ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal1i23 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF549973.1| Xenopus laevis clone S10-37-A10 mRNA sequence Length = 683 Score = 202 bits (102), Expect = 1e-49 Identities = 108/111 (97%) Strand = Plus / Plus Query: 1 atgcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatgg 60 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 282 atgcgatggacgctatggatggcgccgtgctggacggacgcgagctgagggtgcagatgg 341 Query: 61 cccgctncgggcgccctcccgnctcccaccacggaaggcgagggcctcctc 111 |||||| |||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 342 cccgctacgggcgccctcccgactcccaccacggaaggcgagggcctcctc 392
>gb|BC064167.1| Xenopus tropicalis splicing factor, arginine/serine-rich 2 (SC-35), mRNA (cDNA clone MGC:75633 IMAGE:5379445), complete cds Length = 1762 Score = 119 bits (60), Expect = 2e-24 Identities = 96/109 (88%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| ||||||| |||||||||||||| || ||||||||||||||||||||| Sbjct: 335 gcgatggacgccatggatggggccgtgctggacgggcgggagctgagggtgcagatggcc 394 Query: 63 cgctncgggcgccctcccgnctcccaccacggaaggcgagggcctcctc 111 || | ||| || ||||||| ||||||||||||||| ||||||| |||| Sbjct: 395 cggtacggccggcctcccgattcccaccacggaaggagagggccccctc 443
>ref|NM_203997.1| Xenopus tropicalis splicing factor, arginine/serine-rich 2 (SC-35) (sfrs2), mRNA Length = 1762 Score = 119 bits (60), Expect = 2e-24 Identities = 96/109 (88%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| ||||||| |||||||||||||| || ||||||||||||||||||||| Sbjct: 335 gcgatggacgccatggatggggccgtgctggacgggcgggagctgagggtgcagatggcc 394 Query: 63 cgctncgggcgccctcccgnctcccaccacggaaggcgagggcctcctc 111 || | ||| || ||||||| ||||||||||||||| ||||||| |||| Sbjct: 395 cggtacggccggcctcccgattcccaccacggaaggagagggccccctc 443
>emb|CR760874.2| Xenopus tropicalis finished cDNA, clone TTpA004e12 Length = 1649 Score = 119 bits (60), Expect = 2e-24 Identities = 96/109 (88%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| ||||||| |||||||||||||| || ||||||||||||||||||||| Sbjct: 243 gcgatggacgccatggatggggccgtgctggacgggcgggagctgagggtgcagatggcc 302 Query: 63 cgctncgggcgccctcccgnctcccaccacggaaggcgagggcctcctc 111 || | ||| || ||||||| ||||||||||||||| ||||||| |||| Sbjct: 303 cggtacggccggcctcccgattcccaccacggaaggagagggccccctc 351
>gb|BC045229.1| Xenopus laevis splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:53177 IMAGE:5543005), complete cds Length = 1663 Score = 87.7 bits (44), Expect = 6e-15 Identities = 86/101 (85%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 |||||||||||| |||| || |||||| | ||||| || ||||||||||||||||||||| Sbjct: 315 gcgatggacgctatggacggggccgtgttagacgggcgggagctgagggtgcagatggcc 374 Query: 63 cgctncgggcgccctcccgnctcccaccacggaaggcgagg 103 |||| ||| || || |||| ||||| ||||||||| |||| Sbjct: 375 cgctacggacggccgcccgattcccatcacggaaggagagg 415
>ref|NM_001009720.1| Rattus norvegicus similar to splicing factor, arginine/serine-rich 2 (Sfrs2), mRNA Length = 1196 Score = 75.8 bits (38), Expect = 2e-11 Identities = 74/87 (85%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| ||||||| |||||||| || || ||||||||| ||||||||||||| ||| Sbjct: 381 atggacgccatggatggggccgtgctcgatggccgcgagctgcgggtgcagatggcgcgc 440 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| || ||||||| ||| |||||| Sbjct: 441 tacggccgtcctcccgactcgcaccac 467
>gb|BC058508.1| Rattus norvegicus similar to splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:73009 IMAGE:6889746), complete cds Length = 1196 Score = 75.8 bits (38), Expect = 2e-11 Identities = 74/87 (85%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| ||||||| |||||||| || || ||||||||| ||||||||||||| ||| Sbjct: 381 atggacgccatggatggggccgtgctcgatggccgcgagctgcgggtgcagatggcgcgc 440 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| || ||||||| ||| |||||| Sbjct: 441 tacggccgtcctcccgactcgcaccac 467
>gb|BC005493.1| Mus musculus splicing factor, arginine/serine-rich 2 (SC-35), mRNA (cDNA clone MGC:7377 IMAGE:3487678), complete cds Length = 1365 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 357 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 416 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 417 tacggccgcccgcccgactcgcaccac 443
>ref|XM_852679.1| PREDICTED: Canis familiaris similar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa), transcript variant 5 (LOC612817), mRNA Length = 2640 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||||||||| ||||||||| ||||||||||||| ||| Sbjct: 424 atggacgccatggacggggcggtgctggacggccgcgagctgcgggtgcagatggcgcgc 483 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| || | ||| |||||| Sbjct: 484 tacggccgcccgccggactcgcaccac 510
>ref|XM_852636.1| PREDICTED: Canis familiaris similar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa), transcript variant 4 (LOC612817), mRNA Length = 2744 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||||||||| ||||||||| ||||||||||||| ||| Sbjct: 424 atggacgccatggacggggcggtgctggacggccgcgagctgcgggtgcagatggcgcgc 483 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| || | ||| |||||| Sbjct: 484 tacggccgcccgccggactcgcaccac 510
>ref|XM_852595.1| PREDICTED: Canis familiaris similar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa), transcript variant 3 (LOC612817), mRNA Length = 2240 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||||||||| ||||||||| ||||||||||||| ||| Sbjct: 424 atggacgccatggacggggcggtgctggacggccgcgagctgcgggtgcagatggcgcgc 483 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| || | ||| |||||| Sbjct: 484 tacggccgcccgccggactcgcaccac 510
>ref|XM_843896.1| PREDICTED: Canis familiaris similar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa), transcript variant 2 (LOC612817), mRNA Length = 2136 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||||||||| ||||||||| ||||||||||||| ||| Sbjct: 424 atggacgccatggacggggcggtgctggacggccgcgagctgcgggtgcagatggcgcgc 483 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| || | ||| |||||| Sbjct: 484 tacggccgcccgccggactcgcaccac 510
>gb|AC091694.9| Mus musculus Strain C57BL6/J chromosome 11 BAC, RP23-316F3, Complete Sequence, complete sequence Length = 213119 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 94840 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 94899 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 94900 tacggccgcccgcccgactcgcaccac 94926
>dbj|AK161873.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330508C11 product:splicing factor, arginine/serine-rich 2 (SC-35), full insert sequence Length = 1880 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 375 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 434 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 435 tacggccgcccgcccgactcgcaccac 461
>dbj|AK076448.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched library, clone:4833401I21 product:splicing factor, arginine/serine-rich 2 (SC-35), full insert sequence Length = 1734 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 377 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 436 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 437 tacggccgcccgcccgactcgcaccac 463
>dbj|AK086103.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930005P03 product:splicing factor, arginine/serine-rich 2 (SC-35), full insert sequence Length = 1900 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 377 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 436 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 437 tacggccgcccgcccgactcgcaccac 463
>dbj|AK011528.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610024E04 product:splicing factor, arginine/serine-rich 2 (SC-35), full insert sequence Length = 1156 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 376 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 435 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 436 tacggccgcccgcccgactcgcaccac 462
>emb|AL645542.13| Mouse DNA sequence from clone RP23-468A19 on chromosome 11, complete sequence Length = 166100 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/87 (83%) Strand = Plus / Minus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| ||||||||| ||||||||||||| ||| Sbjct: 134913 atggacgccatggacggggcggtgctcgacggccgcgagctgcgggtgcagatggcgcgc 134854 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 134853 tacggccgcccgcccgactcgcaccac 134827
>ref|XM_519086.1| PREDICTED: Pan troglodytes similar to Splicing factor, arginine/serine-rich, 46kD (LOC463398), mRNA Length = 1752 Score = 63.9 bits (32), Expect = 9e-08 Identities = 38/40 (95%) Strand = Plus / Plus Query: 27 gtgctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||||| ||||||||||||| |||| Sbjct: 1105 gtgctggacggacgcgagctgcgggtgcagatggcgcgct 1144
>gb|AC004870.2| Homo sapiens PAC clone RP4-739M23 from 7, complete sequence Length = 144546 Score = 63.9 bits (32), Expect = 9e-08 Identities = 38/40 (95%) Strand = Plus / Minus Query: 27 gtgctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||||| ||||||||||||| |||| Sbjct: 42857 gtgctggacggacgcgagctgcgggtgcagatggcgcgct 42818
>ref|XM_936928.1| PREDICTED: Homo sapiens similar to Splicing factor, arginine/serine-rich, 46kD (LOC647864), mRNA Length = 1650 Score = 63.9 bits (32), Expect = 9e-08 Identities = 38/40 (95%) Strand = Plus / Plus Query: 27 gtgctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||||| ||||||||||||| |||| Sbjct: 1003 gtgctggacggacgcgagctgcgggtgcagatggcgcgct 1042
>ref|XM_930163.1| PREDICTED: Homo sapiens similar to Splicing factor, arginine/serine-rich, 46kD (LOC647145), mRNA Length = 1650 Score = 63.9 bits (32), Expect = 9e-08 Identities = 38/40 (95%) Strand = Plus / Plus Query: 27 gtgctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||||| ||||||||||||| |||| Sbjct: 1003 gtgctggacggacgcgagctgcgggtgcagatggcgcgct 1042
>ref|NM_001034118.1| Pan troglodytes splicing factor, arginine/serine-rich 2 (SFRS2), mRNA Length = 1937 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 403 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 462 Query: 84 tcccaccac 92 || |||||| Sbjct: 463 tcacaccac 471
>gb|BC001303.2| Homo sapiens splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:5480 IMAGE:3452024), complete cds Length = 1878 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 380 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 439 Query: 84 tcccaccac 92 || |||||| Sbjct: 440 tcacaccac 448
>gb|BC000339.2| Homo sapiens splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:8562 IMAGE:2822956), complete cds Length = 1900 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 383 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 442 Query: 84 tcccaccac 92 || |||||| Sbjct: 443 tcacaccac 451
>ref|NM_003016.2| Homo sapiens splicing factor, arginine/serine-rich 2 (SFRS2), mRNA Length = 2923 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 403 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 462 Query: 84 tcccaccac 92 || |||||| Sbjct: 463 tcacaccac 471
>emb|X75755.1|HSPR264SC H.sapiens PR264 gene Length = 4251 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 1448 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 1507 Query: 84 tcccaccac 92 || |||||| Sbjct: 1508 tcacaccac 1516
>emb|X62447.1|HSPR264 H.sapiens PR264 mRNA Length = 709 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 268 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 327 Query: 84 tcccaccac 92 || |||||| Sbjct: 328 tcacaccac 336
>gb|BC070086.1| Homo sapiens splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:87441 IMAGE:5296371), complete cds Length = 2923 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 403 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 462 Query: 84 tcccaccac 92 || |||||| Sbjct: 463 tcacaccac 471
>gb|BT007250.1| Homo sapiens splicing factor, arginine/serine-rich 2 mRNA, complete cds Length = 666 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 232 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 291 Query: 84 tcccaccac 92 || |||||| Sbjct: 292 tcacaccac 300
>emb|X03477.1|GGCMYBR Chicken c-myb mRNA Length = 2218 Score = 61.9 bits (31), Expect = 3e-07 Identities = 62/73 (84%) Strand = Plus / Minus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| |||| || ||||||||||| || |||||||| | |||||||||||| Sbjct: 77 gcgatggacgccatggacggggccgtgctggatggccgcgagctccgcgtgcagatggcc 18 Query: 63 cgctncgggcgcc 75 |||| ||| |||| Sbjct: 17 cgctacggccgcc 5
>emb|CR626719.1| full-length cDNA clone CS0DE009YF20 of Placenta of Homo sapiens (human) Length = 1359 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 380 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 439 Query: 84 tcccaccac 92 || |||||| Sbjct: 440 tcacaccac 448
>emb|CR624890.1| full-length cDNA clone CS0DH007YH06 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1851 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 382 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 441 Query: 84 tcccaccac 92 || |||||| Sbjct: 442 tcacaccac 450
>emb|CR623313.1| full-length cDNA clone CS0DN002YF07 of Adult brain of Homo sapiens (human) Length = 1824 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 383 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 442 Query: 84 tcccaccac 92 || |||||| Sbjct: 443 tcacaccac 451
>dbj|AK124792.1| Homo sapiens cDNA FLJ42802 fis, clone BRCAN2002562, moderately similar to Splicing factor, arginine/serine-rich 2 Length = 1927 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 446 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 505 Query: 84 tcccaccac 92 || |||||| Sbjct: 506 tcacaccac 514
>emb|CR620472.1| full-length cDNA clone CS0DE005YO24 of Placenta of Homo sapiens (human) Length = 1840 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 380 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 439 Query: 84 tcccaccac 92 || |||||| Sbjct: 440 tcacaccac 448
>emb|CR621293.1| full-length cDNA clone CS0DG005YK06 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1784 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 356 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 415 Query: 84 tcccaccac 92 || |||||| Sbjct: 416 tcacaccac 424
>dbj|AK098209.1| Homo sapiens cDNA FLJ40890 fis, clone UTERU2001024, highly similar to SPLICING FACTOR, ARGININE/SERINE-RICH 2 Length = 2846 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 374 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 433 Query: 84 tcccaccac 92 || |||||| Sbjct: 434 tcacaccac 442
>emb|CR618477.1| full-length cDNA clone CL0BB008ZA09 of Neuroblastoma of Homo sapiens (human) Length = 1842 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 380 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 439 Query: 84 tcccaccac 92 || |||||| Sbjct: 440 tcacaccac 448
>emb|CR605207.1| full-length cDNA clone CS0DG004YF12 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1340 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 379 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 438 Query: 84 tcccaccac 92 || |||||| Sbjct: 439 tcacaccac 447
>emb|CR597972.1| full-length cDNA clone CS0DE003YA11 of Placenta of Homo sapiens (human) Length = 1835 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 379 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 438 Query: 84 tcccaccac 92 || |||||| Sbjct: 439 tcacaccac 447
>emb|CR593478.1| full-length cDNA clone CS0DE001YG08 of Placenta of Homo sapiens (human) Length = 1827 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 379 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 438 Query: 84 tcccaccac 92 || |||||| Sbjct: 439 tcacaccac 447
>gb|AC027694.8| Homo sapiens chromosome 17, clone CTD1-2246P4, complete sequence Length = 102202 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 98038 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 98097 Query: 84 tcccaccac 92 || |||||| Sbjct: 98098 tcacaccac 98106
>dbj|AB168918.1| Macaca fascicularis testis cDNA, clone: QtsA-15801, similar to human splicing factor, arginine/serine-rich 2 (SFRS2), mRNA, RefSeq: NM_003016.1 Length = 1913 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 405 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 464 Query: 84 tcccaccac 92 || |||||| Sbjct: 465 tcacaccac 473
>dbj|AK223252.1| Homo sapiens mRNA for splicing factor, arginine/serine-rich 2 variant, clone: STM04813 Length = 1868 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 402 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 461 Query: 84 tcccaccac 92 || |||||| Sbjct: 462 tcacaccac 470
>dbj|AB188282.1| Pan troglodytes sfrs2 mRNA for arginine/serine-rich 2 splicing factor, complete cds Length = 1937 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 403 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 462 Query: 84 tcccaccac 92 || |||||| Sbjct: 463 tcacaccac 471
>ref|NM_205306.1| Gallus gallus v-myb myeloblastosis viral oncogene homolog (avian) (MYB), mRNA Length = 2218 Score = 61.9 bits (31), Expect = 3e-07 Identities = 62/73 (84%) Strand = Plus / Minus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| |||| || ||||||||||| || |||||||| | |||||||||||| Sbjct: 77 gcgatggacgccatggacggggccgtgctggatggccgcgagctccgcgtgcagatggcc 18 Query: 63 cgctncgggcgcc 75 |||| ||| |||| Sbjct: 17 cgctacggccgcc 5
>gb|AY888746.1| Synthetic construct Homo sapiens clone FLH023446.01X splicing factor arginine/serine-rich 2 (SFRS2) mRNA, complete cds Length = 666 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 232 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 291 Query: 84 tcccaccac 92 || |||||| Sbjct: 292 tcacaccac 300
>gb|AC005837.1|AC005837 Homo sapiens chromosome 17, clone hRPK.318_A_15, complete sequence Length = 163218 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 26561 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 26620 Query: 84 tcccaccac 92 || |||||| Sbjct: 26621 tcacaccac 26629
>gb|AF015190.1|AF015190 Homo sapiens clone ET61 ET mRNA, alternatively spliced partial sequence Length = 818 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Minus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 365 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 306 Query: 84 tcccaccac 92 || |||||| Sbjct: 305 tcacaccac 297
>gb|AF015189.1|AF015189 Homo sapiens clone ET51 ET mRNA, alternatively spliced partial sequence Length = 2128 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Minus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 619 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 560 Query: 84 tcccaccac 92 || |||||| Sbjct: 559 tcacaccac 551
>gb|AF015188.1|AF015188 Homo sapiens clone ET42 ET mRNA, alternatively spliced partial sequence Length = 1223 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Minus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 904 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 845 Query: 84 tcccaccac 92 || |||||| Sbjct: 844 tcacaccac 836
>gb|AF015187.1|AF015187 Homo sapiens clone ET32 ET mRNA, alternatively spliced partial sequence Length = 446 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Minus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 77 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 18 Query: 84 tcccaccac 92 || |||||| Sbjct: 17 tcacaccac 9
>gb|AF015186.1|AF015186 Homo sapiens clone ET22 ET putative translation product (ET) mRNA, alternatively spliced complete cds Length = 1985 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Minus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 77 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 18 Query: 84 tcccaccac 92 || |||||| Sbjct: 17 tcacaccac 9
>gb|M90104.1|HUMSC35A Human splicing factor SC35 mRNA, complete cds Length = 1879 Score = 61.9 bits (31), Expect = 3e-07 Identities = 59/69 (85%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 387 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 446 Query: 84 tcccaccac 92 || |||||| Sbjct: 447 tcacaccac 455
>ref|NM_011358.1| Mus musculus splicing factor, arginine/serine-rich 2 (SC-35) (Sfrs2), mRNA Length = 1900 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/87 (82%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| |||||||| ||||||||||||| ||| Sbjct: 367 atggacgccatggacggggcggtgctcgacggccgcgagctacgggtgcagatggcgcgc 426 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 427 tacggccgcccgcccgactcgcaccac 453
>emb|X98511.1|MMPR264 M.musculus PR264 gene Length = 1620 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/87 (82%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| |||||||| ||||||||||||| ||| Sbjct: 1386 atggacgccatggacggggcggtgctcgacggccgcgagctacgggtgcagatggcgcgc 1445 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 1446 tacggccgcccgcccgactcgcaccac 1472
>dbj|AK165670.1| Mus musculus bone marrow stroma cell CRL-2028 SR-4987 cDNA, RIKEN full-length enriched library, clone:G430128O14 product:splicing factor, arginine/serine-rich 2 (SC-35), full insert sequence Length = 1894 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/87 (82%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| |||||||| ||||||||||||| ||| Sbjct: 381 atggacgccatggacggggcggtgctcgacggccgcgagctacgggtgcagatggcgcgc 440 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 441 tacggccgcccgcccgactcgcaccac 467
>dbj|AK088042.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002L15 product:splicing factor, arginine/serine-rich 2 (SC-35), full insert sequence Length = 1892 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/87 (82%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| |||||||| ||||||||||||| ||| Sbjct: 377 atggacgccatggacggggcggtgctcgacggccgcgagctacgggtgcagatggcgcgc 436 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 437 tacggccgcccgcccgactcgcaccac 463
>gb|BC105138.1| Bos taurus splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:127100 IMAGE:7943684), complete cds Length = 3115 Score = 60.0 bits (30), Expect = 1e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccc 76 ||||| |||||||| ||||||||| ||||||||||||| |||| ||| ||||| Sbjct: 448 gccgtactggacggccgcgagctgcgggtgcagatggcgcgctacggccgccc 500
>ref|NM_001034318.1| Bos taurus splicing factor, arginine/serine-rich 2 (SFRS2), mRNA Length = 3115 Score = 60.0 bits (30), Expect = 1e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccc 76 ||||| |||||||| ||||||||| ||||||||||||| |||| ||| ||||| Sbjct: 448 gccgtactggacggccgcgagctgcgggtgcagatggcgcgctacggccgccc 500
>gb|AF077858.1|AF077858 Mus musculus splicing factor SC35 mRNA, complete cds Length = 1900 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/87 (82%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| |||||||| ||||||||||||| ||| Sbjct: 367 atggacgccatggacggggcggtgctcgacggccgcgagctacgggtgcagatggcgcgc 426 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 427 tacggccgcccgcccgactcgcaccac 453
>emb|X63448.1|HSETLOC H.sapiens DNA for ET locus Length = 170 Score = 60.0 bits (30), Expect = 1e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccc 76 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| Sbjct: 62 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctacggccgccc 10
>gb|L13610.1|MUSIREBF2A Mus musculus IFN-response element binding factor 2 (IREBF2) mRNA, 3' end Length = 1093 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/87 (82%) Strand = Plus / Plus Query: 6 atggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcccgc 65 |||||||| |||| || || ||||| ||||| |||||||| ||||||||||||| ||| Sbjct: 351 atggacgccatggacggggcggtgctcgacggccgcgagctacgggtgcagatggcgcgc 410 Query: 66 tncgggcgccctcccgnctcccaccac 92 | ||| ||||| |||| ||| |||||| Sbjct: 411 tacggccgcccgcccgactcgcaccac 437
>emb|CR727772.2|CNS0GOHU Tetraodon nigroviridis full-length cDNA Length = 1828 Score = 58.0 bits (29), Expect = 5e-06 Identities = 55/64 (85%) Strand = Plus / Plus Query: 1 atgcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatgg 60 ||||||||||||| |||| |||||| | ||||| ||||| |||||| |||| ||||||| Sbjct: 338 atgcgatggacgccatggacggcgccctcctggatggacgggagctgcgggttcagatgg 397 Query: 61 cccg 64 |||| Sbjct: 398 cccg 401
>emb|X62446.1|GGPR264 G.gallus PR264 mRNA Length = 709 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/90 (82%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| |||| || ||||| ||||| || |||||||| | |||||||||||| Sbjct: 247 gcgatggacgccatggacggggccgttctggatggccgcgagctccgcgtgcagatggcc 306 Query: 63 cgctncgggcgccctcccgnctcccaccac 92 |||| ||| ||||| || | ||| |||||| Sbjct: 307 cgctacggccgccccccggactcgcaccac 336
>ref|NM_001001305.1| Gallus gallus arginine/serine-rich2 splicing factor (SFRS2), mRNA Length = 709 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/90 (82%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| |||| || ||||| ||||| || |||||||| | |||||||||||| Sbjct: 247 gcgatggacgccatggacggggccgttctggatggccgcgagctccgcgtgcagatggcc 306 Query: 63 cgctncgggcgccctcccgnctcccaccac 92 |||| ||| ||||| || | ||| |||||| Sbjct: 307 cgctacggccgccccccggactcgcaccac 336
>emb|X63447.1|GGETLOC G.gallus DNA for ET locus Length = 283 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/90 (82%) Strand = Plus / Minus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggcc 62 ||||||||||| |||| || ||||| ||||| || |||||||| | |||||||||||| Sbjct: 186 gcgatggacgccatggacggggccgttctggatggccgcgagctccgcgtgcagatggcc 127 Query: 63 cgctncgggcgccctcccgnctcccaccac 92 |||| ||| ||||| || | ||| |||||| Sbjct: 126 cgctacggccgccccccggactcgcaccac 97
>dbj|AK092489.1| Homo sapiens cDNA FLJ35170 fis, clone PLACE6012942, highly similar to SPLICING FACTOR, ARGININE/SERINE-RICH 2 Length = 1814 Score = 56.0 bits (28), Expect = 2e-05 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgg 70 |||||||||||||| ||||||||| ||||||| ||||| |||| ||| Sbjct: 403 gccgtgctggacggccgcgagctgcgggtgcaaatggcgcgctgcgg 449
>dbj|AK123712.1| Homo sapiens cDNA FLJ41718 fis, clone HLUNG2013097, highly similar to SPLICING FACTOR, ARGININE/SERINE-RICH 2 Length = 2770 Score = 54.0 bits (27), Expect = 8e-05 Identities = 58/69 (84%) Strand = Plus / Plus Query: 24 gccgtgctggacggacgcgagctgagggtgcagatggcccgctncgggcgccctcccgnc 83 ||||||||||||| ||||||||| ||||||| ||||| |||| ||| ||||| || | | Sbjct: 383 gccgtgctggacgcccgcgagctgcgggtgcaaatggcgcgctacggccgccccccggac 442 Query: 84 tcccaccac 92 || |||||| Sbjct: 443 tcacaccac 451
>ref|XM_508706.1| PREDICTED: Pan troglodytes similar to FLJ10251 protein (LOC451494), mRNA Length = 3009 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 2682 gctggacggacgcgagctgcgggtgcaggtggcgcgct 2719
>gb|BC057783.1| Homo sapiens Splicing factor, arginine/serine-rich, 46kD, mRNA (cDNA clone MGC:71595 IMAGE:5285882), complete cds Length = 1950 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 298 gctggacggacgcgagctgcgggtgcaggtggcgcgct 335
>dbj|AK023379.1| Homo sapiens cDNA FLJ13317 fis, clone OVARC1001577, highly similar to Homo sapiens SRp46 splicing factor transcribed retropseudogene Length = 1966 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 473 gctggacggacgcgagctgcgggtgcaggtggcgcgct 510
>gb|AF031166.1|AF031166 Homo sapiens SRp46 splicing factor (SRP46) mRNA, partial cds Length = 1874 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 207 gctggacggacgcgagctgcgggtgcaggtggcgcgct 244
>gb|AF031165.1|AF031165 Homo sapiens SRp46 splicing factor (SRp46) retropseudogene, complete cds Length = 2347 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 620 gctggacggacgcgagctgcgggtgcaggtggcgcgct 657
>ref|NM_032102.1| Homo sapiens Splicing factor, arginine/serine-rich, 46kD (SRP46), mRNA Length = 2186 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 519 gctggacggacgcgagctgcgggtgcaggtggcgcgct 556
>dbj|AP001264.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-735A19, complete sequence Length = 74520 Score = 52.0 bits (26), Expect = 3e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 29 gctggacggacgcgagctgagggtgcagatggcccgct 66 ||||||||||||||||||| |||||||| |||| |||| Sbjct: 21319 gctggacggacgcgagctgcgggtgcaggtggcgcgct 21356
>emb|CR352342.9| Zebrafish DNA sequence from clone CH211-134H7 in linkage group 12, complete sequence Length = 186937 Score = 48.1 bits (24), Expect = 0.005 Identities = 50/59 (84%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggc 61 |||||||| || |||| ||||| |||||||||| ||||||||| | ||||||||||| Sbjct: 10453 gcgatggatgccatggacggcgcattgctggacgggcgcgagctgcgcgtgcagatggc 10511
>ref|XM_677914.1| PREDICTED: Danio rerio similar to ring finger protein 157 (LOC555415), mRNA Length = 3144 Score = 48.1 bits (24), Expect = 0.005 Identities = 50/59 (84%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggc 61 |||||||| || |||| ||||| |||||||||| ||||||||| | ||||||||||| Sbjct: 211 gcgatggatgccatggacggcgcattgctggacgggcgcgagctgcgcgtgcagatggc 269
>gb|BC046045.1| Danio rerio splicing factor, arginine/serine-rich 2, mRNA (cDNA clone MGC:56283 IMAGE:5602509), complete cds Length = 1796 Score = 48.1 bits (24), Expect = 0.005 Identities = 50/59 (84%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggc 61 |||||||| || |||| ||||| |||||||||| ||||||||| | ||||||||||| Sbjct: 355 gcgatggatgccatggacggcgcattgctggacgggcgcgagctgcgcgtgcagatggc 413
>ref|NM_213382.1| Danio rerio splicing factor, arginine/serine-rich 2 (sfrs2), mRNA Length = 1796 Score = 48.1 bits (24), Expect = 0.005 Identities = 50/59 (84%) Strand = Plus / Plus Query: 3 gcgatggacgctntggatggcgccgtgctggacggacgcgagctgagggtgcagatggc 61 |||||||| || |||| ||||| |||||||||| ||||||||| | ||||||||||| Sbjct: 355 gcgatggatgccatggacggcgcattgctggacgggcgcgagctgcgcgtgcagatggc 413
>gb|AC010674.11| Homo sapiens chromosome 15 clone RP11-430B1 map 15q21.1, complete sequence Length = 214415 Score = 42.1 bits (21), Expect = 0.32 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 gctgagggtgcagatggcccg 64 ||||||||||||||||||||| Sbjct: 4213 gctgagggtgcagatggcccg 4193
>gb|AC023906.7|AC023906 Homo sapiens chromosome 15 clone CTD-2184D3 map 15q21.2, complete sequence Length = 93287 Score = 42.1 bits (21), Expect = 0.32 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 gctgagggtgcagatggcccg 64 ||||||||||||||||||||| Sbjct: 86221 gctgagggtgcagatggcccg 86201
>ref|XM_813258.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053510465.10) partial mRNA Length = 10440 Score = 38.2 bits (19), Expect = 5.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 16 tggatggcgccgtgctgga 34 ||||||||||||||||||| Sbjct: 7895 tggatggcgccgtgctgga 7913
>ref|XM_844526.1| PREDICTED: Canis familiaris similar to EEA1 (Early Endosome Antigen, Rab effector) homolog family member (eea-1) (LOC607741), mRNA Length = 4722 Score = 38.2 bits (19), Expect = 5.0 Identities = 22/23 (95%) Strand = Plus / Plus Query: 42 gagctgagggtgcagatggcccg 64 ||||||||||||||| ||||||| Sbjct: 358 gagctgagggtgcaggtggcccg 380
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 38.2 bits (19), Expect = 5.0 Identities = 22/23 (95%) Strand = Plus / Plus Query: 21 ggcgccgtgctggacggacgcga 43 ||||||||||||||||| ||||| Sbjct: 215434 ggcgccgtgctggacgggcgcga 215456
>gb|AE012418.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 326 of 460 of the complete genome Length = 10118 Score = 38.2 bits (19), Expect = 5.0 Identities = 25/27 (92%) Strand = Plus / Plus Query: 21 ggcgccgtgctggacggacgcgagctg 47 ||||||||||||| || |||||||||| Sbjct: 9897 ggcgccgtgctggccgaacgcgagctg 9923
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 38.2 bits (19), Expect = 5.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 21 ggcgccgtgctggacggacgcgagctg 47 ||||||||||||| || |||||||||| Sbjct: 1340241 ggcgccgtgctggccgaacgcgagctg 1340215 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 346,968 Number of Sequences: 3902068 Number of extensions: 346968 Number of successful extensions: 22444 Number of sequences better than 10.0: 88 Number of HSP's better than 10.0 without gapping: 88 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 22296 Number of HSP's gapped (non-prelim): 148 length of query: 111 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 90 effective length of database: 17,151,101,840 effective search space: 1543599165600 effective search space used: 1543599165600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
