>emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BAC clone T8H10
          Length = 87503

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 469  tgaaaaagaagatattcaaatatttgttgt 498
            |||||||||||||||||||||||| |||||
Sbjct: 2448 tgaaaaagaagatattcaaatattagttgt 2477

>ref|XM_632930.1| Dictyostelium discoideum hypothetical protein (DDB0218761), partial
            mRNA
          Length = 3096

 Score = 44.1 bits (22), Expect = 0.65
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 159  taaatctttaacatcatcaacatcat 184
            |||||| |||||||||||||||||||
Sbjct: 1062 taaatcattaacatcatcaacatcat 1087

>gb|AC007239.3| Homo sapiens BAC clone RP11-83A12 from 2, complete sequence
          Length = 139391

 Score = 44.1 bits (22), Expect = 0.65
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 470   gaaaaagaagatattcaaatat 491
             ||||||||||||||||||||||
Sbjct: 17463 gaaaaagaagatattcaaatat 17484

>emb|Z92777.1|CEC17H1 Caenorhabditis elegans Cosmid C17H1, complete sequence
          Length = 37261

 Score = 44.1 bits (22), Expect = 0.65
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 566   ttgttcttgctaattgtaactt 587
             ||||||||||||||||||||||
Sbjct: 31243 ttgttcttgctaattgtaactt 31264



 Score = 44.1 bits (22), Expect = 0.65
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 566   ttgttcttgctaattgtaactt 587
             ||||||||||||||||||||||
Sbjct: 11176 ttgttcttgctaattgtaactt 11197



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 567   tgttcttgctaattgtaactt 587
             |||||||||||||||||||||
Sbjct: 33960 tgttcttgctaattgtaactt 33980

>ref|XM_640467.1| Dictyostelium discoideum hypothetical protein (DDB0168382), partial
            mRNA
          Length = 8103

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 609  tggattcaatcatcgaattcaaatt 633
            |||||||||||||| ||||||||||
Sbjct: 2422 tggattcaatcatcaaattcaaatt 2446

>gb|AC157491.12| Mus musculus chromosome 8, clone RP24-289G15, complete sequence
          Length = 168377

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 685   tttcaagtttttgaagttaga 705
             |||||||||||||||||||||
Sbjct: 70116 tttcaagtttttgaagttaga 70136

>gb|AC104964.12| Homo sapiens chromosome 8, clone RP11-981G7, complete sequence
          Length = 212226

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      aatttgaacatagatacacag 28
              |||||||||||||||||||||
Sbjct: 204328 aatttgaacatagatacacag 204308

>emb|AJ832111.1| Themira arctica mitochondrial partial coi gene for cytochrome oxidase
            subunit I
          Length = 1510

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 560  ctggagttgttcttgctaatt 580
            |||||||||||||||||||||
Sbjct: 1042 ctggagttgttcttgctaatt 1062

>gb|AF417730.1| Ochlerotatus triseriatus cytochrome c oxidase subunit I (COI) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 903

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 560 ctggagttgttcttgctaatt 580
           |||||||||||||||||||||
Sbjct: 437 ctggagttgttcttgctaatt 457

>emb|AL583841.16| Human DNA sequence from clone RP11-556L2 on chromosome 9 Contains part of
              the ROR2 gene for receptor tyrosine kinase-like orphan
              receptor, complete sequence
          Length = 192799

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 533    ttttctgcattttctttaagatgta 557
              ||||||||||||||||||| |||||
Sbjct: 178569 ttttctgcattttctttaatatgta 178545

>emb|AL158052.10| Human DNA sequence from clone RP11-570J20 on chromosome 9q33.1-34.12
              Contains three novel genes, the 3' end of the LHX2 gene for
              LIM homeobox protein 2 and four CpG islands, complete
              sequence
          Length = 221887

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 221    tgaaggccagttgagttgttggcaa 245
              |||||| ||||||||||||||||||
Sbjct: 135706 tgaaggacagttgagttgttggcaa 135730

>gb|AF187145.1| Arixyleborus medius cytochrome oxidase I gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1179

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 560 ctggagttgttcttgctaatt 580
           |||||||||||||||||||||
Sbjct: 788 ctggagttgttcttgctaatt 808

>gb|AF348838.1| Coloceras laticlypeatus cytochrome oxidase subunit I gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 383

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 560 ctggagttgttcttgctaatt 580
           |||||||||||||||||||||
Sbjct: 341 ctggagttgttcttgctaatt 361

>gb|AF278543.1|AF278543 Acalymma blandulum cytochrome oxidase subunit I (COI) gene, partial
           cds; and tRNA-Leu gene, partial sequence; mitochondrial
           genes for mitochondrial products
          Length = 1341

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 560 ctggagttgttcttgctaatt 580
           |||||||||||||||||||||
Sbjct: 836 ctggagttgttcttgctaatt 856

>gb|AF278652.1|AF278652 Auricotes rotundus cytochrome oxidase subunit I gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 383

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 560 ctggagttgttcttgctaatt 580
           |||||||||||||||||||||
Sbjct: 341 ctggagttgttcttgctaatt 361

>gb|AF253033.1|AF253033 Aedes mariae isolate mar 2 cytochrome oxidase subunit I (COI) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 763

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 560 ctggagttgttcttgctaatt 580
           |||||||||||||||||||||
Sbjct: 299 ctggagttgttcttgctaatt 319

>gb|AC116982.2| Dictyostelium discoideum chromosome 2 map 3622643-3879522 strain AX4,
             complete sequence
          Length = 256879

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 609   tggattcaatcatcgaattcaaatt 633
             |||||||||||||| ||||||||||
Sbjct: 67329 tggattcaatcatcaaattcaaatt 67353


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,018,915
Number of Sequences: 3902068
Number of extensions: 8018915
Number of successful extensions: 167765
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 167726
Number of HSP's gapped (non-prelim): 39
length of query: 739
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 716
effective length of database: 17,143,297,704
effective search space: 12274601156064
effective search space used: 12274601156064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)