggtggaggcacatttgatgtgtcaattct 770 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactc 459 |||||||| |||||||| || || || || |||||||||||||| Sbjct: 556 gtcaccaatgcagtgattaccgtgccagcctatttcaatgactc 599
>gb|AY466497.1| Macrobrachium rosenbergii heat shock protein 70-like mRNA, complete sequence Length = 2173 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 431 atcacagttcctgcttatttcaatgactcccagag 465 |||||||||||||||| ||||||||||| ||||| Sbjct: 552 atcacagttcctgcttgcttcaatgactctcagag 586
>gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0022E16 map C481S, complete sequence Length = 179668 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagagg 466 |||| |||||||| || |||||||||||||||||| Sbjct: 134131 tcactgttcctgcctacttcaatgactcccagagg 134165
>ref|XM_462265.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G17688g) partial mRNA Length = 1968 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactccca 462 |||||||||| |||||||||||||| ||||| Sbjct: 503 tcacagttccagcttatttcaatgattccca 533
>emb|CR933369.1| Cytosol-type hsp70, Paramecium tetraurelia macronuclear gene Length = 2141 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgt 615 |||||||||| ||||| |||||||||||||| Sbjct: 699 tttttgatcttggaggtggcacctttgatgt 729
>gb|AY353254.1| Pneumocystis carinii f. sp. muris heat shock protein 70 (hsp70) gene, partial cds Length = 611 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgt 615 |||||||||| ||||||||||| |||||||| Sbjct: 497 tttttgatcttggaggaggcacttttgatgt 527
>emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70 Length = 4791 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagagg 466 |||| |||||||| || |||||||||||||||||| Sbjct: 3067 tcactgttcctgcctacttcaatgactcccagagg 3101
>gb|AF502479.1| Mitsukurina owstoni isolate Miow3 Hsp70 protein (Hsp70) gene, partial cds Length = 1386 Score = 46.1 bits (23), Expect = 0.14 Identities = 59/71 (83%) Strand = Plus / Plus Query: 416 gtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggacggctaca 475 |||||||| || || ||||| || || ||||| ||||||||||||||| || ||| || Sbjct: 298 gtcaccaatgctgtcatcacggtgccggcttacttcaatgactcccagcggcaggcaacc 357 Query: 476 aaagatgctgg 486 ||||||||||| Sbjct: 358 aaagatgctgg 368
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces hansenii Length = 2051428 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactccca 462 |||||||||| |||||||||||||| ||||| Sbjct: 1355170 tcacagttccagcttatttcaatgattccca 1355200
>emb|BX572101.1| Prochlorococcus marinus MIT9313 complete genome; segment 7/7 Length = 318136 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 423 aggcagtgatcacagttcctgcttatttcaatgactcccagag 465 |||| ||||||||||| ||||| ||||| |||||||| ||||| Sbjct: 297224 aggctgtgatcacagtgcctgcgtattttaatgactcacagag 297182
>emb|AJ318883.1|OED318883 Ostrea edulis partial hsp70 gene for heat shock protein 70 Length = 1797 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 594 tgggaggaggcacctttgatgtctcagttct 624 |||||||||| ||||||||||||||| |||| Sbjct: 617 tgggaggaggaacctttgatgtctcaattct 647
>emb|AJ318882.1|CGI318882 Crassostrea gigas partial hsp70 gene for heat shock protein 70 Length = 1797 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 594 tgggaggaggcacctttgatgtctcagttct 624 |||||||||| ||||||||||||||| |||| Sbjct: 617 tgggaggaggaacctttgatgtctcaattct 647 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccag 463 ||||||| || |||||||||||||| |||||| Sbjct: 437 tcacagtcccagcttatttcaatgattcccag 468
>emb|AJ305315.1|CGI305315 Crassostrea gigas hsc70 gene, exons 1-6 Length = 2553 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 594 tgggaggaggcacctttgatgtctcagttct 624 |||||||||| ||||||||||||||| |||| Sbjct: 1026 tgggaggaggaacctttgatgtctcaattct 1056 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccag 463 ||||||| || |||||||||||||| |||||| Sbjct: 740 tcacagtcccagcttatttcaatgattcccag 771
>gb|AY741371.1| Emiliania huxleyi strain CCMP 373 chloroplast, complete genome Length = 105309 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Minus Query: 437 gttcctgcttatttcaatgactcccagaggacggctacaaaagatgc 483 |||||||||||||| |||||||| ||||| |||||||||||||| Sbjct: 90334 gttcctgcttattttaatgactcacagagacaagctacaaaagatgc 90288
>gb|AY836653.1| Aurelia aurita clone 009 heat shock protein 70 (Hsp70) mRNA, partial cds Length = 1265 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactc 459 ||||| ||||| |||||||| |||||||||||||| Sbjct: 576 gcagttatcactgttcctgcctatttcaatgactc 610
>gb|U80969.1|PCU80969 Pneumocystis carinii f. sp. ratti heat shock protein 70B/SSB1 (Prsb1) gene, partial cds Length = 838 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgt 615 |||||||| ||||||||||||| |||||||| Sbjct: 677 tttttgatttgggaggaggcacatttgatgt 707 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 473 acaaaagatgctgggcgcattgcagggttggatgttcttcgtat 516 ||||||||||| || ||||||||| || |||||||||||||| Sbjct: 559 acaaaagatgcaggaaccattgcaggcttagatgttcttcgtat 602
>ref|NG_002380.1| Homo sapiens heat shock 70kDa protein 9B pseudogene (HSPA9BP) on chromosome 2 Length = 2933 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 |||||| |||| || |||||||||||||||| |||||| ||| || ||||||||||| Sbjct: 701 gtgatcgcagtcccagcttatttcaatgacttgcagaggcaggccactaaagatgctgg 759
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagagg 466 |||| |||||||| || |||||||||||||||||| Sbjct: 28175576 tcactgttcctgcctacttcaatgactcccagagg 28175610
>gb|AF144646.1|AF144646 Crassostrea gigas heat shock protein 70 (hsp70) mRNA, complete cds Length = 2381 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 594 tgggaggaggcacctttgatgtctcagttct 624 |||||||||| ||||||||||||||| |||| Sbjct: 700 tgggaggaggaacctttgatgtctcaattct 730 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccag 463 ||||||| || |||||||||||||| |||||| Sbjct: 520 tcacagtcccagcttatttcaatgattcccag 551
>gb|AE004889.1| Pseudomonas aeruginosa PAO1, section 450 of 529 of the complete genome Length = 11415 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Minus Query: 98 aacgccgagggcgcgcggaccacgccgtcggtcgtggcctacaccaa 144 ||||||||||||||||| ||||| || ||| || | ||||||||||| Sbjct: 11257 aacgccgagggcgcgcgtaccaccccctcgatcatcgcctacaccaa 11211
>gb|AC009302.2| Homo sapiens BAC clone RP11-71J24 from 2, complete sequence Length = 180970 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Plus Query: 428 gtgatcacagttcctgcttatttcaatgactcccagaggacggctacaaaagatgctgg 486 |||||| |||| || |||||||||||||||| |||||| ||| || ||||||||||| Sbjct: 41971 gtgatcgcagtcccagcttatttcaatgacttgcagaggcaggccactaaagatgctgg 42029
>gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cognate protein 70 (Hsc70-3) mRNA, complete cds Length = 1953 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactccca 462 |||| ||||||||||||||||| |||||||| Sbjct: 443 tcaccgttcctgcttatttcaacgactccca 473
>dbj|AB162946.1| Chironomus yoshimatsui HSP70 mRNA for heat shock protein 70, complete cds Length = 2357 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactc 459 ||||| || |||||||| ||||||||||||||||| Sbjct: 613 gcagtcattacagttccagcttatttcaatgactc 647
>dbj|AB122064.1| Crassostrea gigas HSC71 mRNA for 71kDa heat shock connate protein, complete cds Length = 2265 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 594 tgggaggaggcacctttgatgtctcagttct 624 |||||||||| ||||||||||||||| |||| Sbjct: 649 tgggaggaggaacctttgatgtctcaattct 679 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccag 463 ||||||| || |||||||||||||| |||||| Sbjct: 469 tcacagtcccagcttatttcaatgattcccag 500
>dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-H02, full insert sequence Length = 2311 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagagg 466 |||| |||||||| || |||||||||||||||||| Sbjct: 619 tcactgttcctgcctacttcaatgactcccagagg 653
>dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021C17, full insert sequence Length = 2380 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagagg 466 |||| |||||||| || |||||||||||||||||| Sbjct: 515 tcactgttcctgcctacttcaatgactcccagagg 549
>gb|AY104983.1| Zea mays PCO092463 mRNA sequence Length = 2588 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 422 aaggcagtgatcacagttcctgcttatttcaatga 456 ||||||||||| || ||||| |||||||||||||| Sbjct: 693 aaggcagtgattactgttccagcttatttcaatga 727
>gb|AF031360.1|AF031360 Paramecium tetraurelia cytosolic heat shock protein 70 (HSP70) gene, partial cds Length = 648 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgt 615 |||||||||| ||||| |||||||||||||| Sbjct: 554 tttttgatcttggaggtggcacctttgatgt 584
>gb|AF031353.1|AF031353 Euplotes aediculatus cytosolic heat shock protein 70 (HSP70) gene, partial cds Length = 648 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 425 gcagtgatcacagttcctgcttatttcaatgactc 459 ||||| ||||||||||| || |||||||||||||| Sbjct: 388 gcagtcatcacagttccagcatatttcaatgactc 422
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagagg 466 |||| |||||||| || |||||||||||||||||| Sbjct: 28160454 tcactgttcctgcctacttcaatgactcccagagg 28160488
>ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G12580 (HSP70) mRNA, complete cds Length = 2281 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 434 acagttcctgcttatttcaatgactc 459 |||||||||||||||||||| ||||| Sbjct: 547 acagttcctgcttatttcaacgactc 572
>gb|BT016692.1| Zea mays clone Contig525 mRNA sequence Length = 1806 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 335 aagcagttcgctgccgaggagatctc 360 |||||||||||||| ||||||||||| Sbjct: 50 aagcagttcgctgctgaggagatctc 75
>gb|BC078115.1| Xenopus laevis cDNA clone MGC:83630 IMAGE:5084801, complete cds Length = 2589 Score = 44.1 bits (22), Expect = 0.54 Identities = 31/34 (91%) Strand = Plus / Plus Query: 585 tttttgatctgggaggaggcacctttgatgtctc 618 |||||||| |||||||||| || ||||||||||| Sbjct: 703 tttttgatttgggaggaggaacatttgatgtctc 736
>gb|AY643490.1| Cryptosporidium muris heat shock protein 70 gene, partial cds Length = 1024 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 434 acagttcctgcttatttcaatgactc 459 ||||||||||| |||||||||||||| Sbjct: 140 acagttcctgcctatttcaatgactc 165
>gb|AE008986.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 12 of 256 of the complete sequence Length = 9110 Score = 44.1 bits (22), Expect = 0.54 Identities = 28/30 (93%) Strand = Plus / Minus Query: 98 aacgccgagggcgcgcggaccacgccgtcg 127 ||||| || ||||||||||||||||||||| Sbjct: 6091 aacgcagaaggcgcgcggaccacgccgtcg 6062
>gb|AY240875.3| Cyclospora cayetanensis heat shock protein 70 gene, partial cds Length = 1284 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 506 gttcttcgtatcataaacgagcctac 531 |||||||||||||| ||||||||||| Sbjct: 435 gttcttcgtatcattaacgagcctac 460
>gb|DQ366743.1| Uncultured Prochlorococcus marinus clone HOT0M-8F9 genomic sequence Length = 27928 Score = 44.1 bits (22), Expect = 0.54 Identities = 64/78 (82%) Strand = Plus / Plus Query: 409 tgacaaagtcaccaaggcagtgatcacagttcctgcttatttcaatgactcccagaggac 468 ||||||||| || |||| || || |||||||| |||||||| ||||| ||||| || Sbjct: 13220 tgacaaagttacacaggctgtaattacagttccagcttattttaatgattcccaaagaca 13279 Query: 469 ggctacaaaagatgctgg 486 |||||| ||||||||||| Sbjct: 13280 ggctactaaagatgctgg 13297
>gb|DQ366739.1| Uncultured Prochlorococcus marinus clone HOT0M-7B6 genomic sequence Length = 11735 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Plus Query: 582 tggtttttgatctgggaggaggcacctttgatgtctca 619 ||||||||||| | |||||||| || |||||||||||| Sbjct: 11554 tggtttttgatttaggaggaggaacatttgatgtctca 11591
>gb|AE017158.1| Chlamydophila pneumoniae TW-183, section 2 of 4 of the complete genome Length = 300380 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 473 acaaaagatgctgggcgcattgcagg 498 |||||||||||||| ||||||||||| Sbjct: 281161 acaaaagatgctggacgcattgcagg 281186
>gb|AY172024.1| Crassostrea ariakensis heat shock protein 70 mRNA, complete cds Length = 2320 Score = 44.1 bits (22), Expect = 0.54 Identities = 31/34 (91%) Strand = Plus / Plus Query: 432 tcacagttcctgcttatttcaatgactcccagag 465 ||||||| || |||||||||||||| |||||||| Sbjct: 517 tcacagtcccagcttatttcaatgattcccagag 550 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 594 tgggaggaggcacctttgatgtctc 618 |||||||||| |||||||||||||| Sbjct: 697 tgggaggaggaacctttgatgtctc 721
>emb|Z69729.1|SPAC13G7 S.pombe chromosome I cosmid c13G7 Length = 25009 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Minus Query: 437 gttcctgcttatttcaatgactccca 462 ||||| |||||||||||||||||||| Sbjct: 3180 gttcccgcttatttcaatgactccca 3155
>emb|Y08582.1|FRHSP705 F.rubripes hsp70-5 gene, 5' Length = 2525 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttga 612 ||||| |||||||||||||||||||| Sbjct: 2382 tttgacctgggaggaggcacctttga 2407
>emb|Y08581.1|FRHSP704 F.rubripes hsp70-4 gene, complete Length = 5352 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttga 612 ||||| |||||||||||||||||||| Sbjct: 2381 tttgacctgggaggaggcacctttga 2406
>emb|Y08576.1|FRHSP701 F.rubripes hsp70-1 gene, 5' Length = 5248 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 587 tttgatctgggaggaggcacctttga 612 ||||| |||||||||||||||||||| Sbjct: 5105 tttgacctgggaggaggcacctttga 5130
>emb|X87113.1|AGDNAKJGE A.tumefaciens dnaK & dnaJ genes Length = 2818 Score = 44.1 bits (22), Expect = 0.54 Identities = 28/30 (93%) Strand = Plus / Plus Query: 98 aacgccgagggcgcgcggaccacgccgtcg 127 ||||| || ||||||||||||||||||||| Sbjct: 711 aacgcagaaggcgcgcggaccacgccgtcg 740
>emb|X63106.1|NTHSP70 N.tabacum Nthsp70 mRNA for heat shock protein 70 Length = 1894 Score = 44.1 bits (22), Expect = 0.54 Identities = 43/50 (86%) Strand = Plus / Plus Query: 434 acagttcctgcttatttcaatgactcccagaggacggctacaaaagatgc 483 ||||||||||||||||| ||||| || || ||| |||||| |||||||| Sbjct: 199 acagttcctgcttattttaatgattctcaaaggcaggctacgaaagatgc 248 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,227,777 Number of Sequences: 3902068 Number of extensions: 4227777 Number of successful extensions: 77928 Number of sequences better than 10.0: 609 Number of HSP's better than 10.0 without gapping: 596 Number of HSP's successfully gapped in prelim test: 13 Number of HSP's that attempted gapping in prelim test: 75683 Number of HSP's gapped (non-prelim): 2259 length of query: 624 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 601 effective length of database: 17,143,297,704 effective search space: 10303121920104 effective search space used: 10303121920104 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)