ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal41p12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009457.1| Triticum aestivum clone wlp1c.pk007.f6:fis, full ... 1128 0.0
2dbj|AK065019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 607 e-170
3dbj|AK061771.1| Oryza sativa (japonica cultivar-group) cDNA clon... 601 e-168
4gb|AY103957.1| Zea mays PCO116832 mRNA sequence 525 e-146
5gb|BT009148.1| Triticum aestivum clone wl1n.pk0059.g7:fis, full ... 293 4e-76
6dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 289 6e-75
7dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D... 289 6e-75
8ref|NM_103909.3| Arabidopsis thaliana FTSH1; ATP-dependent pepti... 206 6e-50
9gb|AY123034.1| Arabidopsis thaliana putative chloroplast FtsH pr... 206 6e-50
10gb|AY091095.1| Arabidopsis thaliana putative chloroplast FtsH pr... 206 6e-50
11emb|X99808.1|ATFTSH A.thaliana mRNA for chloroplast FtsH protease 198 2e-47
12emb|BX815046.1|CNS0AE0R Arabidopsis thaliana Full-length cDNA Co... 198 2e-47
13emb|Y12780.1|ATAAAA A.thaliana mRNA for ATPase, partial 186 6e-44
14gb|DQ339462.1| Vitis pseudoreticulata ATPase mRNA, complete cds 182 9e-43
15gb|AC007980.1| Arabidopsis thaliana chromosome I BAC F14I3 genom... 176 6e-41
16emb|X90472.1|CAATPASE C.annuum mRNA for ATPase protein 168 1e-38
17dbj|AB017480.2| Nicotiana tabacum mRNA for chloroplast FtsH prot... 149 1e-32
18ref|NM_123592.2| Arabidopsis thaliana VAR1 (VARIEGATED 1); ATP-d... 131 3e-27
19gb|AY126987.1| Arabidopsis thaliana AT5g42270/K5J14_7 mRNA, comp... 131 3e-27
20dbj|AP003569.3| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
21dbj|AP003509.3| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
22dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 115 2e-22
23gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 109 1e-20
24emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segmen... 105 2e-19
25gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 96 2e-16
26dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 94 7e-16
27dbj|AB032368.1| Thermus thermophilus clpB, dafA, dnaJ, grpE, dna... 94 7e-16
28gb|AE017221.1| Thermus thermophilus HB27, complete genome 86 2e-13
29emb|BX572096.1| Prochlorococcus marinus MIT9313 complete genome;... 72 2e-09
30gb|CP000110.1| Synechococcus sp. CC9605, complete genome 70 1e-08
31gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 70 1e-08
32gb|AF332134.1| Medicago sativa FtsH protease (FtsH) mRNA, comple... 70 1e-08
33dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 70 1e-08
34gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 68 4e-08
35gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 68 4e-08
36emb|AJ488199.1|PVI488199 Uncultured bacterium gene for putative ... 68 4e-08
37dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 66 2e-07
38gb|CP000088.1| Thermobifida fusca YX, complete genome 64 6e-07
39gb|CP000097.1| Synechococcus sp. CC9902, complete genome 62 2e-06
40gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 60 9e-06
41gb|AE005986.1| Caulobacter crescentus CB15 section 312 of 359 of... 60 9e-06
42gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 58 4e-05
43emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 58 4e-05
44dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 58 4e-05
45gb|AE006470.1| Chlorobium tepidum TLS, complete genome 58 4e-05
46gb|AE004888.1| Pseudomonas aeruginosa PAO1, section 449 of 529 o... 58 4e-05
47dbj|AK110158.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 4e-05
48gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 58 4e-05
49gb|AC175197.2| Sporobolomyces roseus clone JGIBAIF-21O18, comple... 56 1e-04
50gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 54 6e-04
51emb|AL939124.1|SCO939124 Streptomyces coelicolor A3(2) complete ... 54 6e-04
52emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete ... 54 6e-04
53gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 54 6e-04
54dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 54 6e-04
55gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 54 6e-04
56gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 54 6e-04
57dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 54 6e-04
58emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 54 6e-04
59gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 54 6e-04
60gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 52 0.002
61emb|CR555306.1| Azoarcus sp. EbN1 complete genome 52 0.002
62emb|BX248359.1| Corynebacterium diphtheriae gravis NCTC13129, co... 52 0.002
63emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A stra... 52 0.002
64gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 52 0.002
65dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 52 0.002
66gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome 52 0.002
67gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 52 0.002
68gb|AE002098.2| Neisseria meningitidis MC58, complete genome 52 0.002
69gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 52 0.002
70gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 50 0.009
71emb|BX014465.1|CNS08JBP Single read from an extremity of a full-... 50 0.009
72emb|BX014464.1|CNS08JBO Single read from an extremity of a full-... 50 0.009
73gb|CP000133.1| Rhizobium etli CFN 42, complete genome 50 0.009
74gb|CP000249.1| Frankia sp. CcI3, complete genome 50 0.009
75emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 50 0.009
76gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 50 0.009
77gb|AE010377.1| Methanopyrus kandleri AV19 section 76 of 157 of t... 48 0.035
78gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.035
79gb|AF037269.1| Mycobacterium smegmatis cell division protein (Ft... 48 0.035
80gb|AY540192.1| Oreochromis mossambicus proteasome 26S ATPase sub... 48 0.035
81ref|XM_570849.1| Cryptococcus neoformans var. neoformans JEC21 e... 48 0.035
82emb|CR727756.2|CNS0GOHE Tetraodon nigroviridis full-length cDNA 48 0.035
83emb|CR719511.2|CNS0GI4D Tetraodon nigroviridis full-length cDNA 48 0.035
84emb|CR708630.2|CNS0G9QA Tetraodon nigroviridis full-length cDNA 48 0.035
85emb|CR695652.2|CNS0FZPS Tetraodon nigroviridis full-length cDNA 48 0.035
86emb|CR689180.2|CNS0FUQ0 Tetraodon nigroviridis full-length cDNA 48 0.035
87emb|CR661563.2|CNS0F9FL Tetraodon nigroviridis full-length cDNA 48 0.035
88emb|CR650415.2|CNS0F0TX Tetraodon nigroviridis full-length cDNA 48 0.035
89emb|CR649796.2|CNS0F0CQ Tetraodon nigroviridis full-length cDNA 48 0.035
90emb|CR646015.2|CNS0EXFP Tetraodon nigroviridis full-length cDNA 48 0.035
91gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 48 0.035
92gb|BC044464.1| Danio rerio nuclear VCP-like, mRNA (cDNA clone MG... 48 0.035
93ref|NM_213484.1| Danio rerio nuclear VCP-like (nvl), mRNA 48 0.035
94dbj|AB236774.1| Trifolium pratense RNA for putative zinc depende... 48 0.035
95gb|AF319040.1|AF319040 Leishmania donovani ATP-dependent zinc me... 48 0.035
96gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 46 0.14
97gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 46 0.14
98gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 46 0.14
99ref|XM_482385.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.14
100gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 46 0.14
101gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 46 0.14
102gb|AE009302.1| Agrobacterium tumefaciens str. C58 linear chromos... 46 0.14
103gb|AE008312.1| Agrobacterium tumefaciens str. C58 linear chromos... 46 0.14
104gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 46 0.14
105ref|XM_765222.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_80_6... 46 0.14
106ref|XM_766189.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_306_... 46 0.14
107gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 46 0.14
108ref|XM_782306.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.14
109emb|Z83338.1|MTZ83338 M.tuberculosis H37Ra ftsH gene, partial 46 0.14
110emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome... 46 0.14
111emb|BX572092.1| Prochlorococcus marinus MED4 complete genome; se... 46 0.14
112emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segmen... 46 0.14
113emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 46 0.14
114gb|AF456414.1| Giardia intestinalis endosomal AAA ATPase-like pr... 46 0.14
115ref|XM_697576.1| PREDICTED: Danio rerio hypothetical protein LOC... 46 0.14
116gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 46 0.14
117dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
118dbj|BA000002.2| Aeropyrum pernix K1 DNA, complete genome 46 0.14
119gb|AE005094.1| Halobacterium sp. NRC-1 section 125 of 170 of the... 46 0.14
120dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
121ref|XM_316268.2| Anopheles gambiae str. PEST ENSANGP00000020514 ... 46 0.14
122gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 46 0.14
123gb|AE010343.1| Methanopyrus kandleri AV19 section 42 of 157 of t... 44 0.55
124gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 44 0.55
125gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 44 0.55
126ref|XM_359584.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.55
127gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 44 0.55
128emb|AL591791.1|SME591791 Sinorhizobium meliloti 1021 complete ch... 44 0.55
129emb|AJ243808.1|BJA243808 Bradyrhizobium japonicum yaeN and ftsH ... 44 0.55
130ref|XM_500040.1| Yarrowia lipolytica CLIB122, YALI0A13541g predi... 44 0.55
131gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 44 0.55
132emb|BX572090.1| Prochlorococcus marinus MED4 complete genome; se... 44 0.55
133emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 44 0.55
134emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 44 0.55
135emb|BX321857.1| Nitrosomonas europaea ATCC 19718, complete genom... 44 0.55
136gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 44 0.55
137dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 44 0.55
138gb|AE009637.1| Brucella melitensis 16M chromosome I, section 194... 44 0.55
139gb|AE004918.1| Pseudomonas aeruginosa PAO1, section 479 of 529 o... 44 0.55
140dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.55
141dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 44 0.55
142gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 44 0.55
143gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 44 0.55
144gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 44 0.55
145gb|AF006691.1|AF006691 Pseudomonas putida regulatory protein (ip... 44 0.55
146emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 44 0.55
147emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 44 0.55
148dbj|AB018433.1| Pyrococcus kodakaraensis Pk-cdcA gene, complete cds 44 0.55
149gb|AC002511.1| Homo sapiens chromosome 19 clone PC28130, complet... 42 2.2
150gb|DQ214550.1| Taeniopygia guttata clone 0061P0013A02 26S ATPase... 42 2.2
151gb|DQ214549.1| Taeniopygia guttata clone 0063P0013D05 26S ATPase... 42 2.2
152ref|XM_324383.1| Neurospora crassa OR74A predicted protein (NCU0... 42 2.2
153ref|XM_951242.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.2
154gb|AY639765.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 42 2.2
155gb|AY639764.1| Aegilops tauschii cultivar KU2156 FtsH-like prote... 42 2.2
156gb|AY639763.1| Triticum urartu cultivar IG45487 FtsH-like protei... 42 2.2
157gb|AY639762.1| Hordeum vulgare subsp. spontaneum cultivar PI 220... 42 2.2
158gb|AY639761.1| Aegilops tauschii cultivar KU2160 FtsH-like prote... 42 2.2
159gb|AY639760.1| Aegilops tauschii cultivar KU2065 FtsH-like prote... 42 2.2
160gb|AY639759.1| Triticum monococcum cultivar G4913 FtsH-like prot... 42 2.2
161gb|AY639756.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
162gb|AY639755.1| Triticum urartu cultivar IG45633 FtsH-like protei... 42 2.2
163gb|AY639754.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 42 2.2
164gb|AY639751.1| Hordeum vulgare subsp. spontaneum cultivar PI 227... 42 2.2
165gb|AY639750.1| Aegilops tauschii cultivar KU2801 FtsH-like prote... 42 2.2
166gb|AY639749.1| Triticum urartu cultivar IG113243 FtsH-like prote... 42 2.2
167gb|AY639748.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
168gb|AY639747.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
169gb|AY639746.1| Hordeum vulgare subsp. spontaneum cultivar PI 420... 42 2.2
170gb|AY639745.1| Hordeum vulgare subsp. spontaneum cultivar PI 254... 42 2.2
171gb|AY639744.1| Aegilops tauschii cultivar KU2146 FtsH-like prote... 42 2.2
172gb|AY639743.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
173gb|AY639742.1| Hordeum vulgare subsp. spontaneum cultivar PI 282... 42 2.2
174gb|AY639741.1| Triticum urartu cultivar IG45470 FtsH-like protei... 42 2.2
175gb|AY639740.1| Hordeum vulgare subsp. spontaneum cultivar PI 420... 42 2.2
176gb|AY639739.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
177gb|AY639738.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
178gb|AY639737.1| Triticum urartu cultivar IG45218 FtsH-like protei... 42 2.2
179gb|AY639735.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
180gb|AY639734.1| Aegilops tauschii cultivar KU2030 FtsH-like prote... 42 2.2
181gb|AY639733.1| Lophopyrum elongatum FtsH-like protein gene, part... 42 2.2
182gb|AY639732.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.2
183ref|XM_751952.1| Ustilago maydis 521 hypothetical protein (UM008... 42 2.2
184ref|XM_500490.1| Yarrowia lipolytica CLIB122, YALI0B04334g predi... 42 2.2
185ref|XM_506087.1| Yarrowia lipolytica CLIB122, YALI0F31251g predi... 42 2.2
186gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 42 2.2
187dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 42 2.2
188dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 42 2.2
189dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
190dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 42 2.2
191emb|BX842599.1| Neurospora crassa DNA linkage group II BAC clone... 42 2.2
192gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 42 2.2
193dbj|AK068710.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
194gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 42 2.2
195gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
196emb|AL954157.3|CNS08CCV Oryza sativa chromosome 12, . BAC OSJNBa... 42 2.2
197emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa... 42 2.2
198emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 42 2.2
199emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 42 2.2
200ref|NM_115254.3| Arabidopsis thaliana binding / transporter AT3G... 40 8.6
201gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome 40 8.6
202ref|XM_511168.1| PREDICTED: Pan troglodytes similar to paraplegi... 40 8.6
203gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome 40 8.6
204gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 40 8.6
205gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 8.6
206gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 40 8.6
207gb|BC007692.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 8.6
208gb|BC071538.1| Danio rerio proteasome (prosome, macropain) 26S s... 40 8.6
209gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 8.6
210ref|XM_610479.2| PREDICTED: Bos taurus similar to neuron navigat... 40 8.6
211ref|XM_419244.1| PREDICTED: Gallus gallus similar to steerin1 pr... 40 8.6
212ref|NM_003119.2| Homo sapiens spastic paraplegia 7, paraplegin (... 40 8.6
213ref|NM_199367.1| Homo sapiens spastic paraplegia 7, paraplegin (... 40 8.6
214gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, compl... 40 8.6
215gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 40 8.6
216gb|BT011963.1| Arabidopsis thaliana At3g53940 mRNA sequence 40 8.6
217gb|AC092123.4| Homo sapiens chromosome 16 clone RP11-104N10, com... 40 8.6
218ref|XM_842897.1| Leishmania major strain Friedlin ATPase (LMJ_02... 40 8.6
219ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26... 40 8.6
220ref|XM_385706.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 8.6
221emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete ch... 40 8.6
222gb|BC035929.2| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 8.6
223ref|XM_499951.1| Yarrowia lipolytica CLIB122, YALI0A10615g predi... 40 8.6
224ref|XM_500430.1| Yarrowia lipolytica CLIB122, YALI0B02574g predi... 40 8.6
225gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 8.6
226gb|AC010538.9| Homo sapiens chromosome 16 clone RP11-368I7, comp... 40 8.6
227gb|AF259761.1| Ovis aries microsatellite MNS-89 sequence 40 8.6
228emb|Y16610.1|HSPARAPLE Homo sapiens mRNA for paraplegin 40 8.6
229gb|AE008912.1| Salmonella typhimurium LT2, section 216 of 220 of... 40 8.6
230emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment ... 40 8.6
231gb|BC036104.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 8.6
232emb|AL627284.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 8.6
233emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BA... 40 8.6
234ref|NM_001002091.1| Danio rerio proteasome (prosome, macropain) ... 40 8.6
235gb|AC114900.26| Ustilago hordei strain 4875-4 clone uhobac-2b7, ... 40 8.6
236emb|CR609511.1| full-length cDNA clone CS0DL005YD01 of B cells (... 40 8.6
237gb|AF236051.1| California sea lion herpesvirus terminase gene, p... 40 8.6
238gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 8.6
239gb|AY093262.1| Arabidopsis thaliana putative protein (F5K20.24) ... 40 8.6
240gb|AY062478.1| Arabidopsis thaliana putative protein (F5K20.24) ... 40 8.6
241gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 8.6
242gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 8.6
243gb|AF080518.1|HSSPGSC08 Homo sapiens paraplegin (SPG7) gene, exo... 40 8.6
244gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 8.6
245gb|AF193618.1|AF193618 California sea lion herpesvirus terminase... 40 8.6
246emb|BX822250.1|CNS0A70P Arabidopsis thaliana Full-length cDNA Co... 40 8.6
247emb|BX824565.1|CNS0A4VO Arabidopsis thaliana Full-length cDNA Co... 40 8.6
248gb|AE004548.1| Pseudomonas aeruginosa PAO1, section 109 of 529 o... 40 8.6
249ref|XM_345541.2| PREDICTED: Rattus norvegicus similar to Ubiquit... 40 8.6
250dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 40 8.6
251ref|NM_210204.1| Eremothecium gossypii AEL011Wp (AEL011W), mRNA 40 8.6
252ref|NM_210381.1| Eremothecium gossypii AER169Cp (AER169C), mRNA 40 8.6
253emb|AL935145.12| Zebrafish DNA sequence from clone CH211-173B9 i... 40 8.6
254gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 8.6
255emb|AM118080.1| Ustilago hordei mating type region MAT-1, strain... 40 8.6
256gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 8.6
257gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 8.6
258gb|AY627304.1| Haloferax volcanii DS2 proteasome-activating nucl... 40 8.6
259gb|BC110530.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 8.6
260gb|BC110531.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 8.6
261dbj|AB023310.1| Cyanidioschyzon merolae gene for FtsH2, complete... 40 8.6

>gb|BT009457.1| Triticum aestivum clone wlp1c.pk007.f6:fis, full insert mRNA
           sequence
          Length = 1556

 Score = 1128 bits (569), Expect = 0.0
 Identities = 611/625 (97%)
 Strand = Plus / Plus

                                                                       
Query: 6   cgaggtcttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggc 65
           |||| ||||||||||||| || || |||||||||||||||||||||||||||||||||||
Sbjct: 207 cgagctcttcgtcggcgtcggcgcgtccagggtgagggacctcttcgagaaggccaaggc 266

                                                                       
Query: 66  caaggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgc 125
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 267 caaggcgccctgcatcgtcttcatcgatgagattgacgccgtcgggaggcagcgtggtgc 326

                                                                       
Query: 126 gggaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagat 185
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 327 cggaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagat 386

                                                                       
Query: 186 ggacggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgt 245
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 387 ggacggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgt 446

                                                                       
Query: 246 gcttgactccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtcc 305
           ||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 447 gctcgactcggcgcttctgcggccagggcggtttgatcggcaggtcaccgtcgaccgtcc 506

                                                                       
Query: 306 ggatgtagccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaa 365
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 507 ggatgtcgccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaa 566

                                                                       
Query: 366 ggatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttca 425
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 567 ggatgtagactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttca 626

                                                                       
Query: 426 gaacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaa 485
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 627 gaacttgatgaatgaggctgccatccttgctgctcgtcgtgatctgaaggagataagcaa 686

                                                                       
Query: 486 ggacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagt 545
           ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 687 ggacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagt 746

                                                                       
Query: 546 tgtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcgg 605
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 747 tgtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcgg 806

                                    
Query: 606 tgccctgatgcctgaatatgaccct 630
           |||||||||||||||||||||||||
Sbjct: 807 tgccctgatgcctgaatatgaccct 831



to top

>dbj|AK065019.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001F19, full
            insert sequence
          Length = 2378

 Score =  607 bits (306), Expect = e-170
 Identities = 540/618 (87%)
 Strand = Plus / Plus

                                                                        
Query: 13   ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
            |||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 949  ttcgtcggtgtcggtgcctccagggtcagggacctgttcgagaaggccaaggccaaggcc 1008

                                                                        
Query: 73   ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
            || |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | 
Sbjct: 1009 ccttgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctc 1068

                                                                        
Query: 133  ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
            || ||||| || |||||||||||||||||||||||||||||  | || |||||||| || 
Sbjct: 1069 ggagggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatgga 1128

                                                                        
Query: 193  ttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgac 252
            ||  |||| || ||||||||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 1129 tttgccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgac 1188

                                                                        
Query: 253  tccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgta 312
             | || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| 
Sbjct: 1189 gcggctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtc 1248

                                                                        
Query: 313  gccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaaggatgtg 372
            ||||| ||||||| ||| |||||||||||||| |||||||||||  |||| || ||||| 
Sbjct: 1249 gccgggcgtgtcaagattcttgaggttcactcgagaggaaaggctctggcaaaagatgtc 1308

                                                                        
Query: 373  gactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcagaacttg 432
            |||||||| ||  ||||| | || || ||||||||||| || ||||||||||| ||||||
Sbjct: 1309 gactttgagaaaattgcccggagaacccctggtttcactggagctgatcttcaaaacttg 1368

                                                                        
Query: 433  atgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaaggacgag 492
            |||||||||||||| || ||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 1369 atgaatgaggctgctattcttgctgctcgtcgtgatctgaaggagattagcaaggatgag 1428

                                                                        
Query: 493  atctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagttgtttca 552
            |||||||| ||| |||||||||||||||| |||||||||||||| ||||| |||||||||
Sbjct: 1429 atctctgatgctttggagaggatcattgctgggcctgagaagaaaaatgctgttgtttca 1488

                                                                        
Query: 553  gaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtgccctg 612
            ||| |||||||||  ||||||||||||||||||||||| |||||||| || |||||||| 
Sbjct: 1489 gaagagaagaggagacttgtggcttaccatgaggctggtcatgcccttgttggtgccctc 1548

                              
Query: 613  atgcctgaatatgaccct 630
            ||||||||||||||||||
Sbjct: 1549 atgcctgaatatgaccct 1566



to top

>dbj|AK061771.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C10, full
           insert sequence
          Length = 1325

 Score =  601 bits (303), Expect = e-168
 Identities = 540/618 (87%), Gaps = 2/618 (0%)
 Strand = Plus / Plus

                                                                       
Query: 13  ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
           |||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 7   ttcgtcggtgtcggtgcctccagggtcagggacctgttcgagaaggccaaggccaaggcc 66

                                                                       
Query: 73  ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
           || |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | 
Sbjct: 67  ccttgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctc 126

                                                                       
Query: 133 ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
           || ||||| || |||||||||||||||||||||||||||||  | || |||||||| || 
Sbjct: 127 ggagggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatgga 186

                                                                       
Query: 193 ttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgac 252
           ||  |||| || ||||||||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 187 tttgccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgac 246

                                                                       
Query: 253 tccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgta 312
            | || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| 
Sbjct: 247 gcggctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtc 306

                                                                       
Query: 313 gccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaaggatgtg 372
           ||||| ||||||| ||| |||||||||||||| |||||||||||  |||| || ||||| 
Sbjct: 307 gccgggcgtgtcaagattcttgaggttcactcgagaggaaaggc--tggcaaaagatgtc 364

                                                                       
Query: 373 gactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcagaacttg 432
           |||||||| ||  ||||| | || || ||||||||||| || ||||||||||| ||||||
Sbjct: 365 gactttgagaaaattgcccggagaacccctggtttcactggagctgatcttcaaaacttg 424

                                                                       
Query: 433 atgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaaggacgag 492
           |||||||||||||| || ||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 425 atgaatgaggctgctattcttgctgctcgtcgtgatctgaaggagattagcaaggatgag 484

                                                                       
Query: 493 atctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagttgtttca 552
           |||||||| ||| |||||||||||||||| |||||||||||||| ||||| |||||||||
Sbjct: 485 atctctgatgctttggagaggatcattgctgggcctgagaagaaaaatgctgttgtttca 544

                                                                       
Query: 553 gaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtgccctg 612
           ||| |||||||||  ||||||||||||||||||||||| |||||||| || |||||||| 
Sbjct: 545 gaagagaagaggagacttgtggcttaccatgaggctggtcatgcccttgttggtgccctc 604

                             
Query: 613 atgcctgaatatgaccct 630
           ||||||||||||||||||
Sbjct: 605 atgcctgaatatgaccct 622



to top

>gb|AY103957.1| Zea mays PCO116832 mRNA sequence
          Length = 1820

 Score =  525 bits (265), Expect = e-146
 Identities = 532/621 (85%)
 Strand = Plus / Plus

                                                                       
Query: 6   cgaggtcttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggc 65
           |||| |||||||||| || ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 294 cgagctcttcgtcggtgtcggtgcctccagggtgcgcgacctcttcgagaaggccaaggc 353

                                                                       
Query: 66  caaggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgc 125
           ||||||||||||||| |||||||| || |||||||| ||||| || |||||||| |||||
Sbjct: 354 caaggcgccctgcattgtcttcattgatgagattgatgccgttggaaggcagcgcggtgc 413

                                                                       
Query: 126 gggaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagat 185
            ||| | |||||||| || || ||||| ||||||||||||||||||||  | ||||||||
Sbjct: 414 cggacttggtgggggtaatgacgagagagagcagaccattaaccagctcttgacggagat 473

                                                                       
Query: 186 ggacggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgt 245
           ||| |||||| | || |||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 474 ggatggcttcgctggcaacagcggtgtcattgtgcttgccgccaccaacaggcccgatgt 533

                                                                       
Query: 246 gcttgactccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtcc 305
           ||| ||||||||||| || || |||||| | || ||| ||||||||||||| ||| | ||
Sbjct: 534 gctggactccgcgctcctacgaccagggagatttgataggcaggtcaccgttgacaggcc 593

                                                                       
Query: 306 ggatgtagccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaa 365
            ||||| ||||| || |||| ||| |||||||| |||||| |||||||||| ||||||||
Sbjct: 594 agatgttgccggacgcgtcaagattcttgaggtccactcccgaggaaaggctttggcgaa 653

                                                                       
Query: 366 ggatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttca 425
            ||||| || ||||||||  |||| |||||||| ||||||||||| |||||||| || ||
Sbjct: 654 agatgttgattttgataaaattgctagaaggacccctggtttcactggtgctgacctcca 713

                                                                       
Query: 426 gaacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaa 485
            ||| | ||||||||||||||||||||||| ||||| |||||||| ||||| || |||||
Sbjct: 714 aaacctcatgaatgaggctgccatccttgctgctcgccgtgatcttaaggaaattagcaa 773

                                                                       
Query: 486 ggacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagt 545
           ||| ||||||||||| ||||| ||||| |||||||| || ||||||||||| ||||| ||
Sbjct: 774 ggatgagatctctgatgctcttgagagaatcattgctggccctgagaagaaaaatgctgt 833

                                                                       
Query: 546 tgtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcgg 605
           |||||| ||  |||||| || ||| || ||||||||||||||||| |||||||| |||||
Sbjct: 834 tgtttccgaggagaagaagaggctcgtcgcttaccatgaggctggccatgcccttgtcgg 893

                                
Query: 606 tgccctgatgcctgaatatga 626
            ||||| ||||| || |||||
Sbjct: 894 cgccctcatgccagagtatga 914



to top

>gb|BT009148.1| Triticum aestivum clone wl1n.pk0059.g7:fis, full insert mRNA
           sequence
          Length = 890

 Score =  293 bits (148), Expect = 4e-76
 Identities = 157/160 (98%)
 Strand = Plus / Plus

                                                                       
Query: 471 gaaggagataagcaaggacgagatctctgacgctctggagaggatcattgccgggcctga 530
           |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 8   gaaggagataagcaaggacgagatctctgatgctctggagaggatcattgctgggcccga 67

                                                                       
Query: 531 gaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccatgaggctgg 590
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68  gaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccatgaggctgg 127

                                                   
Query: 591 acatgccctcgtcggtgccctgatgcctgaatatgaccct 630
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 128 acatgccctcgtcggtgccctgatgcctgaatatgaccct 167



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  289 bits (146), Expect = 6e-75
 Identities = 281/326 (86%)
 Strand = Plus / Minus

                                                                            
Query: 13       ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
                |||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 30361140 ttcgtcggtgtcggtgcctccagggtcagggacctgttcgagaaggccaaggccaaggcc 30361081

                                                                            
Query: 73       ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
                || |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | 
Sbjct: 30361080 ccttgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctc 30361021

                                                                            
Query: 133      ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
                || ||||| || |||||||||||||||||||||||||||||  | || |||||||| || 
Sbjct: 30361020 ggagggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatgga 30360961

                                                                            
Query: 193      ttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgac 252
                ||  |||| || ||||||||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 30360960 tttgccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgac 30360901

                                                                            
Query: 253      tccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgta 312
                 | || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| 
Sbjct: 30360900 gcggctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtc 30360841

                                          
Query: 313      gccggccgtgtcaggatccttgaggt 338
                ||||| ||||||| ||| ||||||||
Sbjct: 30360840 gccgggcgtgtcaagattcttgaggt 30360815



 Score =  264 bits (133), Expect = 3e-67
 Identities = 220/249 (88%)
 Strand = Plus / Minus

                                                                            
Query: 335      aggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggttgccagaa 394
                |||||||||| |||||||||||  |||| || ||||| |||||||| ||  ||||| | |
Sbjct: 30360113 aggttcactcgagaggaaaggctctggcaaaagatgtcgactttgagaaaattgcccgga 30360054

                                                                            
Query: 395      ggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttg 454
                | || ||||||||||| || ||||||||||| |||||||||||||||||||| || ||||
Sbjct: 30360053 gaacccctggtttcactggagctgatcttcaaaacttgatgaatgaggctgctattcttg 30359994

                                                                            
Query: 455      ccgctcgtcgtgatctgaaggagataagcaaggacgagatctctgacgctctggagagga 514
                | ||||||||||||||||||||||| |||||||| ||||||||||| ||| |||||||||
Sbjct: 30359993 ctgctcgtcgtgatctgaaggagattagcaaggatgagatctctgatgctttggagagga 30359934

                                                                            
Query: 515      tcattgccgggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtgg 574
                ||||||| |||||||||||||| ||||| |||||||||||| |||||||||  |||||||
Sbjct: 30359933 tcattgctgggcctgagaagaaaaatgctgttgtttcagaagagaagaggagacttgtgg 30359874

                         
Query: 575      cttaccatg 583
                |||||||||
Sbjct: 30359873 cttaccatg 30359865



 Score =  125 bits (63), Expect = 2e-25
 Identities = 150/179 (83%)
 Strand = Plus / Minus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               ||||||||||| || || ||  ||||| | ||||| ||||| | ||||||||| |  |||
Sbjct: 6714369 ttcgtcggcgtcggcgcgtcgcgggtgcgcgacctgttcgacagggccaaggcgagcgcg 6714310

                                                                           
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
               || ||| ||||||||||||||||||| |||||||| ||| ||||||| || ||||| || 
Sbjct: 6714309 ccgtgcctcgtcttcatcgacgagatcgacgccgtggggcggcagcgcggcgcggggatc 6714250

                                                                          
Query: 133     ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
               || || |||||||| ||||||||||||||  | |||||||||||||| |||||||||||
Sbjct: 6714249 ggcggcgggaacgacgagagggagcagacgctgaaccagctgctcaccgagatggacgg 6714191



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                                
Query: 583      gaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccct 630
                |||||||| |||||||| || |||||||| ||||||||||||||||||
Sbjct: 30359771 gaggctggtcatgcccttgttggtgccctcatgcctgaatatgaccct 30359724



to top

>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0548E04
          Length = 138037

 Score =  289 bits (146), Expect = 6e-75
 Identities = 281/326 (86%)
 Strand = Plus / Minus

                                                                          
Query: 13     ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
              |||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 107735 ttcgtcggtgtcggtgcctccagggtcagggacctgttcgagaaggccaaggccaaggcc 107676

                                                                          
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
              || |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | 
Sbjct: 107675 ccttgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctc 107616

                                                                          
Query: 133    ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
              || ||||| || |||||||||||||||||||||||||||||  | || |||||||| || 
Sbjct: 107615 ggagggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatgga 107556

                                                                          
Query: 193    ttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgac 252
              ||  |||| || ||||||||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 107555 tttgccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgac 107496

                                                                          
Query: 253    tccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgta 312
               | || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| 
Sbjct: 107495 gcggctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtc 107436

                                        
Query: 313    gccggccgtgtcaggatccttgaggt 338
              ||||| ||||||| ||| ||||||||
Sbjct: 107435 gccgggcgtgtcaagattcttgaggt 107410



 Score =  264 bits (133), Expect = 3e-67
 Identities = 220/249 (88%)
 Strand = Plus / Minus

                                                                          
Query: 335    aggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggttgccagaa 394
              |||||||||| |||||||||||  |||| || ||||| |||||||| ||  ||||| | |
Sbjct: 106708 aggttcactcgagaggaaaggctctggcaaaagatgtcgactttgagaaaattgcccgga 106649

                                                                          
Query: 395    ggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttg 454
              | || ||||||||||| || ||||||||||| |||||||||||||||||||| || ||||
Sbjct: 106648 gaacccctggtttcactggagctgatcttcaaaacttgatgaatgaggctgctattcttg 106589

                                                                          
Query: 455    ccgctcgtcgtgatctgaaggagataagcaaggacgagatctctgacgctctggagagga 514
              | ||||||||||||||||||||||| |||||||| ||||||||||| ||| |||||||||
Sbjct: 106588 ctgctcgtcgtgatctgaaggagattagcaaggatgagatctctgatgctttggagagga 106529

                                                                          
Query: 515    tcattgccgggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtgg 574
              ||||||| |||||||||||||| ||||| |||||||||||| |||||||||  |||||||
Sbjct: 106528 tcattgctgggcctgagaagaaaaatgctgttgtttcagaagagaagaggagacttgtgg 106469

                       
Query: 575    cttaccatg 583
              |||||||||
Sbjct: 106468 cttaccatg 106460



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                              
Query: 583    gaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccct 630
              |||||||| |||||||| || |||||||| ||||||||||||||||||
Sbjct: 106366 gaggctggtcatgcccttgttggtgccctcatgcctgaatatgaccct 106319



to top

>ref|NM_103909.3| Arabidopsis thaliana FTSH1; ATP-dependent peptidase/ ATPase/
            metallopeptidase AT1G50250 (FTSH1) mRNA, complete cds
          Length = 2473

 Score =  206 bits (104), Expect = 6e-50
 Identities = 221/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 367  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1490 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1549

                                                                        
Query: 427  aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
            ||| |||||||||| || || || ||||| ||| | ||||| || ||||| |||||||||
Sbjct: 1550 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1609

                                                                        
Query: 487  gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
            || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 1610 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1669

                                                                        
Query: 547  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 606
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1670 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1729

                                
Query: 607  gccctgatgcctgaatatga 626
            || || ||||| ||||||||
Sbjct: 1730 gctcttatgccagaatatga 1749



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 110/140 (78%)
 Strand = Plus / Plus

                                                                        
Query: 49   ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
            ||||||||||| ||| | || || || || || || ||||| || ||||||||||| || 
Sbjct: 1172 ttcgagaaggctaagtctaaagccccttgtattgtattcattgatgagattgacgctgtg 1231

                                                                        
Query: 109  gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
            || |||||| | || || || ||||| || || || |||||||| || ||||| ||||| 
Sbjct: 1232 ggtaggcagagaggagctgggatgggaggaggaaatgatgagagagaacagactattaat 1291

                                
Query: 169  cagctgctcacggagatgga 188
            |||||| | || ||||||||
Sbjct: 1292 cagctgttgacagagatgga 1311



to top

>gb|AY123034.1| Arabidopsis thaliana putative chloroplast FtsH protease (At1g50250)
            mRNA, complete cds
          Length = 2182

 Score =  206 bits (104), Expect = 6e-50
 Identities = 221/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 367  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1357 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1416

                                                                        
Query: 427  aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
            ||| |||||||||| || || || ||||| ||| | ||||| || ||||| |||||||||
Sbjct: 1417 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1476

                                                                        
Query: 487  gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
            || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 1477 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1536

                                                                        
Query: 547  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 606
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1537 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1596

                                
Query: 607  gccctgatgcctgaatatga 626
            || || ||||| ||||||||
Sbjct: 1597 gctcttatgccagaatatga 1616



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 110/140 (78%)
 Strand = Plus / Plus

                                                                        
Query: 49   ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
            ||||||||||| ||| | || || || || || || ||||| || ||||||||||| || 
Sbjct: 1039 ttcgagaaggctaagtctaaagccccttgtattgtattcattgatgagattgacgctgtg 1098

                                                                        
Query: 109  gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
            || |||||| | || || || ||||| || || || |||||||| || ||||| ||||| 
Sbjct: 1099 ggtaggcagagaggagctgggatgggaggaggaaatgatgagagagaacagactattaat 1158

                                
Query: 169  cagctgctcacggagatgga 188
            |||||| | || ||||||||
Sbjct: 1159 cagctgttgacagagatgga 1178



to top

>gb|AY091095.1| Arabidopsis thaliana putative chloroplast FtsH protease (At1g50250)
            mRNA, complete cds
          Length = 2452

 Score =  206 bits (104), Expect = 6e-50
 Identities = 221/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 367  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1453 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1512

                                                                        
Query: 427  aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
            ||| |||||||||| || || || ||||| ||| | ||||| || ||||| |||||||||
Sbjct: 1513 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1572

                                                                        
Query: 487  gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
            || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 1573 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1632

                                                                        
Query: 547  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 606
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1633 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1692

                                
Query: 607  gccctgatgcctgaatatga 626
            || || ||||| ||||||||
Sbjct: 1693 gctcttatgccagaatatga 1712



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 110/140 (78%)
 Strand = Plus / Plus

                                                                        
Query: 49   ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
            ||||||||||| ||| | || || || || || || ||||| || ||||||||||| || 
Sbjct: 1135 ttcgagaaggctaagtctaaagccccttgtattgtattcattgatgagattgacgctgtg 1194

                                                                        
Query: 109  gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
            || |||||| | || || || ||||| || || || |||||||| || ||||| ||||| 
Sbjct: 1195 ggtaggcagagaggagctgggatgggaggaggaaatgatgagagagaacagactattaat 1254

                                
Query: 169  cagctgctcacggagatgga 188
            |||||| | || ||||||||
Sbjct: 1255 cagctgttgacagagatgga 1274



to top

>emb|X99808.1|ATFTSH A.thaliana mRNA for chloroplast FtsH protease
          Length = 2447

 Score =  198 bits (100), Expect = 2e-47
 Identities = 220/260 (84%)
 Strand = Plus / Plus

                                                                        
Query: 367  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1488 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1547

                                                                        
Query: 427  aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
            ||| |||||||||| || || || ||||| ||| | |||||  | ||||| |||||||||
Sbjct: 1548 aacctgatgaatgaagcggcgattcttgcggctaggcgtgacgttaaggaaataagcaag 1607

                                                                        
Query: 487  gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
            || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 1608 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1667

                                                                        
Query: 547  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 606
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1668 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1727

                                
Query: 607  gccctgatgcctgaatatga 626
            || || ||||| ||||||||
Sbjct: 1728 gctcttatgccagaatatga 1747



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 110/140 (78%)
 Strand = Plus / Plus

                                                                        
Query: 49   ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
            ||||||||||| ||| | || || || || || || ||||| || ||||||||||| || 
Sbjct: 1170 ttcgagaaggctaagtctaaagccccttgtattgtattcattgatgagattgacgctgtg 1229

                                                                        
Query: 109  gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
            || |||||| | || || || ||||| || || || |||||||| || ||||| ||||| 
Sbjct: 1230 ggtaggcagagaggagctgggatgggaggaggaaatgatgagagagaacagactattaat 1289

                                
Query: 169  cagctgctcacggagatgga 188
            |||||| | || ||||||||
Sbjct: 1290 cagctgttgacagagatgga 1309



to top

>emb|BX815046.1|CNS0AE0R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS28ZC04 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2428

 Score =  198 bits (100), Expect = 2e-47
 Identities = 220/260 (84%)
 Strand = Plus / Plus

                                                                        
Query: 367  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1489 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1548

                                                                        
Query: 427  aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
            ||| |||||||||| || || || ||||| ||| | ||||| || ||||| |||||||||
Sbjct: 1549 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1608

                                                                        
Query: 487  gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
            || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 1609 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1668

                                                                        
Query: 547  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 606
            || || ||| |||||| ||  ||||| ||  ||||||||||||| ||||| || || |||
Sbjct: 1669 gtctctgaagagaagaagagacttgttgcacaccatgaggctggtcatgctctagtgggt 1728

                                
Query: 607  gccctgatgcctgaatatga 626
            || || ||||| ||||||||
Sbjct: 1729 gctcttatgccagaatatga 1748



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 110/140 (78%)
 Strand = Plus / Plus

                                                                        
Query: 49   ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
            ||||||||||| ||| | || || || || || || ||||| || ||||||||||| || 
Sbjct: 1171 ttcgagaaggctaagtctaaagccccttgtattgtattcattgatgagattgacgctgtg 1230

                                                                        
Query: 109  gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
            || |||||| | || || || ||||| || || || |||||||| || ||||| ||||| 
Sbjct: 1231 ggtaggcagagaggagctgggatgggaggaggaaatgatgagagagaacagactattaat 1290

                                
Query: 169  cagctgctcacggagatgga 188
            |||||| | || ||||||||
Sbjct: 1291 cagctgttgacagagatgga 1310



to top

>emb|Y12780.1|ATAAAA A.thaliana mRNA for ATPase, partial
          Length = 2190

 Score =  186 bits (94), Expect = 6e-44
 Identities = 196/230 (85%)
 Strand = Plus / Plus

                                                                        
Query: 367  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
            |||||||||||||| ||||||||||||||| | ||||||||||| ||||||||  | || 
Sbjct: 1153 gatgtggactttgacaaggttgccagaaggtcccctggtttcacgggtgctgacttacaa 1212

                                                                        
Query: 427  aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
            ||| |||||||||| || || || ||||| ||| | ||||| || ||||| |||||||||
Sbjct: 1213 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1272

                                                                        
Query: 487  gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
            || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 1273 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1332

                                                              
Query: 547  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgc 596
            || || ||| |||||| ||  ||||| || |||||||||||||| |||||
Sbjct: 1333 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgc 1382



to top

>gb|DQ339462.1| Vitis pseudoreticulata ATPase mRNA, complete cds
          Length = 600

 Score =  182 bits (92), Expect = 9e-43
 Identities = 251/304 (82%)
 Strand = Plus / Plus

                                                                       
Query: 327 gatccttgaggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggt 386
           ||||||| |||| ||||| ||||| |||||| | || |||||||| |||||||| ||| |
Sbjct: 144 gatccttcaggtgcactcaagagggaaggcactagccaaggatgtagactttgaaaagat 203

                                                                       
Query: 387 tgccagaaggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgc 446
           ||| |||||||| || || ||||| || |||||  | |||||| ||||||||||||| ||
Sbjct: 204 tgcgagaaggaccccaggcttcacaggggctgacttgcagaacctgatgaatgaggcagc 263

                                                                       
Query: 447 catccttgccgctcgtcgtgatctgaaggagataagcaaggacgagatctctgacgctct 506
           |||||| || ||| | ||||| || ||||||||||||||||| ||||| ||||| || ||
Sbjct: 264 catcctcgcagctaggcgtgacctcaaggagataagcaaggatgagatatctgatgccct 323

                                                                       
Query: 507 ggagaggatcattgccgggcctgagaagaagaatgcagttgtttcagaacagaagaggaa 566
           ||||||||| ||||| ||||| |||||||| ||||| || || |||||  |||||| |||
Sbjct: 324 ggagaggataattgctgggccagagaagaaaaatgctgtggtctcagacgagaagaagaa 383

                                                                       
Query: 567 gcttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatga 626
             | || || || ||||||||||| |||||  | |||||||| || ||||||||||||||
Sbjct: 384 attagttgcctatcatgaggctgggcatgcattggtcggtgcacttatgcctgaatatga 443

               
Query: 627 ccct 630
           ||||
Sbjct: 444 ccct 447



to top

>gb|AC007980.1| Arabidopsis thaliana chromosome I BAC F14I3 genomic sequence, complete
             sequence
          Length = 100975

 Score =  176 bits (89), Expect = 6e-41
 Identities = 185/217 (85%)
 Strand = Plus / Plus

                                                                         
Query: 367   gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 426
             |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 61377 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 61436

                                                                         
Query: 427   aacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagcaag 486
             ||| |||||||||| || || || ||||| ||| | ||||| || ||||| |||||||||
Sbjct: 61437 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 61496

                                                                         
Query: 487   gacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgcagtt 546
             || || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||
Sbjct: 61497 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 61556

                                                  
Query: 547   gtttcagaacagaagaggaagcttgtggcttaccatg 583
             || || ||| |||||| ||  ||||| || |||||||
Sbjct: 61557 gtctctgaagagaagaagagacttgttgcataccatg 61593



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 110/140 (78%)
 Strand = Plus / Plus

                                                                         
Query: 49    ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
             ||||||||||| ||| | || || || || || || ||||| || ||||||||||| || 
Sbjct: 60963 ttcgagaaggctaagtctaaagccccttgtattgtattcattgatgagattgacgctgtg 61022

                                                                         
Query: 109   gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
             || |||||| | || || || ||||| || || || |||||||| || ||||| ||||| 
Sbjct: 61023 ggtaggcagagaggagctgggatgggaggaggaaatgatgagagagaacagactattaat 61082

                                 
Query: 169   cagctgctcacggagatgga 188
             |||||| | || ||||||||
Sbjct: 61083 cagctgttgacagagatgga 61102



to top

>emb|X90472.1|CAATPASE C.annuum mRNA for ATPase protein
          Length = 1989

 Score =  168 bits (85), Expect = 1e-38
 Identities = 250/305 (81%)
 Strand = Plus / Plus

                                                                        
Query: 322  gtcaggatccttgaggttcactccagaggaaaggcattggcgaaggatgtggactttgat 381
            |||||||| ||| |||| || || |||||||||||  | || ||||||||||||||||||
Sbjct: 1218 gtcaggattcttcaggtacattctagaggaaaggcccttgcaaaggatgtggactttgat 1277

                                                                        
Query: 382  aaggttgccagaaggacacctggtttcaccggtgctgatcttcagaacttgatgaatgag 441
            ||| ||||||| || || || |||||||| ||||| ||| | || ||||||||||| || 
Sbjct: 1278 aagattgccaggagaactccaggtttcactggtgcagatttacaaaacttgatgaacgaa 1337

                                                                        
Query: 442  gctgccatccttgccgctcgtcgtgatctgaaggagataagcaaggacgagatctctgac 501
            || ||||||||||| ||| | ||||| || ||||| ||||| || || ||||| ||||| 
Sbjct: 1338 gcagccatccttgcagctaggcgtgacctaaaggaaataagtaaagatgagatatctgat 1397

                                                                        
Query: 502  gctctggagaggatcattgccgggcctgagaagaagaatgcagttgtttcagaacagaag 561
            |||||||||||||| ||||| || || |||||||| || || ||||| |||||  |||||
Sbjct: 1398 gctctggagaggataattgctggtccggagaagaaaaacgctgttgtctcagatgagaag 1457

                                                                        
Query: 562  aggaagcttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaa 621
            | |||||| || ||||| ||||||||||| |||||| | || ||||| || ||||| || 
Sbjct: 1458 aagaagctggtagcttatcatgaggctggccatgccttggttggtgcacttatgcccgag 1517

                 
Query: 622  tatga 626
            |||||
Sbjct: 1518 tatga 1522



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                        
Query: 70   gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
            ||||| ||||| || || ||||| |||||||| || || || |||||| | ||||| |||
Sbjct: 966  gcgccttgcattgtgtttatcgatgagattgatgctgtaggaaggcagagaggtgcagga 1025

                                                        
Query: 130  atgggtggggggaacgatgagagggagcagaccattaaccagct 173
             | || || || || ||||||||||||||||| ||||| |||||
Sbjct: 1026 cttggaggtggaaatgatgagagggagcagactattaatcagct 1069



to top

>dbj|AB017480.2| Nicotiana tabacum mRNA for chloroplast FtsH protease, complete cds
          Length = 2447

 Score =  149 bits (75), Expect = 1e-32
 Identities = 216/263 (82%)
 Strand = Plus / Plus

                                                                        
Query: 364  aaggatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatctt 423
            ||||||||||||||||| ||| ||||||| || ||||| |||| ||| ||||| ||| | 
Sbjct: 1348 aaggatgtggactttgagaagattgccaggagaacaccgggttacactggtgcagatttg 1407

                                                                        
Query: 424  cagaacttgatgaatgaggctgccatccttgccgctcgtcgtgatctgaaggagataagc 483
            || ||||||||||| || || || |||||||| ||| | ||||| || ||||| ||||| 
Sbjct: 1408 caaaacttgatgaacgaagcagcaatccttgcagctaggcgtgaactaaaggaaataagt 1467

                                                                        
Query: 484  aaggacgagatctctgacgctctggagaggatcattgccgggcctgagaagaagaatgca 543
            || || ||||| ||||| |||||||||||||| |||||||| || |||||||| ||||| 
Sbjct: 1468 aaagatgagatatctgatgctctggagaggataattgccggcccagagaagaaaaatgct 1527

                                                                        
Query: 544  gttgtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtc 603
            ||||| |||||  |||||| |||||| || ||||| |||||||| || |||||| | || 
Sbjct: 1528 gttgtctcagatgagaagaagaagctggtagcttatcatgaggccggccatgccttggtt 1587

                                   
Query: 604  ggtgccctgatgcctgaatatga 626
            ||||| || ||||| || |||||
Sbjct: 1588 ggtgcacttatgcccgagtatga 1610



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                        
Query: 49   ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
            ||||||||||| ||| | || ||||| ||||| || || || || |||||||| || || 
Sbjct: 1033 ttcgagaaggcgaagtcgaaagcgccttgcattgtgtttattgatgagattgatgctgtg 1092

                                                                       
Query: 109  gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaa 167
            ||||||||| | ||||| |||||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1093 gggaggcagagaggtgcaggaatgggaggtgggaatgatgagagagagcagactattaa 1151



to top

>ref|NM_123592.2| Arabidopsis thaliana VAR1 (VARIEGATED 1); ATP-dependent peptidase/
            ATPase/ metallopeptidase AT5G42270 (VAR1) mRNA, complete
            cds
          Length = 3058

 Score =  131 bits (66), Expect = 3e-27
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                        
Query: 403  ggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgctcgt 462
            |||||||| ||||||||| | |||||| |||||||||| ||||| || ||||| ||| | 
Sbjct: 1530 ggtttcactggtgctgatttgcagaacctgatgaatgaagctgcgattcttgctgctaga 1589

                                                                        
Query: 463  cgtgatctgaaggagataagcaaggacgagatctctgacgctctggagaggatcattgcc 522
            ||||| || ||||||||||||||||| || || ||||| ||||| |||||||||||||| 
Sbjct: 1590 cgtgagcttaaggagataagcaaggatgaaatatctgatgctcttgagaggatcattgct 1649

                                                                        
Query: 523  gggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccat 582
            || ||||| |||||||| || ||||| || ||  ||||||  |  ||||| |||||||||
Sbjct: 1650 ggacctgaaaagaagaacgctgttgtctctgaggagaagaaaagacttgttgcttaccat 1709

                          
Query: 583  gaggctggacatgc 596
            |||||||| |||||
Sbjct: 1710 gaggctgggcatgc 1723



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 102/129 (79%)
 Strand = Plus / Plus

                                                                        
Query: 130  atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
            |||||||| || || ||||||||||| ||||| ||||| |||||  | || |||||||| 
Sbjct: 1257 atgggtggtggaaatgatgagagggaacagactattaatcagcttttgactgagatggat 1316

                                                                        
Query: 190  ggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgctt 249
            || || || || |||   |||||||| ||| | || || || || || |||||||| |||
Sbjct: 1317 gggttttctggtaactctggtgtcattgtgttggctgccactaatagaccggatgttctt 1376

                     
Query: 250  gactccgcg 258
            |||||||||
Sbjct: 1377 gactccgcg 1385



to top

>gb|AY126987.1| Arabidopsis thaliana AT5g42270/K5J14_7 mRNA, complete cds
          Length = 2311

 Score =  131 bits (66), Expect = 3e-27
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                        
Query: 403  ggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgctcgt 462
            |||||||| ||||||||| | |||||| |||||||||| ||||| || ||||| ||| | 
Sbjct: 1456 ggtttcactggtgctgatttgcagaacctgatgaatgaagctgcgattcttgctgctaga 1515

                                                                        
Query: 463  cgtgatctgaaggagataagcaaggacgagatctctgacgctctggagaggatcattgcc 522
            ||||| || ||||||||||||||||| || || ||||| ||||| |||||||||||||| 
Sbjct: 1516 cgtgagcttaaggagataagcaaggatgaaatatctgatgctcttgagaggatcattgct 1575

                                                                        
Query: 523  gggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccat 582
            || ||||| |||||||| || ||||| || ||  ||||||  |  ||||| |||||||||
Sbjct: 1576 ggacctgaaaagaagaacgctgttgtctctgaggagaagaaaagacttgttgcttaccat 1635

                          
Query: 583  gaggctggacatgc 596
            |||||||| |||||
Sbjct: 1636 gaggctgggcatgc 1649



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 102/129 (79%)
 Strand = Plus / Plus

                                                                        
Query: 130  atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
            |||||||| || || ||||||||||| ||||| ||||| |||||  | || |||||||| 
Sbjct: 1183 atgggtggtggaaatgatgagagggaacagactattaatcagcttttgactgagatggat 1242

                                                                        
Query: 190  ggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgctt 249
            || || || || |||   |||||||| ||| | || || || || || |||||||| |||
Sbjct: 1243 gggttttctggtaactctggtgtcattgtgttggctgccactaatagaccggatgttctt 1302

                     
Query: 250  gactccgcg 258
            |||||||||
Sbjct: 1303 gactccgcg 1311



to top

>dbj|AP003569.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0425F05
          Length = 162858

 Score =  125 bits (63), Expect = 2e-25
 Identities = 150/179 (83%)
 Strand = Plus / Minus

                                                                          
Query: 13     ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
              ||||||||||| || || ||  ||||| | ||||| ||||| | ||||||||| |  |||
Sbjct: 148495 ttcgtcggcgtcggcgcgtcgcgggtgcgcgacctgttcgacagggccaaggcgagcgcg 148436

                                                                          
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
              || ||| ||||||||||||||||||| |||||||| ||| ||||||| || ||||| || 
Sbjct: 148435 ccgtgcctcgtcttcatcgacgagatcgacgccgtggggcggcagcgcggcgcggggatc 148376

                                                                         
Query: 133    ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
              || || |||||||| ||||||||||||||  | |||||||||||||| |||||||||||
Sbjct: 148375 ggcggcgggaacgacgagagggagcagacgctgaaccagctgctcaccgagatggacgg 148317



to top

>dbj|AP003509.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0525F01
          Length = 151668

 Score =  125 bits (63), Expect = 2e-25
 Identities = 150/179 (83%)
 Strand = Plus / Minus

                                                                         
Query: 13    ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
             ||||||||||| || || ||  ||||| | ||||| ||||| | ||||||||| |  |||
Sbjct: 44048 ttcgtcggcgtcggcgcgtcgcgggtgcgcgacctgttcgacagggccaaggcgagcgcg 43989

                                                                         
Query: 73    ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
             || ||| ||||||||||||||||||| |||||||| ||| ||||||| || ||||| || 
Sbjct: 43988 ccgtgcctcgtcttcatcgacgagatcgacgccgtggggcggcagcgcggcgcggggatc 43929

                                                                        
Query: 133   ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
             || || |||||||| ||||||||||||||  | |||||||||||||| |||||||||||
Sbjct: 43928 ggcggcgggaacgacgagagggagcagacgctgaaccagctgctcaccgagatggacgg 43870



to top

>dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14
          Length = 59762

 Score =  115 bits (58), Expect = 2e-22
 Identities = 124/146 (84%)
 Strand = Plus / Plus

                                                                         
Query: 403   ggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgctcgt 462
             |||||||| ||||||||| | |||||| |||||||||| ||||| || ||||| ||| | 
Sbjct: 42638 ggtttcactggtgctgatttgcagaacctgatgaatgaagctgcgattcttgctgctaga 42697

                                                                         
Query: 463   cgtgatctgaaggagataagcaaggacgagatctctgacgctctggagaggatcattgcc 522
             ||||| || ||||||||||||||||| || || ||||| ||||| |||||||||||||| 
Sbjct: 42698 cgtgagcttaaggagataagcaaggatgaaatatctgatgctcttgagaggatcattgct 42757

                                       
Query: 523   gggcctgagaagaagaatgcagttgt 548
             || ||||| |||||||| || |||||
Sbjct: 42758 ggacctgaaaagaagaacgctgttgt 42783



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 102/129 (79%)
 Strand = Plus / Plus

                                                                         
Query: 130   atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
             |||||||| || || ||||||||||| ||||| ||||| |||||  | || |||||||| 
Sbjct: 42286 atgggtggtggaaatgatgagagggaacagactattaatcagcttttgactgagatggat 42345

                                                                         
Query: 190   ggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgctt 249
             || || || || |||   |||||||| ||| | || || || || || |||||||| |||
Sbjct: 42346 gggttttctggtaactctggtgtcattgtgttggctgccactaatagaccggatgttctt 42405

                      
Query: 250   gactccgcg 258
             |||||||||
Sbjct: 42406 gactccgcg 42414



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 16   gtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcgccc 75
            ||||| |||||||||||  | ||  |||| |||||| ||||||||||||  || ||||||
Sbjct: 4562 gtcggggtgggtgcctctcgcgtacgggatctcttcaagaaggccaaggagaatgcgccc 4503

                                                                        
Query: 76   tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 135
            ||||||||||||||||||||||||||||| || ||  ||||||| || || || || || 
Sbjct: 4502 tgcatcgtcttcatcgacgagattgacgcggtgggccggcagcggggggccggcattggc 4443

                                                                       
Query: 136  ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggctt 194
            || || ||||| ||  | ||||| ||| | |||||| ||||||||||||||||||||||
Sbjct: 4442 ggtggcaacgacgaacgcgagcaaaccctgaaccagttgctcacggagatggacggctt 4384



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                          
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
              |||||||||||||||||||| || ||||| || |||||  | ||||| || || ||  ||
Sbjct: 640775 ccctgcatcgtcttcatcgatgaaattgatgcagtcggtcgccagcggggagctggcttg 640834

                                                                         
Query: 133    ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
              || || || ||||| ||  ||||||||||| | |||||| ||||||| |||||||||||
Sbjct: 640835 ggaggtggcaacgacgaacgggagcagaccctgaaccagttgctcaccgagatggacgg 640893



to top

>emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segment 4/7
          Length = 345997

 Score =  105 bits (53), Expect = 2e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                          
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 135
              |||||||| |||||||| |||||||||||||||||  | ||||| ||||| ||||| |||
Sbjct: 154625 tgcatcgtgttcatcgatgagattgacgccgtcggtcgtcagcgcggtgccggaatcggt 154684

                                                                   
Query: 136    ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 188
              || ||||| || ||| ||||||||||| | ||||||||||||||||| |||||
Sbjct: 154685 ggagggaatgacgagcgggagcagaccctgaaccagctgctcacggaaatgga 154737



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 144/176 (81%)
 Strand = Plus / Minus

                                                                        
Query: 13   ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
            |||||||||||||| |||||  ||||| |||| |||||  ||||||||||||  || || 
Sbjct: 4425 ttcgtcggcgtgggggcctcgcgggtgcgggatctctttaagaaggccaaggagaatgct 4366

                                                                        
Query: 73   ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
            |||||||||||||||||||||||||| ||||| || ||  ||||||| || ||||| || 
Sbjct: 4365 ccctgcatcgtcttcatcgacgagatcgacgcggtgggccggcagcggggagcgggcatt 4306

                                                                    
Query: 133  ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 188
            || || || ||||| ||| | ||||| ||| | |||||| |||| ||||| |||||
Sbjct: 4305 ggcggcggcaacgacgagcgcgagcaaaccctgaaccagttgcttacggaaatgga 4250



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 136/173 (78%)
 Strand = Plus / Plus

                                                                           
Query: 22      gtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcgccctgcatc 81
               ||||| |||||  ||||| |||| || |||||| ||||||||   || || ||||| || 
Sbjct: 2770265 gtgggggcctcgcgggtgcgggatctgttcgagcaggccaagcaaaatgccccctgtatt 2770324

                                                                           
Query: 82      gtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtgggggg 141
               |||||||||||||| || || ||||| ||  ||||||| || || ||  | || || || 
Sbjct: 2770325 gtcttcatcgacgaaatcgatgccgtgggtcggcagcggggagccggcctaggaggtggc 2770384

                                                                    
Query: 142     aacgatgagagggagcagaccattaaccagctgctcacggagatggacggctt 194
               ||||| ||| ||||||| ||| | |||||| |||| || ||||||||||||||
Sbjct: 2770385 aacgacgagcgggagcaaaccctgaaccagttgctgaccgagatggacggctt 2770437



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 106/123 (86%), Gaps = 2/123 (1%)
 Strand = Plus / Plus

                                                                           
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtgg-tgcgggaat 131
               ||||||||||||||||| ||||||||||||||||| |||||| |||| ||  |||||  |
Sbjct: 1419876 ccctgcatcgtcttcattgacgagattgacgccgtggggaggaagcggggaagcggg-gt 1419934

                                                                           
Query: 132     gggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
               ||| || |||||||| ||| ||||||||||| | |||||||| |||  ||||||||||||
Sbjct: 1419935 ggggggcgggaacgacgagcgggagcagaccctgaaccagctcctcgtggagatggacgg 1419994

                  
Query: 192     ctt 194
               |||
Sbjct: 1419995 ctt 1419997



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 77     gcatcgtcttcatcgacgagattgac 102
              ||||||||||||| ||||||||||||
Sbjct: 601790 gcatcgtcttcattgacgagattgac 601765



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 143    acgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
              |||| ||| ||||||||||| | |||||| | ||| |||||||||||||
Sbjct: 382299 acgacgagcgggagcagaccctgaaccagatcctctcggagatggacgg 382251



to top

>dbj|AB032368.1| Thermus thermophilus clpB, dafA, dnaJ, grpE, dnaK, ftsH genes,
            complete cds
          Length = 9000

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 106/123 (86%), Gaps = 2/123 (1%)
 Strand = Plus / Plus

                                                                        
Query: 73   ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtgg-tgcgggaat 131
            ||||||||||||||||| ||||||||||||||||| |||||| |||| ||  |||||  |
Sbjct: 7041 ccctgcatcgtcttcattgacgagattgacgccgtggggaggaagcggggaagcggg-gt 7099

                                                                        
Query: 132  gggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
            ||| || |||||||| ||| ||||||||||| | |||||||| |||  ||||||||||||
Sbjct: 7100 ggggggcgggaacgacgagcgggagcagaccctgaaccagctcctcgtggagatggacgg 7159

               
Query: 192  ctt 194
            |||
Sbjct: 7160 ctt 7162



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 105/123 (85%), Gaps = 2/123 (1%)
 Strand = Plus / Plus

                                                                           
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtgg-tgcgggaat 131
               ||||||||||||||||| ||||||||||||||||| |||||| |||| ||  |||||  |
Sbjct: 1096964 ccctgcatcgtcttcattgacgagattgacgccgtggggaggaagcggggaagcggg-gt 1097022

                                                                           
Query: 132     gggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
               ||| || || ||||| ||| ||||||||||| | |||||||| |||  ||||||||||||
Sbjct: 1097023 ggggggcggaaacgacgagcgggagcagaccctgaaccagctcctcgtggagatggacgg 1097082

                  
Query: 192     ctt 194
               |||
Sbjct: 1097083 ctt 1097085



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 77     gcatcgtcttcatcgacgagattgac 102
              ||||||||||||| ||||||||||||
Sbjct: 255573 gcatcgtcttcattgacgagattgac 255548



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 143   acgatgagagggagcagaccattaaccagctgctcacggagatggacgg 191
             |||| ||| ||||||||||| | |||||| | ||| |||||||||||||
Sbjct: 31951 acgacgagcgggagcagaccctgaaccagatcctctcggagatggacgg 31903



to top

>emb|BX572096.1| Prochlorococcus marinus MIT9313 complete genome; segment 2/7
          Length = 349323

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                     
Query: 142   aacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttctc 197
             ||||||||| | ||||||||| ||||||||||||||||||| ||||| ||||||||
Sbjct: 78439 aacgatgagcgtgagcagacccttaaccagctgctcacggaaatggatggcttctc 78494



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                                 
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgt 107
              |||||||||||||||||||||||||||||||||||
Sbjct: 305033 ccctgcatcgtcttcatcgacgagattgacgccgt 305067



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 583    gaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 629
              |||||||| |||||||| || ||||||||||||||||| || |||||
Sbjct: 305543 gaggctggccatgcccttgtgggtgccctgatgcctgactacgaccc 305589



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 152    gggagcagaccattaaccagctgctcacggagatgga 188
              ||||||||||| | |||||||||||||| ||||||||
Sbjct: 892552 gggagcagaccctcaaccagctgctcactgagatgga 892588



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                          
Query: 49      ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgt 107
               |||||| ||||||||   || ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2406656 ttcgagcaggccaagaagaacgcgccctgcatcgtcttcatcgacgagatcgacgccgt 2406598



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 77     gcatcgtcttcatcgacgagat 98
              ||||||||||||||||||||||
Sbjct: 120586 gcatcgtcttcatcgacgagat 120607



to top

>gb|AF332134.1| Medicago sativa FtsH protease (FtsH) mRNA, complete cds; chloroplast
            gene for chloroplast product
          Length = 2352

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 236/303 (77%)
 Strand = Plus / Plus

                                                                        
Query: 328  atccttgaggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggtt 387
            |||||| |||| || || |||||||| ||| | || |||||||| |||||||| ||  ||
Sbjct: 1343 atccttcaggtgcattctagaggaaaagcacttgcaaaggatgttgactttgacaaaatt 1402

                                                                        
Query: 388  gccagaaggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgcc 447
            ||||| || || || || ||||| || | |||||| |||||  ||||||| || || || 
Sbjct: 1403 gccaggagaaccccagggttcacaggagttgatctgcagaatctgatgaacgaagcagct 1462

                                                                        
Query: 448  atccttgccgctcgtcgtgatctgaaggagataagcaaggacgagatctctgacgctctg 507
            || ||||| ||  | ||||| || || || ||||| || || |||||  |||| || || 
Sbjct: 1463 attcttgctgccaggcgtgacctcaaagaaataagtaaagatgagatagctgatgcgctt 1522

                                                                        
Query: 508  gagaggatcattgccgggcctgagaagaagaatgcagttgtttcagaacagaagaggaag 567
            || ||||||||||| || || || ||||| ||||| ||||| |||||| |||||| ||| 
Sbjct: 1523 gaaaggatcattgctggaccagaaaagaaaaatgccgttgtctcagaagagaagaagaaa 1582

                                                                        
Query: 568  cttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgac 627
             | || || || ||||||||||| |||||  | || |||||  |||||||||||||||||
Sbjct: 1583 ttagtagcctatcatgaggctggccatgctttagtgggtgctttgatgcctgaatatgac 1642

               
Query: 628  cct 630
            |||
Sbjct: 1643 cct 1645



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                        
Query: 52   gagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtcggg 111
            |||||||| ||| | |||||||| ||||| || || || || |||||||| || || |||
Sbjct: 1067 gagaaggcgaagtcaaaggcgccttgcattgtgtttattgatgagattgatgctgttggg 1126

                                                                        
Query: 112  aggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaaccag 171
            || ||| | || || ||  | ||||| ||||| ||||||||||| ||||| ||||| |||
Sbjct: 1127 agacagagaggagctggtcttggtggtgggaatgatgagagggaacagactattaatcag 1186

              
Query: 172  ct 173
            ||
Sbjct: 1187 ct 1188



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 146/183 (79%)
 Strand = Plus / Minus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               ||||| |||||||| || ||| | ||| | ||||||||  |||||||||| |  || || 
Sbjct: 2732178 ttcgtgggcgtgggggcttcccgcgtgcgcgacctctttaagaaggccaaagagaacgcc 2732119

                                                                           
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
               ||||||||||| ||||||||||| || ||||| |||||  | ||||| || || || || 
Sbjct: 2732118 ccctgcatcgtgttcatcgacgaaatcgacgcggtcggccgccagcgcggcgccggtatc 2732059

                                                                           
Query: 133     ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
               || || || ||||| ||| | ||||||||| | ||||||||||||   ||||||||||||
Sbjct: 2732058 ggcggcggcaacgacgagcgcgagcagaccctcaaccagctgctcgtcgagatggacggc 2731999

                  
Query: 193     ttc 195
               |||
Sbjct: 2731998 ttc 2731996



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 146/183 (79%)
 Strand = Plus / Minus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               ||||| |||||||| || ||| | ||| | |||||||| ||| ||||||||   || || 
Sbjct: 2038724 ttcgtgggcgtgggggcttcccgcgtgcgcgacctctttgagcaggccaagaagaacgcc 2038665

                                                                           
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
               ||||||||||| ||||||||||| || ||||| |||||  | ||||| ||||| ||  ||
Sbjct: 2038664 ccctgcatcgtgttcatcgacgaaatcgacgcggtcggccgccagcgcggtgccggcctg 2038605

                                                                           
Query: 133     ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
               || || || ||||| ||| | ||||||||| | |||||| |||||   ||||||||||||
Sbjct: 2038604 ggcggcggcaacgacgagcgcgagcagaccctcaaccagttgctcgtcgagatggacggc 2038545

                  
Query: 193     ttc 195
               |||
Sbjct: 2038544 ttc 2038542



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 78      catcgtcttcatcgacgagattgacgcc 105
               |||||||||||||||||| || ||||||
Sbjct: 2805382 catcgtcttcatcgacgaaatcgacgcc 2805409



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                         
Query: 154     gagcagaccattaaccagctgctcacggagatggacggcttc 195
               ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 1210312 gagcagaccctcaaccagctgctcacggagatggacggcttc 1210271



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                          
Query: 16     gtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcgccc 75
              ||||||||||||||  || | ||| | ||| | |||||| ||||||||   || ||||| 
Sbjct: 826020 gtcggcgtgggtgctgcccgtgtgcgtgacatgttcgagcaggccaagaagaatgcgcca 826079

                                              
Query: 76     tgcatcgtcttcatcgacgagattgacgccgt 107
              |||||||||||||| ||||| ||||| |||||
Sbjct: 826080 tgcatcgtcttcattgacgaaattgatgccgt 826111



to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 100/122 (81%)
 Strand = Plus / Plus

                                                                           
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
               |||||||||||| |||| ||||||||||| || ||||| ||| | || || ||||| || 
Sbjct: 1170465 gcgccctgcatcatctttatcgacgagatcgatgccgtggggcgccatcgcggtgccggc 1170524

                                                                           
Query: 130     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
                ||||||| ||| |||| ||| ||||||||||| | |||||| ||||   ||||||||||
Sbjct: 1170525 ctgggtggcgggcacgacgagcgggagcagaccctcaaccagttgctggtggagatggac 1170584

                 
Query: 190     gg 191
               ||
Sbjct: 1170585 gg 1170586



to top

>emb|AJ488199.1|PVI488199 Uncultured bacterium gene for putative zinc metallopeptidase, clone
           8
          Length = 1884

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 154 gagcagaccattaaccagctgctcacggagatggacggcttc 195
           ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 832 gagcagaccctcaaccagctgctcacggagatggacggcttc 873



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                       
Query: 70     gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
              ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 147675 gcgccgtgcatcgtcttcatcgacgagatcgacgccgtcgg 147715



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                   
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgcc 105
               ||||||||||||||||||||||||||||| ||||||
Sbjct: 2726559 gcgccctgcatcgtcttcatcgacgagatcgacgcc 2726524



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 143    acgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 195
              |||| ||| ||||||||||  | |||||||||||||| |||||||||||||||
Sbjct: 147751 acgacgagcgggagcagacgctgaaccagctgctcaccgagatggacggcttc 147803



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 152     gggagcagaccattaaccagctgctcacggagatggacggcttc 195
               ||||||||||||| |||||||||||   ||||||||||||||||
Sbjct: 2726477 gggagcagaccatcaaccagctgctggtggagatggacggcttc 2726434



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                 
Query: 71      cgccctgcatcgtcttcatcgacgagattgacgc 104
               ||||||||||||| |||||||||||||| |||||
Sbjct: 3408997 cgccctgcatcgtgttcatcgacgagatcgacgc 3408964



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                   
Query: 157     cagaccattaaccagctgctcacggagatggacggc 192
               |||||| | |||||||||||||| ||||||||||||
Sbjct: 1782371 cagaccctcaaccagctgctcaccgagatggacggc 1782406



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                      
Query: 143     acgatgagagggagcagaccattaaccagctgctcacggagatggacggcttctc 197
               |||| ||| ||||||||||  | |||||||||||   ||||||||||||||||||
Sbjct: 3408925 acgacgagcgggagcagacgctgaaccagctgctggtggagatggacggcttctc 3408871



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               |||||||| ||||| |||||| ||||  | ||||| |||||| ||||||||||||| || 
Sbjct: 3410455 ttcgtcggtgtgggcgcctcccgggtccgcgacctgttcgagcaggccaaggccaacgcc 3410396

                                               
Query: 73      ccctgcatcgtcttcatcgacgagattgacgc 104
               |||   ||| |||||||||||||||| |||||
Sbjct: 3410395 cccgcgatcatcttcatcgacgagatcgacgc 3410364



to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                          
Query: 571     gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 629
               |||||||| || ||||| || ||||||||||||||||| ||||||||||| || |||||
Sbjct: 1951862 gtggcttatcacgaggcaggccatgccctcgtcggtgctctgatgcctgattacgaccc 1951804



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                     
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgt 107
               ||||||||||||||||||||||||||||| || |||||
Sbjct: 2185113 gcgccctgcatcgtcttcatcgacgagatcgatgccgt 2185076



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                     
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgt 107
               ||||||||||||||||||||||||||||| || |||||
Sbjct: 1945176 gcgccctgcatcgtcttcatcgacgagatcgatgccgt 1945213



to top

>gb|AE005986.1| Caulobacter crescentus CB15 section 312 of 359 of the complete genome
          Length = 14149

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 117/146 (80%)
 Strand = Plus / Minus

                                                                         
Query: 49    ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
             |||||| ||||||||   || |||||||||||| ||||||||||||| || |||||||| 
Sbjct: 13366 ttcgagcaggccaagaaaaacgcgccctgcatcatcttcatcgacgaaatcgacgccgtg 13307

                                                                         
Query: 109   gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
             ||  | || ||||| |||||  |||| || || ||||| ||| | ||||||||  | |||
Sbjct: 13306 ggtcgccatcgtggcgcgggcctgggcggcggcaacgacgagcgtgagcagacgctgaac 13247

                                       
Query: 169   cagctgctcacggagatggacggctt 194
             ||||||||    ||||||||||||||
Sbjct: 13246 cagctgctggtcgagatggacggctt 13221



to top

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                           
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
               |||||||||||| ||||||||||||| || || || |||||  | || |||||||| || 
Sbjct: 5066191 gcgccctgcatcatcttcatcgacgaaatcgatgcggtcggtcgtcatcgtggtgccggc 5066132

                                                                           
Query: 130     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
               |||||||| ||  |||| ||| | ||||||||| | |||||| ||||    |||||||||
Sbjct: 5066131 atgggtggtggtcacgacgagcgcgagcagaccctcaaccagttgctggtagagatggac 5066072

                    
Query: 190     ggctt 194
               |||||
Sbjct: 5066071 ggctt 5066067



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                          
Query: 71     cgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaa 130
              |||| |||||| ||||| |||||||||| ||||| |||||  | |||||||| || || |
Sbjct: 342159 cgccgtgcatcatcttcgtcgacgagatcgacgcggtcggccgtcagcgtggcgccggca 342218

                                                                          
Query: 131    tgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacg 190
              |||| || ||  |||| ||| | ||||||||| | |||||||||||   ||| |||||||
Sbjct: 342219 tgggcggcggccacgacgagcgtgagcagaccctgaaccagctgctggtggaaatggacg 342278

                   
Query: 191    gcttc 195
              |||||
Sbjct: 342279 gcttc 342283



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                           
Query: 43      gacctcttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgac 102
               ||||| |||||| | ||||| ||||  ||||| ||||||||||||||||| ||||| |||
Sbjct: 1325290 gacctgttcgagcaagccaaagccagtgcgccttgcatcgtcttcatcgatgagatcgac 1325231

                    
Query: 103     gccgt 107
               |||||
Sbjct: 1325230 gccgt 1325226



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgg 110
              ||||||||||||||||| || ||||||||||||||
Sbjct: 671758 tgcatcgtcttcatcgatgaaattgacgccgtcgg 671792



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                          
Query: 571     gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 629
               ||||||||||| || ||||| || ||| | ||||||||| |||||||||| || |||||
Sbjct: 1324762 gtggcttaccacgaagctggtcacgccttggtcggtgccttgatgcctgactacgaccc 1324704



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 71     cgccctgcatcgtcttcatcgacgagattgacgccgt 107
              |||||||||||||||||||||| ||||| ||||||||
Sbjct: 308984 cgccctgcatcgtcttcatcgatgagatcgacgccgt 308948



to top

>gb|AE004888.1| Pseudomonas aeruginosa PAO1, section 449 of 529 of the complete genome
          Length = 14623

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                      
Query: 70    gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
             ||||| |||||| |||||||||||||||| |||||||||||
Sbjct: 13759 gcgccgtgcatcatcttcatcgacgagatcgacgccgtcgg 13719



to top

>dbj|AK110158.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-F02, full
            insert sequence
          Length = 2830

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 70   gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
            |||||||||||| |||||||||||||||| |||||| ||||
Sbjct: 1525 gcgccctgcatcatcttcatcgacgagatcgacgccatcgg 1565



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                          
Query: 43     gacctcttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgac 102
              ||||| |||||| | ||||| ||||  ||||| ||||||||||||||||| ||||| |||
Sbjct: 295592 gacctgttcgagcaagccaaagccagtgcgccttgcatcgtcttcatcgatgagatcgac 295651

                   
Query: 103    gccgt 107
              |||||
Sbjct: 295652 gccgt 295656



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgg 110
              ||||||||||||||||| || ||||||||||||||
Sbjct: 949048 tgcatcgtcttcatcgatgaaattgacgccgtcgg 949014



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                         
Query: 571    gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 629
              ||||||||||| || ||||| || ||| | ||||||||| |||||||||| || |||||
Sbjct: 296120 gtggcttaccacgaagctggtcacgccttggtcggtgccttgatgcctgactacgaccc 296178



to top

>gb|AC175197.2| Sporobolomyces roseus clone JGIBAIF-21O18, complete sequence
          Length = 35076

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                             
Query: 79    atcgtcttcatcgacgagattgacgccgtcgg 110
             ||||||||||||||||||||||| ||||||||
Sbjct: 33922 atcgtcttcatcgacgagattgatgccgtcgg 33953



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 147/185 (79%), Gaps = 4/185 (2%)
 Strand = Plus / Plus

                                                                          
Query: 13     ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
              ||||||||||| ||||||||| | ||| | |||||||| ||| |||||||||  | | ||
Sbjct: 314121 ttcgtcggcgtcggtgcctcccgagtgcgcgacctctttgagcaggccaagg--aggccg 314178

                                                                          
Query: 73     ccctg--catcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaa 130
              ||| |  |||| ||||||| || ||||||||||| || ||  | || |||||||| || |
Sbjct: 314179 ccccggccatcatcttcattgatgagattgacgctgttggtcgtcatcgtggtgccggta 314238

                                                                          
Query: 131    tgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacg 190
              |||| || ||  |||| ||| | ||||||||| | |||||| |||||   ||||||||||
Sbjct: 314239 tgggcggtggccacgacgagcgtgagcagaccttgaaccagttgctcgttgagatggacg 314298

                   
Query: 191    gcttc 195
              |||||
Sbjct: 314299 gcttc 314303



to top

>emb|AL939124.1|SCO939124 Streptomyces coelicolor A3(2) complete genome; segment 21/29
          Length = 308050

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 154    gagcagaccattaaccagctgctcacggagatggacggcttctccgg 200
              ||||||||| | |||||| | ||||| ||||||||||||||||||||
Sbjct: 112019 gagcagaccctgaaccagatcctcaccgagatggacggcttctccgg 112065



to top

>emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete genome; segment 13/29
          Length = 293050

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 144/183 (78%)
 Strand = Plus / Minus

                                                                          
Query: 13     ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
              |||||||| || ||||||||| | ||| | ||||| |||||| |||||||||| || || 
Sbjct: 144453 ttcgtcggtgtcggtgcctcccgagtgcgtgacctgttcgagcaggccaaggcgaacgcc 144394

                                                                          
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
              ||   |||||||||| |||||||||| ||||| |||||  | || || || || ||  | 
Sbjct: 144393 ccggccatcgtcttcgtcgacgagatcgacgcggtcggccgccaccgcggcgccggcctc 144334

                                                                          
Query: 133    ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
              || || ||  |||| ||| | ||||||||| | ||||||||||||   ||||||||||||
Sbjct: 144333 ggcggcggtcacgacgagcgcgagcagaccctgaaccagctgctcgtcgagatggacggc 144274

                 
Query: 193    ttc 195
              |||
Sbjct: 144273 ttc 144271



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgg 110
              |||||| |||||||||||||||| |||||||||||
Sbjct: 966346 tgcatcatcttcatcgacgagatcgacgccgtcgg 966380



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 83/99 (83%), Gaps = 2/99 (2%)
 Strand = Plus / Plus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               |||||||| || ||||||||| | ||  | |||||||||||| |||||||||| || || 
Sbjct: 5691633 ttcgtcggtgtcggtgcctcccgagtccgtgacctcttcgagcaggccaaggcgaacgc- 5691691

                                                      
Query: 73      ccctgc-atcgtcttcatcgacgagattgacgccgtcgg 110
               ||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 5691692 cccggcgatcgtcttcgtcgacgagatcgacgcggtcgg 5691730



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 76      tgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||||||||||||||||||||| ||||| |||||
Sbjct: 2225203 tgcatcgtcttcatcgacgagatcgacgcggtcgg 2225169



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 71      cgccctgcatcgtcttcatcgacgagat 98
               |||||||| |||||||||||||||||||
Sbjct: 2877512 cgccctgcgtcgtcttcatcgacgagat 2877539



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 359     tggcgaaggatgtggacttt 378
               ||||||||||||||||||||
Sbjct: 1272758 tggcgaaggatgtggacttt 1272777



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 99/123 (80%)
 Strand = Plus / Plus

                                                                           
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
               ||||||||| |||||||||||||||| ||||| |||||  | || || || || ||  ||
Sbjct: 1722036 ccctgcatcatcttcatcgacgagatcgacgcggtcggtcgccaccgcggcgccggcctg 1722095

                                                                           
Query: 133     ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
               || || ||  |||| ||| | ||||||||  | ||||||||||||  |||||||||||||
Sbjct: 1722096 ggcggcggccacgacgagcgcgagcagacgctgaaccagctgctcgtggagatggacggc 1722155

                  
Query: 193     ttc 195
               |||
Sbjct: 1722156 ttc 1722158



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 67      aaggcgccctgcatcgtcttcatcgacgag 96
               ||||||||||||||||| ||||||||||||
Sbjct: 2033053 aaggcgccctgcatcgtgttcatcgacgag 2033024



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 166     aaccagctgctcacggagatggacggcttc 195
               |||||||||||| | |||||||||||||||
Sbjct: 2032954 aaccagctgctcgccgagatggacggcttc 2032925



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 68/84 (80%)
 Strand = Plus / Plus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               ||||| |||||||| ||| || | ||| | ||||| |||||| |||||   |||||||||
Sbjct: 4872911 ttcgtgggcgtgggcgccgcccgcgtgcgcgacctgttcgagcaggcccgcgccaaggcg 4872970

                                       
Query: 73      ccctgcatcgtcttcatcgacgag 96
               ||   |||| ||||||||||||||
Sbjct: 4872971 ccggccatcatcttcatcgacgag 4872994



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 81/99 (81%)
 Strand = Plus / Minus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               ||||||||||| ||||| ||| | ||| | ||| | |||||  ||||||||   || |||
Sbjct: 3121098 ttcgtcggcgtcggtgcatcccgcgtgcgtgacatgttcgaccaggccaagaagaacgcg 3121039

                                                      
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcggg 111
               ||||||||| ||||||||||||| || ||||| ||||||
Sbjct: 3121038 ccctgcatcatcttcatcgacgaaatcgacgcggtcggg 3121000



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                          
Query: 68      aggcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||||| |||||||||||||||||||| || ||||| |||||
Sbjct: 1629574 aggcgccgtgcatcgtcttcatcgacgaaatcgacgctgtcgg 1629616



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   gcgcttctgcggccagggcg 275
             ||||||||||||||||||||
Sbjct: 94710 gcgcttctgcggccagggcg 94729



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgt 107
              |||||||| |||||||| |||||||||||||||||
Sbjct: 596407 ccctgcattgtcttcattgacgagattgacgccgt 596373



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 76      tgcatcgtcttcatcgacgagattgacgc 104
               |||||||||||||| ||||| ||||||||
Sbjct: 1034529 tgcatcgtcttcattgacgaaattgacgc 1034501



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 65    ccaaggcgccctgcatcgtct 85
             |||||||||||||||||||||
Sbjct: 22323 ccaaggcgccctgcatcgtct 22303



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                           
Query: 78      catcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtgg 137
               |||| |||||||||||||||| ||||| |||||  | || || || |||||  | || ||
Sbjct: 2211653 catcatcttcatcgacgagatcgacgcggtcggccgtcaccgcggcgcgggtctcggcgg 2211594

                                                                         
Query: 138     ggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 195
                ||| |||| ||| | ||||||||  | ||||||||||||  ||||||||||||||||
Sbjct: 2211593 cgggcacgacgagcgcgagcagacgctcaaccagctgctcgtggagatggacggcttc 2211536



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 3       gcacgaggtcttcgtcggcg 22
               ||||||||||||||||||||
Sbjct: 1863102 gcacgaggtcttcgtcggcg 1863121



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                           
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
               ||||| |||||| |||||||||||||||| || || |||||  | |||||||| || || 
Sbjct: 2857347 gcgccatgcatcatcttcatcgacgagatcgatgctgtcggacgtcagcgtggcgcaggc 2857406

                                                                           
Query: 130     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
               ||||| || || ||||| ||| | || |||||  | |||||| |||||   |||||||||
Sbjct: 2857407 atggggggcggcaacgacgagcgcgaacagactctcaaccagttgctcgtcgagatggac 2857466

                     
Query: 190     ggcttc 195
               ||||||
Sbjct: 2857467 ggcttc 2857472



to top

>emb|BX248359.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
              6/8
          Length = 349895

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
              ||||||||| |||||||||||||||| ||||| |||||
Sbjct: 315307 ccctgcatcatcttcatcgacgagatcgacgcagtcgg 315270



to top

>emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              3/7
          Length = 311321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
              ||||||||| |||| ||||||||||||||||| |||||
Sbjct: 282898 ccctgcatcatctttatcgacgagattgacgcagtcgg 282861



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 49      ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
               |||||| ||||||||   || |||||||||||| ||||||||||||| || ||||| |||
Sbjct: 5308498 ttcgagcaggccaagaagaacgcgccctgcatcatcttcatcgacgaaatcgacgcggtc 5308439

                 
Query: 109     gg 110
               ||
Sbjct: 5308438 gg 5308437



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||||||| |||||||||||||||| ||||| |||||
Sbjct: 3473974 ccctgcatcatcttcatcgacgagatcgacgcggtcgg 3473937



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 77      gcatcgtcttcatcgacgagat 98
               ||||||||||||||||||||||
Sbjct: 4948172 gcatcgtcttcatcgacgagat 4948193



to top

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                          
Query: 71     cgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaa 130
              ||||||| ||||| || || ||||||||||| ||||||||  | ||||| ||||| ||  
Sbjct: 104118 cgccctgtatcgtttttattgacgagattgatgccgtcggccgccagcgaggtgccggcc 104177

                                                            
Query: 131    tgggtggggggaacgatgagagggagcagaccattaaccagctgct 176
              |||| || ||  |||||||| | ||||||||| | |||||||||||
Sbjct: 104178 tgggcggcggccacgatgagcgcgagcagaccctgaaccagctgct 104223



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                           
Query: 13      ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
               ||||||||||| || |||||  ||||| | ||| | |||||| ||||||||   || || 
Sbjct: 2080364 ttcgtcggcgtcggcgcctctcgggtgcgcgacatgttcgagcaggccaagaagaatgcc 2080423

                                                     
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||||||| ||||||||||||| || ||||| |||||
Sbjct: 2080424 ccctgcatcatcttcatcgacgaaatcgacgcggtcgg 2080461



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
              ||||||||| |||| ||||||||||||||||| |||||
Sbjct: 825214 ccctgcatcatctttatcgacgagattgacgcagtcgg 825177



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                           
Query: 212     tcatcgtgctcgccgcgaccaacaggccggatgtgcttgactccgcgcttctgcggccag 271
               |||||||| |||||||||||||| | || || ||||| ||  ||||||| |||||||| |
Sbjct: 1984109 tcatcgtgatcgccgcgaccaaccgccccgacgtgctcgatcccgcgctgctgcggccgg 1984050

                         
Query: 272     ggcggttcga 281
               | ||||||||
Sbjct: 1984049 gccggttcga 1984040



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 154    gagcagaccattaaccagctgctcacggagatggacggcttc 195
              ||||||||| | ||||||||||| || |||||||||||||||
Sbjct: 897514 gagcagaccctcaaccagctgctgaccgagatggacggcttc 897473



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                           
Query: 68      aggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgg 127
               |||| ||||||||||| ||||||||||| || ||||| |||||  | || ||||| || |
Sbjct: 2397288 aggccccctgcatcgtgttcatcgacgaaatcgacgcggtcggccgccatcgtggcgccg 2397229

                                                                
Query: 128     gaatgggtggggggaacgatgagagggagcagaccattaaccagctgct 176
               | ||||| || || ||||| ||| | ||||||||| | |||||| ||||
Sbjct: 2397228 gcatgggcggcggtaacgacgagcgcgagcagaccctgaaccagatgct 2397180



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 78      catcgtcttcatcgacgagatt 99
               ||||||||||||||||||||||
Sbjct: 2134320 catcgtcttcatcgacgagatt 2134299



to top

>emb|BX014465.1|CNS08JBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 164 ttaaccagctgctcacggagatggacggc 192
           ||||||||||||| |||||||||||||||
Sbjct: 675 ttaaccagctgctgacggagatggacggc 647



to top

>emb|BX014464.1|CNS08JBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 164 ttaaccagctgctcacggagatggacggc 192
           ||||||||||||| |||||||||||||||
Sbjct: 807 ttaaccagctgctgacggagatggacggc 835



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               |||||||||||| ||||||||||||| || || ||||||||
Sbjct: 3644051 gcgccctgcatcatcttcatcgacgaaatcgatgccgtcgg 3644011



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                           
Query: 43      gacctcttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgac 102
               ||||| |||||  ||||||||||||| ||||||  |||| ||||| | |||||||| |||
Sbjct: 5155090 gacctgttcgaacaggccaaggccaacgcgcccgccatcatcttcgttgacgagatcgac 5155149

                    
Query: 103     gccgt 107
               |||||
Sbjct: 5155150 gccgt 5155154



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                          
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 135
              |||||| |||||||||||||||| || ||||||||  | || ||||| || || ||||||
Sbjct: 817666 tgcatcatcttcatcgacgagatcgatgccgtcggtcgtcaccgtggcgccggcatgggt 817725

                                                       
Query: 136    ggggggaacgatgagagggagcagaccattaaccagctgct 176
              || ||  |||| ||| | ||||||||| | |||||| ||||
Sbjct: 817726 ggcggtcacgacgagcgcgagcagaccctgaaccagttgct 817766



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                          
Query: 85     ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 144
              |||||||||||||| ||||| |||||| | |||||||| |||||  | ||||| || |||
Sbjct: 540913 ttcatcgacgagatcgacgcggtcgggcgtcagcgtggcgcgggtctcggtggtggaaac 540972

                   
Query: 145    gatga 149
              |||||
Sbjct: 540973 gatga 540977



to top

>gb|AE010377.1| Methanopyrus kandleri AV19 section 76 of 157 of the complete genome
          Length = 4406

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 168  ccagctgctcacggagatggacggcttc 195
            |||||||||| |||||||||||||||||
Sbjct: 3935 ccagctgctcgcggagatggacggcttc 3962



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 77     gcatcgtcttcatcgacgagattgacgccgtcggga 112
              |||||||||||||||| |||||||| ||| ||||||
Sbjct: 858760 gcatcgtcttcatcgatgagattgatgccatcggga 858795



to top

>gb|AF037269.1| Mycobacterium smegmatis cell division protein (FtsH) gene, complete
           cds
          Length = 2364

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 96/120 (80%)
 Strand = Plus / Plus

                                                                       
Query: 76  tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 135
           |||||| ||||| |||||||||| |||||||||||  | ||||| || |||||  | || 
Sbjct: 769 tgcatcatcttcgtcgacgagatcgacgccgtcggccgtcagcgcggggcgggcctcggc 828

                                                                       
Query: 136 ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 195
           || ||  |||| ||| | ||||||||| | |||||||||||    |||||||||||||||
Sbjct: 829 ggtggtcacgacgagcgcgagcagaccctgaaccagctgctggtcgagatggacggcttc 888



to top

>gb|AY540192.1| Oreochromis mossambicus proteasome 26S ATPase subunit 1 mRNA,
           partial cds
          Length = 770

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 79  atcgtcttcatcgacgagattgacgccgtcgg 110
           |||||||||||||| |||||||||||| ||||
Sbjct: 358 atcgtcttcatcgatgagattgacgccatcgg 389



to top

>ref|XM_570849.1| Cryptococcus neoformans var. neoformans JEC21 endopeptidase
           (CNE03020) partial mRNA
          Length = 1436

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 77  gcatcgtcttcatcgacgagattgacgccgtcggga 112
           |||||||||||||||| |||||||| ||| ||||||
Sbjct: 897 gcatcgtcttcatcgatgagattgatgccatcggga 932



to top

>emb|CR727756.2|CNS0GOHE Tetraodon nigroviridis full-length cDNA
          Length = 1397

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 778 gcgccctccatcgttttcattgacgagattgacgcc 813



to top

>emb|CR719511.2|CNS0GI4D Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 831 gcgccctccatcgttttcattgacgagattgacgcc 866



to top

>emb|CR708630.2|CNS0G9QA Tetraodon nigroviridis full-length cDNA
          Length = 748

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 103 gcgccctccatcgttttcattgacgagattgacgcc 138



to top

>emb|CR695652.2|CNS0FZPS Tetraodon nigroviridis full-length cDNA
          Length = 1333

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 696 gcgccctccatcgttttcattgacgagattgacgcc 731



to top

>emb|CR689180.2|CNS0FUQ0 Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 831 gcgccctccatcgttttcattgacgagattgacgcc 866



to top

>emb|CR661563.2|CNS0F9FL Tetraodon nigroviridis full-length cDNA
          Length = 832

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 184 gcgccctccatcgttttcattgacgagattgacgcc 219



to top

>emb|CR650415.2|CNS0F0TX Tetraodon nigroviridis full-length cDNA
          Length = 1469

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 830 gcgccctccatcgttttcattgacgagattgacgcc 865



to top

>emb|CR649796.2|CNS0F0CQ Tetraodon nigroviridis full-length cDNA
          Length = 1461

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 829 gcgccctccatcgttttcattgacgagattgacgcc 864



to top

>emb|CR646015.2|CNS0EXFP Tetraodon nigroviridis full-length cDNA
          Length = 1507

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 868 gcgccctccatcgttttcattgacgagattgacgcc 903



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                       
Query: 71      cgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||||||||| ||||||||||||| || ||||| |||||
Sbjct: 3857995 cgccctgcatcatcttcatcgacgaaatcgacgcggtcgg 3857956



to top

>gb|BC044464.1| Danio rerio nuclear VCP-like, mRNA (cDNA clone MGC:55732
            IMAGE:3816242), complete cds
          Length = 2657

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 70   gcgccctgcatcgtcttcatcgacgagattgacgcc 105
            |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1083 gcgccctgcatcctcttcatcgatgagatcgacgcc 1118



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 169  cagctgctcacggagatggacgg 191
            |||||||||||||||||||||||
Sbjct: 2055 cagctgctcacggagatggacgg 2077



to top

>ref|NM_213484.1| Danio rerio nuclear VCP-like (nvl), mRNA
          Length = 2657

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 70   gcgccctgcatcgtcttcatcgacgagattgacgcc 105
            |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1083 gcgccctgcatcctcttcatcgatgagatcgacgcc 1118



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 169  cagctgctcacggagatggacgg 191
            |||||||||||||||||||||||
Sbjct: 2055 cagctgctcacggagatggacgg 2077



to top

>dbj|AB236774.1| Trifolium pratense RNA for putative zinc dependent protease, complete
            cds, clone: C1597
          Length = 2290

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 127  ggaatgggtggggggaacgatgagagggagcagaccattaacca 170
            ||||| ||||| ||||||||||| ||||| |||||| |||||||
Sbjct: 1034 ggaattggtggagggaacgatgaaagggaacagacccttaacca 1077



to top

>gb|AF319040.1|AF319040 Leishmania donovani ATP-dependent zinc metallopeptidase-like
           protein gene, complete cds
          Length = 1797

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 83  tcttcatcgacgagattgacgccgtcgg 110
           |||||||||||||||| |||||||||||
Sbjct: 638 tcttcatcgacgagatcgacgccgtcgg 665



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgt 107
               ||||| ||||| |||||||||||||| ||||||||
Sbjct: 3317002 ccctgtatcgtgttcatcgacgagatcgacgccgt 3316968



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 76      tgcatcgtcttcatcgacgagattgacgccgtcgg 110
               |||||| |||||||||||||||| ||||| |||||
Sbjct: 2105156 tgcatcatcttcatcgacgagatcgacgctgtcgg 2105122



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                           
Query: 152     gggagcagaccattaaccagctgctcacggagatggacggcttc 195
               ||||||||||| | || ||||| ||| |||||||||| ||||||
Sbjct: 2704041 gggagcagaccctgaatcagcttctctcggagatggatggcttc 2703998



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 76      tgcatcgtcttcatcgacgagat 98
               |||||||||||||||||||||||
Sbjct: 1930904 tgcatcgtcttcatcgacgagat 1930926



to top

>ref|XM_482385.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2547

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 166  aaccagctgctcacggagatggacggc 192
            |||||||||||||| ||||||||||||
Sbjct: 1840 aaccagctgctcaccgagatggacggc 1866



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 76      tgcatcgtcttcatcgacgagattgacgccgtcgg 110
               |||||| ||||| |||||||||| |||||||||||
Sbjct: 4044245 tgcatcatcttcgtcgacgagatcgacgccgtcgg 4044211



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 76      tgcatcgtcttcatcgacgagattgacgccgtcgg 110
               |||||||||||||||||||| || ||||| |||||
Sbjct: 1676431 tgcatcgtcttcatcgacgaaatcgacgcggtcgg 1676465



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 218    tgctcgccgcgaccaacaggc 238
              |||||||||||||||||||||
Sbjct: 145980 tgctcgccgcgaccaacaggc 146000



to top

>gb|AE009302.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 72 of
            187 of the complete sequence
          Length = 10906

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 221  tcgccgcgaccaacaggccggatgtgcttgactccgcgcttctgcggccagggcggttcg 280
            ||||||| |||||| | || ||||| |||||| ||||||||||||| || || || ||||
Sbjct: 2702 tcgccgctaccaaccgtcctgatgttcttgaccccgcgcttctgcgtcccggccgtttcg 2643

                       
Query: 281  atcggcaggtc 291
            | || ||||||
Sbjct: 2642 accgtcaggtc 2632



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 73   ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
            ||||| ||| ||||||||||||| || |||||||||||
Sbjct: 2850 ccctgtatcatcttcatcgacgaaatcgacgccgtcgg 2813



to top

>gb|AE008312.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 116 of
            187 of the complete sequence
          Length = 11049

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                        
Query: 221  tcgccgcgaccaacaggccggatgtgcttgactccgcgcttctgcggccagggcggttcg 280
            ||||||| |||||| | || ||||| |||||| ||||||||||||| || || || ||||
Sbjct: 4241 tcgccgctaccaaccgtcctgatgttcttgaccccgcgcttctgcgtcccggccgtttcg 4300

                       
Query: 281  atcggcaggtc 291
            | || ||||||
Sbjct: 4301 accgtcaggtc 4311



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 73   ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
            ||||| ||| ||||||||||||| || |||||||||||
Sbjct: 4093 ccctgtatcatcttcatcgacgaaatcgacgccgtcgg 4130



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                              
Query: 49      ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacga 95
               |||||| ||||||||   || |||||||||||| |||||||||||||
Sbjct: 2944784 ttcgagcaggccaagaagaacgcgccctgcatcatcttcatcgacga 2944738



to top

>ref|XM_765222.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_80_61971_63335) partial
           mRNA
          Length = 1365

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 83  tcttcatcgacgagattgacgcc 105
           |||||||||||||||||||||||
Sbjct: 752 tcttcatcgacgagattgacgcc 774



to top

>ref|XM_766189.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_306_32875_31316) partial
           mRNA
          Length = 1560

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 83  tcttcatcgacgagattgacgcc 105
           |||||||||||||||||||||||
Sbjct: 767 tcttcatcgacgagattgacgcc 789



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                           
Query: 49      ttcgagaaggccaaggccaaggcgccctgcatcgtcttcatcgacgagattgacgccgtc 108
               |||||| ||||||||   || ||||| |||||| ||||||||||||| || ||||| |||
Sbjct: 4610926 ttcgagcaggccaagaagaacgcgccgtgcatcatcttcatcgacgaaatcgacgcggtc 4610867

                                                                           
Query: 109     gggaggcagcgtggtgcgggaatgggtggggggaacgatgagagggagcagaccattaac 168
               ||  | || ||||| || ||  | || || || ||||| ||| | ||||||||| | |||
Sbjct: 4610866 ggccgtcatcgtggcgccggtcttggcggcggtaacgacgagcgcgagcagaccctcaac 4610807

                                          
Query: 169     cagctgctcacggagatggacggcttc 195
               ||||||||    |||||||||||||||
Sbjct: 4610806 cagctgctggtcgagatggacggcttc 4610780



to top

>ref|XM_782306.1| PREDICTED: Strongylocentrotus purpuratus similar to YME1-like 1
           isoform 1 (LOC582354), mRNA
          Length = 2071

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 386 ttgccagaaggacacctggtttcaccggtgctgatcttcagaa 428
           |||||||| |||||  ||||||||| || ||||||||||||||
Sbjct: 620 ttgccagagggacagttggtttcacaggggctgatcttcagaa 662



to top

>emb|Z83338.1|MTZ83338 M.tuberculosis H37Ra ftsH gene, partial
          Length = 363

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 76  tgcatcgtcttcatcgacgagattgacgccgtcgg 110
           |||||| ||||| |||||||||| |||||||||||
Sbjct: 163 tgcatcatcttcgtcgacgagatcgacgccgtcgg 197



to top

>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13
          Length = 349606

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgg 110
              |||||| ||||| |||||||||| |||||||||||
Sbjct: 234939 tgcatcatcttcgtcgacgagatcgacgccgtcgg 234905



to top

>emb|BX572092.1| Prochlorococcus marinus MED4 complete genome; segment 3/5
          Length = 348178

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 386  ttgccagaaggacacctggtttcaccggtgctgat 420
            |||| ||||||||||||||||| ||||| ||||||
Sbjct: 5936 ttgcaagaaggacacctggttttaccggagctgat 5902



to top

>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7
          Length = 348764

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                          
Query: 409    accggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgctcgtcgtgat 468
              ||||||||||||||    ||| || ||||||||||||||||||| || || ||||| || 
Sbjct: 303834 accggtgctgatctggccaacctgctgaatgaggctgccatcctggctgcccgtcgcgaa 303893

                                         
Query: 469    ctgaaggagataagcaaggacgagatc 495
              ||||  ||| | ||||| |||||||||
Sbjct: 303894 ctgaccgaggtcagcaacgacgagatc 303920



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 90/113 (79%)
 Strand = Plus / Plus

                                                                          
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 135
              ||||||||||| |||||||| || || || |||||  | || ||||| || ||  | |||
Sbjct: 303501 tgcatcgtctttatcgacgaaatcgatgctgtcggccgtcaacgtggagcaggccttggt 303560

                                                                   
Query: 136    ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 188
              || || ||||||||| |||| || ||| | |||||||| || |||||||||||
Sbjct: 303561 ggcggtaacgatgagcgggaacaaaccctcaaccagctcctgacggagatgga 303613



to top

>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14
          Length = 316050

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 76     tgcatcgtcttcatcgacgagattgacgccgtcgg 110
              |||||| ||||| |||||||||| |||||||||||
Sbjct: 244356 tgcatcatcttcgtcgacgagatcgacgccgtcgg 244322



to top

>gb|AF456414.1| Giardia intestinalis endosomal AAA ATPase-like protein (VPS4) gene,
           complete cds
          Length = 1594

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 83  tcttcatcgacgagattgacgcc 105
           |||||||||||||||||||||||
Sbjct: 854 tcttcatcgacgagattgacgcc 876



to top

>ref|XM_697576.1| PREDICTED: Danio rerio hypothetical protein LOC554702 (LOC554702),
            mRNA
          Length = 2640

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 169  cagctgctcacggagatggacgg 191
            |||||||||||||||||||||||
Sbjct: 2055 cagctgctcacggagatggacgg 2077



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 76    tgcatcgtcttcatcgacgagattgacgccgtcgg 110
             |||||||||||||||||||| || ||||| |||||
Sbjct: 78813 tgcatcgtcttcatcgacgaaatcgacgcggtcgg 78779



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 49      ttcgagaaggccaaggccaagg 70
               ||||||||||||||||||||||
Sbjct: 3077090 ttcgagaaggccaaggccaagg 3077069



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 166      aaccagctgctcacggagatggacggc 192
                |||||||||||||| ||||||||||||
Sbjct: 19750542 aaccagctgctcaccgagatggacggc 19750516



to top

>dbj|BA000002.2| Aeropyrum pernix K1 DNA, complete genome
          Length = 1669695

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 83      tcttcatcgacgagattgacgcc 105
               |||||||||||||||||||||||
Sbjct: 1574505 tcttcatcgacgagattgacgcc 1574483



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 83     tcttcatcgacgagattgacgc 104
              ||||||||||||||||||||||
Sbjct: 870483 tcttcatcgacgagattgacgc 870504



to top

>gb|AE005094.1| Halobacterium sp. NRC-1 section 125 of 170 of the complete genome
          Length = 15065

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 83   tcttcatcgacgagattgacgccgtcg 109
            |||||||||||||||| ||||||||||
Sbjct: 7822 tcttcatcgacgagatcgacgccgtcg 7796



to top

>dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0007M04
          Length = 176293

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 166   aaccagctgctcacggagatggacggc 192
             |||||||||||||| ||||||||||||
Sbjct: 79493 aaccagctgctcaccgagatggacggc 79467



to top

>ref|XM_316268.2| Anopheles gambiae str. PEST ENSANGP00000020514
           (ENSANGG00000018025), mRNA
          Length = 1456

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 166 aaccagctgctcacggagatggacggc 192
           ||||||||||| |||||||||||||||
Sbjct: 808 aaccagctgctgacggagatggacggc 834



to top

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcggg 111
               ||||||||| |||||||||||||| | |||||| |||||
Sbjct: 1313170 ccctgcatcatcttcatcgacgaggtggacgccatcggg 1313208



to top

>gb|AE010343.1| Methanopyrus kandleri AV19 section 42 of 157 of the complete genome
          Length = 7856

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 166  aaccagctgctcacggagatggacgg 191
            ||||||||||| ||||||||||||||
Sbjct: 3294 aaccagctgctgacggagatggacgg 3319



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 77      gcatcgtcttcatcgacgagattgac 102
               |||||||||||||||| |||||||||
Sbjct: 2003943 gcatcgtcttcatcgatgagattgac 2003918



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                          
Query: 70     gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
              ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 810499 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 810558

                                                                          
Query: 130    atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
              ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 810559 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 810618

                    
Query: 190    ggcttc 195
              ||||||
Sbjct: 810619 ggcttc 810624



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 79      atcgtcttcatcgacgagat 98
               ||||||||||||||||||||
Sbjct: 1435767 atcgtcttcatcgacgagat 1435748



to top

>ref|XM_359584.1| Magnaporthe grisea 70-15 hypothetical protein (MG05193.4) partial
            mRNA
          Length = 2463

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 166  aaccagctgctcacggagatggacgg 191
            ||||||||||| ||||||||||||||
Sbjct: 1861 aaccagctgctgacggagatggacgg 1886



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                           
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
               ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 1697218 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 1697277

                                                                           
Query: 130     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
               ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 1697278 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 1697337

                     
Query: 190     ggcttc 195
               ||||||
Sbjct: 1697338 ggcttc 1697343



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 79      atcgtcttcatcgacgagat 98
               ||||||||||||||||||||
Sbjct: 2661898 atcgtcttcatcgacgagat 2661879



to top

>emb|AL591791.1|SME591791 Sinorhizobium meliloti 1021 complete chromosome; segment 10/12
          Length = 340900

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 70     gcgccctgcatcgtcttcatcgacga 95
              |||||||||||| |||||||||||||
Sbjct: 237622 gcgccctgcatcatcttcatcgacga 237597



to top

>emb|AJ243808.1|BJA243808 Bradyrhizobium japonicum yaeN and ftsH genes
          Length = 3715

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 73   ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
            ||||||||| ||||||||||||| || ||||| |||||
Sbjct: 2188 ccctgcatcatcttcatcgacgaaatcgacgctgtcgg 2225



to top

>ref|XM_500040.1| Yarrowia lipolytica CLIB122, YALI0A13541g predicted mRNA
          Length = 1020

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 49  ttcgagaaggccaaggccaagg 70
           ||||||||||||||||||||||
Sbjct: 823 ttcgagaaggccaaggccaagg 844



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 67      aaggcgccctgcatcgtcttcatcgacgag 96
               ||||| ||||||||| ||||||||||||||
Sbjct: 1940486 aaggcaccctgcatcatcttcatcgacgag 1940515



to top

>emb|BX572090.1| Prochlorococcus marinus MED4 complete genome; segment 1/5
          Length = 349742

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 367    gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgat 420
              ||||| ||| ||||||||||||| ||||| || ||||| || || |||||||||
Sbjct: 220557 gatgtagaccttgataaggttgcgagaagaactcctgggtttacaggtgctgat 220504



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 67      aaggcgccctgcatcgtcttcatcgacgag 96
               |||||||| |||||| ||||||||||||||
Sbjct: 1494913 aaggcgccgtgcatcatcttcatcgacgag 1494884



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                           
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
               ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 1583931 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 1583990

                                                                           
Query: 130     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
               ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 1583991 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 1584050

                     
Query: 190     ggcttc 195
               ||||||
Sbjct: 1584051 ggcttc 1584056



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 79      atcgtcttcatcgacgagat 98
               ||||||||||||||||||||
Sbjct: 1721579 atcgtcttcatcgacgagat 1721598



to top

>emb|BX321857.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 2/10
          Length = 313050

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 73     ccctgcatcgtcttcatcgacgagat 98
              ||||||||| ||||||||||||||||
Sbjct: 262666 ccctgcatcatcttcatcgacgagat 262691



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 67      aaggcgccctgcatcgtcttcatcgacgag 96
               |||||||| |||||| ||||||||||||||
Sbjct: 1078834 aaggcgccgtgcatcatcttcatcgacgag 1078805



to top

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 166     aaccagctgctcacggagatggacgg 191
               |||||||||||||| |||||||||||
Sbjct: 1016697 aaccagctgctcactgagatggacgg 1016722



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 166    aaccagctgctcacggagatggacgg 191
              |||||||||||||| |||||||||||
Sbjct: 572668 aaccagctgctcaccgagatggacgg 572643



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 85      ttcatcgacgagattgacgcc 105
               |||||||||||||||||||||
Sbjct: 1016625 ttcatcgacgagattgacgcc 1016645



to top

>gb|AE009637.1| Brucella melitensis 16M chromosome I, section 194 of 195 of the
            complete sequence
          Length = 10552

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 77   gcatcgtcttcatcgacgagattgac 102
            |||||||||||||||| |||||||||
Sbjct: 5140 gcatcgtcttcatcgatgagattgac 5165



to top

>gb|AE004918.1| Pseudomonas aeruginosa PAO1, section 479 of 529 of the complete genome
          Length = 11170

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 77    gcatcgtcttcatcgacgagat 98
             ||||||||||||||||||||||
Sbjct: 10501 gcatcgtcttcatcgacgagat 10522



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 73      ccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||||||| ||||||||||||| || ||||| |||||
Sbjct: 7867517 ccctgcatcatcttcatcgacgaaatcgacgctgtcgg 7867480



to top

>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 142/182 (78%)
 Strand = Plus / Minus

                                                                          
Query: 13     ttcgtcggcgtgggtgcctccagggtgagggacctcttcgagaaggccaaggccaaggcg 72
              ||||| || ||||| |||||  ||||| | |||||||| ||  | ||||| ||||| || 
Sbjct: 112041 ttcgttggggtgggggcctcacgggtgcgcgacctctttgaacaagccaaagccaatgcc 111982

                                                                          
Query: 73     ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 132
              ||||| ||||| || || || |||||||| ||||| ||  | ||||| ||||| ||  ||
Sbjct: 111981 ccctgtatcgtttttattgatgagattgatgccgttggtcgccagcgcggtgccggtctg 111922

                                                                          
Query: 133    ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 192
              || || || || |||||  ||||||| ||| | ||||||||||| ||||| ||||| |||
Sbjct: 111921 gggggtggcaatgatgaacgggagcaaaccctcaaccagctgctgacggaaatggatggc 111862

                
Query: 193    tt 194
              ||
Sbjct: 111861 tt 111860



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 577    taccatgaggctggacatgccctcgtcggtgccctgatgcc 617
              ||||||||||| || |||||||| || || |||||||||||
Sbjct: 111477 taccatgaggcgggtcatgcccttgtgggcgccctgatgcc 111437



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 77      gcatcgtcttcatcgacgagattgac 102
               |||||||||||||||| |||||||||
Sbjct: 2020604 gcatcgtcttcatcgatgagattgac 2020579



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 67      aaggcgccctgcatcgtcttcatcgacgag 96
               |||||||| |||||| ||||||||||||||
Sbjct: 1547637 aaggcgccgtgcatcatcttcatcgacgag 1547666



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 100/126 (79%)
 Strand = Plus / Minus

                                                                           
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 129
               ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 3189706 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 3189647

                                                                           
Query: 130     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 189
               ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 3189646 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 3189587

                     
Query: 190     ggcttc 195
               ||||||
Sbjct: 3189586 ggcttc 3189581



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 79      atcgtcttcatcgacgagatt 99
               |||||||||||||||||||||
Sbjct: 2481065 atcgtcttcatcgacgagatt 2481085



to top

>gb|AF006691.1|AF006691 Pseudomonas putida regulatory protein (ipbR), isopropylbenzene
            dioxygenase, iron-sulfur protein, large subunit (ipbAa),
            isopropylbenzene dioxygenase, iron-sulfur protein, small
            subunit (ipbAb), isopropylbenzene dioxygenase, ferredoxin
            subunit (ipbAc), isopropylbenzene dioxygenase, ferredoxin
            reductase subunit (ipbAd),
            cis-2,3-dihydroxy-2,3-dihydroisopropylbenzene
            dehydrogenase (ipbB), 3-isopropylcatechol dioxygenase
            (ipbC), 2-hydroxypenta-2,4-dienoate hydratase (ipbE),
            acetaldehyde dehydrogenase (acylating) (ipbG),
            4-hydroxy-2-oxovalerate aldolase (ipbF), outer membrane
            protein (ipbH), and
            2-hydroxy-6-oxo-7-methylocta-2,4-dienoate hydrolase
            (ipbD) genes, complete cds
          Length = 21768

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 50   tcgagaaggccaaggccaaggc 71
            ||||||||||||||||||||||
Sbjct: 4789 tcgagaaggccaaggccaaggc 4768



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 47   tcttcgagaaggccaaggcca 67
            |||||||||||||||||||||
Sbjct: 2264 tcttcgagaaggccaaggcca 2244



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 77      gcatcgtcttcatcgacgagattgac 102
               |||||||||||||||| |||||||||
Sbjct: 2017723 gcatcgtcttcatcgatgagattgac 2017698



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 49      ttcgagaaggccaaggccaagg 70
               ||||||||||||||||||||||
Sbjct: 1393416 ttcgagaaggccaaggccaagg 1393437



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 570     tgtggcttaccatgaggctggacatgcc 597
               |||||| |||||||||||||| ||||||
Sbjct: 1102899 tgtggcctaccatgaggctggccatgcc 1102926



to top

>dbj|AB018433.1| Pyrococcus kodakaraensis Pk-cdcA gene, complete cds
          Length = 2880

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 166  aaccagctgctcacggagatggacgg 191
            |||||||||||||| |||||||||||
Sbjct: 2134 aaccagctgctcaccgagatggacgg 2159



to top

>gb|AC002511.1| Homo sapiens chromosome 19 clone PC28130, complete sequence
          Length = 98713

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 567   gcttgtggcttaccatgaggc 587
             |||||||||||||||||||||
Sbjct: 55731 gcttgtggcttaccatgaggc 55711



to top

>gb|DQ214550.1| Taeniopygia guttata clone 0061P0013A02 26S ATPase complex subunit
           4-like mRNA, complete sequence
          Length = 1532

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 78  catcgtcttcatcgacgagat 98
           |||||||||||||||||||||
Sbjct: 873 catcgtcttcatcgacgagat 893



to top

>gb|DQ214549.1| Taeniopygia guttata clone 0063P0013D05 26S ATPase complex subunit
           4-like mRNA, complete sequence
          Length = 1542

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 78  catcgtcttcatcgacgagat 98
           |||||||||||||||||||||
Sbjct: 874 catcgtcttcatcgacgagat 894



to top

>ref|XM_324383.1| Neurospora crassa OR74A predicted protein (NCU05027.1) partial mRNA
          Length = 1368

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 52   gagaaggccaaggccaaggcg 72
            |||||||||||||||||||||
Sbjct: 1108 gagaaggccaaggccaaggcg 1128



to top

>ref|XM_951242.1| Neurospora crassa OR74A hypothetical protein (NCU05027.1) partial
            mRNA
          Length = 1368

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 52   gagaaggccaaggccaaggcg 72
            |||||||||||||||||||||
Sbjct: 1108 gagaaggccaaggccaaggcg 1128



to top

>gb|AY639765.1| Hordeum vulgare subsp. spontaneum cultivar PI 560558 FtsH-like
           protein gene, partial cds
          Length = 456

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639764.1| Aegilops tauschii cultivar KU2156 FtsH-like protein gene, partial
           cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639763.1| Triticum urartu cultivar IG45487 FtsH-like protein gene, partial
           cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639762.1| Hordeum vulgare subsp. spontaneum cultivar PI 220341 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639761.1| Aegilops tauschii cultivar KU2160 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639760.1| Aegilops tauschii cultivar KU2065 FtsH-like protein gene, partial
           cds
          Length = 452

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639759.1| Triticum monococcum cultivar G4913 FtsH-like protein gene, partial
           cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639756.1| Hordeum vulgare subsp. spontaneum cultivar PI 466619 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639755.1| Triticum urartu cultivar IG45633 FtsH-like protein gene, partial
           cds
          Length = 450

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 397 ggtggtgggaacgatgaaagggagcagac 425



to top

>gb|AY639754.1| Hordeum vulgare subsp. spontaneum cultivar PI 560560 FtsH-like
           protein gene, partial cds
          Length = 461

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 403 ggtggtgggaacgatgaaagggagcagac 431



to top

>gb|AY639751.1| Hordeum vulgare subsp. spontaneum cultivar PI 227301 FtsH-like
           protein gene, partial cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639750.1| Aegilops tauschii cultivar KU2801 FtsH-like protein gene, partial
           cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639749.1| Triticum urartu cultivar IG113243 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639748.1| Hordeum vulgare subsp. spontaneum cultivar PI 466233 FtsH-like
           protein gene, partial cds
          Length = 462

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639747.1| Hordeum vulgare subsp. spontaneum cultivar PI 466631 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639746.1| Hordeum vulgare subsp. spontaneum cultivar PI 420915 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639745.1| Hordeum vulgare subsp. spontaneum cultivar PI 254894 FtsH-like
           protein gene, partial cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639744.1| Aegilops tauschii cultivar KU2146 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639743.1| Hordeum vulgare subsp. spontaneum cultivar PI 466265 FtsH-like
           protein gene, partial cds
          Length = 458

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639742.1| Hordeum vulgare subsp. spontaneum cultivar PI 282591 FtsH-like
           protein gene, partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639741.1| Triticum urartu cultivar IG45470 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639740.1| Hordeum vulgare subsp. spontaneum cultivar PI 420914 FtsH-like
           protein gene, partial cds
          Length = 458

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639739.1| Hordeum vulgare subsp. spontaneum cultivar PI 466529 FtsH-like
           protein gene, partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639738.1| Hordeum vulgare subsp. spontaneum cultivar PI 466625 FtsH-like
           protein gene, partial cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639737.1| Triticum urartu cultivar IG45218 FtsH-like protein gene, partial
           cds
          Length = 452

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639735.1| Hordeum vulgare subsp. spontaneum cultivar PI 466252 FtsH-like
           protein gene, partial cds
          Length = 459

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639734.1| Aegilops tauschii cultivar KU2030 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639733.1| Lophopyrum elongatum FtsH-like protein gene, partial cds
          Length = 456

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 401 ggtggtgggaacgatgaaagggagcagac 429



to top

>gb|AY639732.1| Hordeum vulgare subsp. spontaneum cultivar PI 466684 FtsH-like
           protein gene, partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 133 ggtggggggaacgatgagagggagcagac 161
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>ref|XM_751952.1| Ustilago maydis 521 hypothetical protein (UM00898.1) partial mRNA
          Length = 2583

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 70   gcgccctgcatcgtcttcatcgacgagat 98
            |||||||| ||| ||||||||||||||||
Sbjct: 1384 gcgccctgtatcatcttcatcgacgagat 1412



to top

>ref|XM_500490.1| Yarrowia lipolytica CLIB122, YALI0B04334g predicted mRNA
          Length = 3309

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 484  aaggacgagatctctgacgctctgg 508
            |||||||||||| ||||||||||||
Sbjct: 1717 aaggacgagatcgctgacgctctgg 1741



to top

>ref|XM_506087.1| Yarrowia lipolytica CLIB122, YALI0F31251g predicted mRNA
          Length = 2403

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 51   cgagaaggccaaggccaaggc 71
            |||||||||||||||||||||
Sbjct: 2202 cgagaaggccaaggccaaggc 2222



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 70      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 110
               ||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 3525795 gcgccgtgcatcgtgttcatcgacgaaatcgacgcggtcgg 3525755



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 67      aaggcgccctgcatcgtcttcatcgacga 95
               |||||||| ||||||||||| ||||||||
Sbjct: 2827170 aaggcgccgtgcatcgtctttatcgacga 2827142



to top

>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 73      ccctgcatcgtcttcatcgacgagattga 101
               ||||||||||| || ||||||||||||||
Sbjct: 4654830 ccctgcatcgtttttatcgacgagattga 4654802



to top

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                       
Query: 69     ggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgc 125
              ||||||||||||  |||| ||||| || || |||||||||||| | ||||| |||||
Sbjct: 667209 ggcgccctgcattatctttatcgatgaaatcgacgccgtcgggcgtcagcgcggtgc 667265



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 52      gagaaggccaaggccaaggcg 72
               |||||||||||||||||||||
Sbjct: 4502396 gagaaggccaaggccaaggcg 4502416



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 68      aggcgccctgcatcgtcttcatcga 92
               |||| ||||||||||||||||||||
Sbjct: 5893127 aggctccctgcatcgtcttcatcga 5893103



to top

>emb|BX842599.1| Neurospora crassa DNA linkage group II BAC clone B10A24
          Length = 85694

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 52    gagaaggccaaggccaaggcg 72
             |||||||||||||||||||||
Sbjct: 56009 gagaaggccaaggccaaggcg 56029



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 80      tcgtcttcatcgacgagattgacgc 104
               ||||||||||||||||||| |||||
Sbjct: 3127159 tcgtcttcatcgacgagatcgacgc 3127183



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 172     ctgctcacggagatggacggcttc 195
               |||||| |||||||||||||||||
Sbjct: 2821080 ctgctctcggagatggacggcttc 2821103



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     atcgtcttcatcgacgagat 98
              ||||||||||||||||||||
Sbjct: 684380 atcgtcttcatcgacgagat 684399



to top

>dbj|AK068710.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013159K10, full
            insert sequence
          Length = 1573

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 52   gagaaggccaaggccaaggcg 72
            |||||||||||||||||||||
Sbjct: 1056 gagaaggccaaggccaaggcg 1076



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 83    tcttcatcgacgagattgacgccgt 107
             |||||||||||||||| ||||||||
Sbjct: 58475 tcttcatcgacgagatcgacgccgt 58451



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 52      gagaaggccaaggccaaggcg 72
               |||||||||||||||||||||
Sbjct: 4502377 gagaaggccaaggccaaggcg 4502397



to top

>emb|AL954157.3|CNS08CCV Oryza sativa chromosome 12, . BAC OSJNBa0042N11 of library OSJNBa
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 168699

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 52   gagaaggccaaggccaaggcg 72
            |||||||||||||||||||||
Sbjct: 2100 gagaaggccaaggccaaggcg 2080



to top

>emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa0002O20 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 129155

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 52     gagaaggccaaggccaaggcg 72
              |||||||||||||||||||||
Sbjct: 102382 gagaaggccaaggccaaggcg 102362



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 51      cgagaaggccaaggccaaggc 71
               |||||||||||||||||||||
Sbjct: 3898335 cgagaaggccaaggccaaggc 3898355



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 484    aaggacgagatctctgacgctctgg 508
              |||||||||||| ||||||||||||
Sbjct: 581282 aaggacgagatcgctgacgctctgg 581306



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 82     gtcttcatcgacgagattgacgcc 105
              ||||||||||| ||||||||||||
Sbjct: 395406 gtcttcatcgatgagattgacgcc 395429



to top

>ref|NM_115254.3| Arabidopsis thaliana binding / transporter AT3G53940 mRNA, complete
            cds
          Length = 1542

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 528  tgagaagaagaatgcagttg 547
            ||||||||||||||||||||
Sbjct: 1089 tgagaagaagaatgcagttg 1108



to top

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 118    cgtggtgcgggaatgggtggggggaacgatga 149
              |||||||| ||||||||||| || ||||||||
Sbjct: 884766 cgtggtgccggaatgggtggcggtaacgatga 884797



to top

>ref|XM_511168.1| PREDICTED: Pan troglodytes similar to paraplegin isoform 2; cell
            adhesion regulator; cell matrix adhesion regulator
            (LOC454315), mRNA
          Length = 7059

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 2635 ccctgcatcgtctacatcgatgagatcgacgc 2666



to top

>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 241  gatgtgcttgactccgcgcttctgcggccagggcggttcgatcg 284
            ||||||||||| || |||||| |||| |||||||| || |||||
Sbjct: 9289 gatgtgcttgattcggcgcttttgcgtccagggcgttttgatcg 9332



to top

>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                      
Query: 567    gcttgtggcttaccatgaggctggacatgccctcgtcggt 606
              |||||| |||||||||||||| || |||||| | ||||||
Sbjct: 181273 gcttgtagcttaccatgaggcgggccatgccatggtcggt 181312



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 55      aaggccaaggccaaggcgcc 74
               ||||||||||||||||||||
Sbjct: 2742686 aaggccaaggccaaggcgcc 2742667



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 172    ctgctcacggagatggacggcttc 195
              |||||||| |||||||||||||||
Sbjct: 100442 ctgctcaccgagatggacggcttc 100465



to top

>gb|BC007692.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), mRNA (cDNA clone IMAGE:3956605)
          Length = 2310

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1216 ccctgcatcgtctacatcgatgagatcgacgc 1247



to top

>gb|BC071538.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase,
           1b, mRNA (cDNA clone MGC:86923 IMAGE:6905970), complete
           cds
          Length = 1521

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| ||| ||||||||||| ||||| ||||||
Sbjct: 859 gcgccctccattgtcttcatcgatgagatagacgcc 894



to top

>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 565    aagcttgtggcttaccatga 584
              ||||||||||||||||||||
Sbjct: 301864 aagcttgtggcttaccatga 301883



to top

>ref|XM_610479.2| PREDICTED: Bos taurus similar to neuron navigator 1 (LOC531974),
            partial mRNA
          Length = 4224

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 52   gagaaggccaaggccaaggc 71
            ||||||||||||||||||||
Sbjct: 1102 gagaaggccaaggccaaggc 1121



to top

>ref|XM_419244.1| PREDICTED: Gallus gallus similar to steerin1 protein (LOC421164),
            mRNA
          Length = 4986

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 52   gagaaggccaaggccaaggc 71
            ||||||||||||||||||||
Sbjct: 3058 gagaaggccaaggccaaggc 3077



to top

>ref|NM_003119.2| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive) (SPG7), nuclear gene encoding
            mitochondrial protein, transcript variant 1, mRNA
          Length = 3096

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1225 ccctgcatcgtctacatcgatgagatcgacgc 1256



to top

>ref|NM_199367.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive) (SPG7), nuclear gene encoding
            mitochondrial protein, transcript variant 2, mRNA
          Length = 2319

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1225 ccctgcatcgtctacatcgatgagatcgacgc 1256



to top

>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence
          Length = 225556

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 332   ttgaggttcactccagagga 351
             ||||||||||||||||||||
Sbjct: 84075 ttgaggttcactccagagga 84094



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                       
Query: 133     ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 188
               |||||||| ||||||||||| || || ||| | || ||| | ||||||||||||||
Sbjct: 3035367 ggtgggggtaacgatgagagagaacaaaccctcaatcagttactcacggagatgga 3035422



to top

>gb|BT011963.1| Arabidopsis thaliana At3g53940 mRNA sequence
          Length = 1095

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 528 tgagaagaagaatgcagttg 547
           ||||||||||||||||||||
Sbjct: 881 tgagaagaagaatgcagttg 900



to top

>gb|AC092123.4| Homo sapiens chromosome 16 clone RP11-104N10, complete sequence
          Length = 112519

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 73    ccctgcatcgtcttcatcgacgagattgacgc 104
             ||||||||||||| |||||| ||||| |||||
Sbjct: 53225 ccctgcatcgtctacatcgatgagatcgacgc 53194



to top

>ref|XM_842897.1| Leishmania major strain Friedlin ATPase (LMJ_0292) partial mRNA
          Length = 1971

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 172  ctgctcacggagatggacggcttc 195
            |||||||| |||||||||||||||
Sbjct: 1552 ctgctcaccgagatggacggcttc 1575



to top

>ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26S PROTEASE
           REGULATORY SUBUNIT 6B HOMOLOG (FG10769.1) partial mRNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 78  catcgtcttcatcgacgagattgacgcc 105
           |||| |||||||||||||||| ||||||
Sbjct: 780 catcatcttcatcgacgagatcgacgcc 807



to top

>ref|XM_385706.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05530.1)
           partial mRNA
          Length = 2466

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tcttcatcgacgagattgac 102
           ||||||||||||||||||||
Sbjct: 956 tcttcatcgacgagattgac 975



to top

>emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete chromosome; segment 7/12
          Length = 306250

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 581   atgaggctggacatgccctc 600
             ||||||||||||||||||||
Sbjct: 54117 atgaggctggacatgccctc 54136



to top

>gb|BC035929.2| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), mRNA (cDNA clone IMAGE:4396303),
            partial cds
          Length = 2882

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1017 ccctgcatcgtctacatcgatgagatcgacgc 1048



to top

>ref|XM_499951.1| Yarrowia lipolytica CLIB122, YALI0A10615g predicted mRNA
          Length = 2403

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 570  tgtggcttaccatgaggctggacatgcc 597
            |||||| |||||||||||||| ||||||
Sbjct: 1773 tgtggcctaccatgaggctggccatgcc 1800



to top

>ref|XM_500430.1| Yarrowia lipolytica CLIB122, YALI0B02574g predicted mRNA
          Length = 2292

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 82   gtcttcatcgacgagattgacgcc 105
            ||||||||||| ||||||||||||
Sbjct: 1090 gtcttcatcgatgagattgacgcc 1113



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 101/128 (78%)
 Strand = Plus / Minus

                                                                           
Query: 68      aggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgg 127
               ||||||| |||||||| |||||||| || || ||||| || ||  | || ||||| || |
Sbjct: 2394590 aggcgccgtgcatcgtgttcatcgatgaaatcgacgcggtgggccgtcatcgtggcgccg 2394531

                                                                           
Query: 128     gaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgg 187
               | ||||| || || ||||| ||| | ||||||||| | |||||| ||||    |||||||
Sbjct: 2394530 gcatgggcggcggcaacgacgagcgcgagcagaccctgaaccagatgctggtcgagatgg 2394471

                       
Query: 188     acggcttc 195
               ||||||||
Sbjct: 2394470 acggcttc 2394463



to top

>gb|AC010538.9| Homo sapiens chromosome 16 clone RP11-368I7, complete sequence
          Length = 210031

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 73     ccctgcatcgtcttcatcgacgagattgacgc 104
              ||||||||||||| |||||| ||||| |||||
Sbjct: 209158 ccctgcatcgtctacatcgatgagatcgacgc 209127



to top

>gb|AF259761.1| Ovis aries microsatellite MNS-89 sequence
          Length = 995

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 606 tgccctgatgcctgaatatg 625
           ||||||||||||||||||||
Sbjct: 798 tgccctgatgcctgaatatg 817



to top

>emb|Y16610.1|HSPARAPLE Homo sapiens mRNA for paraplegin
          Length = 3087

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1216 ccctgcatcgtctacatcgatgagatcgacgc 1247



to top

>gb|AE008912.1| Salmonella typhimurium LT2, section 216 of 220 of the complete genome
          Length = 20216

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 607  gccctgatgcctgaatatga 626
            ||||||||||||||||||||
Sbjct: 4815 gccctgatgcctgaatatga 4796



to top

>emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment 6/24
          Length = 321950

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 83   tcttcatcgacgagattgacgccgtcgg 110
            ||||||| |||||||||||||| |||||
Sbjct: 9440 tcttcattgacgagattgacgcagtcgg 9467



to top

>gb|BC036104.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), transcript variant 1, mRNA (cDNA
            clone MGC:33917 IMAGE:5274587), complete cds
          Length = 3091

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1219 ccctgcatcgtctacatcgatgagatcgacgc 1250



to top

>emb|AL627284.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
            complete chromosome; segment 20/20
          Length = 88037

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 607  gccctgatgcctgaatatga 626
            ||||||||||||||||||||
Sbjct: 3877 gccctgatgcctgaatatga 3858



to top

>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20
          Length = 119407

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   tgagaagaagaatgcagttg 547
             ||||||||||||||||||||
Sbjct: 73981 tgagaagaagaatgcagttg 73962



to top

>ref|NM_001002091.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 1b
           (psmc1b), mRNA
          Length = 1521

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 70  gcgccctgcatcgtcttcatcgacgagattgacgcc 105
           ||||||| ||| ||||||||||| ||||| ||||||
Sbjct: 859 gcgccctccattgtcttcatcgatgagatagacgcc 894



to top

>gb|AC114900.26| Ustilago hordei strain 4875-4 clone uhobac-2b7, complete sequence
          Length = 100829

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 78    catcgtcttcatcgacgagattgacgcc 105
             |||| |||||||||||||||| ||||||
Sbjct: 77823 catcatcttcatcgacgagatcgacgcc 77796



to top

>emb|CR609511.1| full-length cDNA clone CS0DL005YD01 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 2234

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   ccctgcatcgtcttcatcgacgagattgacgc 104
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1216 ccctgcatcgtctacatcgatgagatcgacgc 1247



to top

>gb|AF236051.1| California sea lion herpesvirus terminase gene, partial cds
          Length = 448

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 558 gaagaggaagcttgtggctt 577
           ||||||||||||||||||||
Sbjct: 109 gaagaggaagcttgtggctt 90



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                           
Query: 247     cttgactccgcgcttctgcggccagggcggttcgatcggcaggt 290
               |||||||||||| | |||||||| || || ||||| ||||||||
Sbjct: 2168295 cttgactccgcgttgctgcggccgggccgcttcgaccggcaggt 2168338



to top

>gb|AY093262.1| Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds
          Length = 1169

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 528 tgagaagaagaatgcagttg 547
           ||||||||||||||||||||
Sbjct: 884 tgagaagaagaatgcagttg 903



to top

>gb|AY062478.1| Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds
          Length = 1397

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 528  tgagaagaagaatgcagttg 547
            ||||||||||||||||||||
Sbjct: 1089 tgagaagaagaatgcagttg 1108



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 83      tcttcatcgacgagattgacgccgtcgg 110
               ||||||||||||| || |||||||||||
Sbjct: 1288491 tcttcatcgacgaaatcgacgccgtcgg 1288518



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 164    ttaaccagctgctcacggagatggacgg 191
              |||||||||||||| || ||||||||||
Sbjct: 952336 ttaaccagctgctcgcgaagatggacgg 952309



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 77     gcatcgtcttcatcgacgagattgacgc 104
              |||| ||||||||||||||||| |||||
Sbjct: 614604 gcatagtcttcatcgacgagatcgacgc 614631



to top

>gb|AF080518.1|HSSPGSC08 Homo sapiens paraplegin (SPG7) gene, exons 8 and 9
          Length = 1068

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 73  ccctgcatcgtcttcatcgacgagattgacgc 104
           ||||||||||||| |||||| ||||| |||||
Sbjct: 815 ccctgcatcgtctacatcgatgagatcgacgc 846



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 76      tgcatcgtcttcatcgacgagattgacgccgt 107
               |||||| ||||||||||||| || ||||||||
Sbjct: 1188361 tgcatcatcttcatcgacgaaatcgacgccgt 1188392



to top

>gb|AF193618.1|AF193618 California sea lion herpesvirus terminase gene, partial cds
          Length = 375

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 558 gaagaggaagcttgtggctt 577
           ||||||||||||||||||||
Sbjct: 36  gaagaggaagcttgtggctt 17



to top

>emb|BX822250.1|CNS0A70P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB23ZB02 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1400

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 528  tgagaagaagaatgcagttg 547
            ||||||||||||||||||||
Sbjct: 1044 tgagaagaagaatgcagttg 1063



to top

>emb|BX824565.1|CNS0A4VO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH56ZE10 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1499

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 528  tgagaagaagaatgcagttg 547
            ||||||||||||||||||||
Sbjct: 1056 tgagaagaagaatgcagttg 1075



to top

>gb|AE004548.1| Pseudomonas aeruginosa PAO1, section 109 of 529 of the complete
            genome
          Length = 10054

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  tcatcgtgctcgccgcgacc 231
            ||||||||||||||||||||
Sbjct: 8703 tcatcgtgctcgccgcgacc 8722



to top

>ref|XM_345541.2| PREDICTED: Rattus norvegicus similar to Ubiquitin carboxyl-terminal
           hydrolase isozyme L3 (UCH-L3) (Ubiquitin thiolesterase
           L3) (LOC366382), mRNA
          Length = 687

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 549 ttcagaacagaagaggaagc 568
           ||||||||||||||||||||
Sbjct: 199 ttcagaacagaagaggaagc 218



to top

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 263    tgcggccagggcggttcgatcggcaggt 290
              |||||||||| ||||||||||| |||||
Sbjct: 697074 tgcggccaggacggttcgatcgccaggt 697101



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                      
Query: 571    gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatga 626
              |||||||||||||| ||||| || ||| | || |||||  |||||||||| |||||
Sbjct: 472337 gtggcttaccatgaagctggccacgccttggtgggtgctttgatgcctgattatga 472392



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                          
Query: 64     gccaaggcgccctgcatcgtcttcatcgacgagattgacgccgt 107
              ||||| || ||||| |||||||||||||| || ||||| |||||
Sbjct: 471830 gccaatgctccctgtatcgtcttcatcgatgaaattgatgccgt 471873


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,895,427
Number of Sequences: 3902068
Number of extensions: 4895427
Number of successful extensions: 90889
Number of sequences better than 10.0: 261
Number of HSP's better than 10.0 without gapping: 260
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 85889
Number of HSP's gapped (non-prelim): 4998
length of query: 630
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 607
effective length of database: 17,143,297,704
effective search space: 10405981706328
effective search space used: 10405981706328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top