Clone Name	baal41n02
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, compl...	1354	0.0
2	emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase	1346	0.0
3	gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, p...	1239	0.0
4	emb|Z99634.1|SCCATALAS Secale cereale mRNA for catalase (cat2 gene)	985	0.0
5	dbj|AK100019.1| Oryza sativa (japonica cultivar-group) cDNA clon...	839	0.0
6	dbj|AK069446.1| Oryza sativa (japonica cultivar-group) cDNA clon...	839	0.0
7	dbj|D26484.1|RICPOSCATB Oryza sativa (japonica cultivar-group) m...	831	0.0
8	gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRN...	823	0.0
9	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	779	0.0
10	dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic D...	779	0.0
11	dbj|D64013.1| Oryza sativa (japonica cultivar-group) CatB gene f...	771	0.0
12	gb|AY103601.1| Zea mays PCO144994 mRNA sequence	664	0.0
13	gb|AF475100.1| Triticum aestivum catalase isozyme mRNA, partial cds	660	0.0
14	emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (E...	648	0.0
15	gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence	632	e-178
16	gb|U16132.1|HVU16132 Hordeum vulgare catalase mRNA, partial cds	630	e-177
17	emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1	557	e-155
18	ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalas...	230	5e-57
19	ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); cata...	230	5e-57
20	gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090...	230	5e-57
21	gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090...	230	5e-57
22	gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.1...	230	5e-57
23	gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, c...	216	7e-53
24	emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase	214	3e-52
25	gb|AY641732.1| Camellia sinensis catalase mRNA, partial cds	208	2e-50
26	emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ...	176	6e-41
27	emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA...	176	6e-41
28	emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA...	176	6e-41
29	emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit ...	157	6e-35
30	emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 ...	149	1e-32
31	gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, comple...	149	1e-32
32	ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalas...	147	6e-32
33	gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, comple...	147	6e-32
34	gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence	147	6e-32
35	gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds	147	6e-32
36	emb|X94447.1|ATCATAL A.thaliana cat gene for catalase	147	6e-32
37	gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630...	147	6e-32
38	gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA...	147	6e-32
39	gb|AY170463.1| Morus alba catalase (CAT1) mRNA, partial cds	141	4e-30
40	gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA...	139	1e-29
41	gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, ...	139	1e-29
42	gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds	135	2e-28
43	emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 ...	135	2e-28
44	gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds	129	1e-26
45	emb|Z99633.1|SACATALAS Soldanella alpina mRNA for catalase (cat1...	127	5e-26
46	gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catala...	127	5e-26
47	gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, comp...	127	5e-26
48	emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8	125	2e-25
49	gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, com...	125	2e-25
50	gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, com...	123	8e-25
51	emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subun...	119	1e-23
52	emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 ...	117	5e-23
53	emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, par...	117	5e-23
54	gb|AF151368.1|AF151368 Hevea brasiliensis catalase (cat) mRNA, c...	117	5e-23
55	gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds	115	2e-22
56	gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds	113	8e-22
57	gb|AY987854.1| Euphorbia characias catalase mRNA, complete cds	113	8e-22
58	gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, co...	113	8e-22
59	emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 ...	111	3e-21
60	gb|AF443179.1|AF443179 Nicotiana tabacum catalase mRNA, partial cds	111	3e-21
61	dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds	111	3e-21
62	gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, com...	109	1e-20
63	gb|AF243518.1|AF243518 Helianthus annuus catalase 3 (CATA3) mRNA...	109	1e-20
64	ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalas...	107	5e-20
65	ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalas...	107	5e-20
66	ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata...	107	5e-20
67	ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata...	107	5e-20
68	ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata...	107	5e-20
69	gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, comp...	107	5e-20
70	gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, comp...	107	5e-20
71	emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Co...	107	5e-20
72	gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana...	107	5e-20
73	gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana...	107	5e-20
74	gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, c...	105	2e-19
75	emb|AJ302710.1|BPE302710 Betula pendula partial mRNA for catalas...	103	8e-19
76	gb|AY338958.1| Cucumis sativus catalase-like (cat) mRNA, partial...	101	3e-18
77	gb|AY162277.1| Prunus armeniaca catalase1 (CAT1) mRNA, partial cds	101	3e-18
78	emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catal...	100	1e-17
79	emb|AJ295295.1|BPE295295 Betula pendula partial mRNA for catalas...	100	1e-17
80	emb|AJ538651.1|NTA538651 Nicotiana tabacum cDNA-AFLP-fragment BC...	100	1e-17
81	gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, com...	100	1e-17
82	gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, com...	100	1e-17
83	gb|U43147.1|ATU43147 Arabidopsis thaliana catalase 3 (CAT3) gene...	100	1e-17
84	gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) an...	100	1e-17
85	dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds	100	1e-17
86	emb|Z12021.1|GMCATALG G.max gene for catalase	96	2e-16
87	gb|AF295641.1| Beta vulgaris catalase (cat) mRNA, partial cds	96	2e-16
88	gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complet...	96	2e-16
89	gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete s...	94	7e-16
90	dbj|D63384.1|CUSCA Cucumis sativus mRNA for catalase, partial cd...	94	7e-16
91	gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds	92	3e-15
92	dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete...	90	1e-14
93	emb|X60169.1|PSCATAL Pisum sativum mRNA for catalase	88	5e-14
94	gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial...	88	5e-14
95	gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complet...	88	5e-14
96	gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complet...	88	5e-14
97	gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRN...	88	5e-14
98	gb|DQ226689.1| Boechera divaricarpa isolate SLW-348-443-G06 mRNA...	86	2e-13
99	gb|DQ124022.1| Coffea arabica clone MN-SSH2-H06 mRNA sequence	86	2e-13
100	gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complet...	86	2e-13
101	gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds	82	3e-12
102	emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8	78	4e-11
103	emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1...	78	4e-11
104	dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1,...	76	2e-10
105	gb|AY726007.1| Petunia x hybrida catalase gene, partial cds	74	7e-10
106	emb|AJ973128.1| Andrographis paniculata partial cat gene for put...	74	7e-10
107	emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2	74	7e-10
108	emb|AJ299450.1|PPI299450 Pinus pinea partial mRNA for catalase 1...	74	7e-10
109	emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene	74	7e-10
110	gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, ...	74	7e-10
111	gb|AY110648.1| Zea mays CL1739_1 mRNA sequence	74	7e-10
112	gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1...	74	7e-10
113	gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1...	74	7e-10
114	gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end	74	7e-10
115	ref|XM_470174.1| Oryza sativa (japonica cultivar-group), predic...	70	1e-08
116	gb|AF332973.2| Zantedeschia aethiopica catalase 2 (Cat2) mRNA, c...	70	1e-08
117	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	70	1e-08
118	gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase m...	70	1e-08
119	gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome...	70	1e-08
120	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	70	1e-08
121	dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	1e-08
122	dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	1e-08
123	dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds	70	1e-08
124	dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene f...	70	1e-08
125	gb|AF139539.2|AF139539 Raphanus sativus catalase 3 (Cat3) mRNA, ...	68	4e-08
126	dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone...	68	4e-08
127	gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C m...	66	2e-07
128	gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, comp...	66	2e-07
129	gb|AF096252.1|AF096252 Lycopersicon esculentum ethylene-responsi...	66	2e-07
130	gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA...	66	2e-07
131	gb|AF170272.1|AF170272 Manihot esculenta catalase CAT1 mRNA, com...	64	7e-07
132	gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, part...	64	7e-07
133	gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ...	62	3e-06
134	emb|AJ005939.1|MBA005939 Methanosarcina barkeri kat gene	62	3e-06
135	gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid bindin...	62	3e-06
136	gb|AF069320.1|AF069320 Mesembryanthemum crystallinum root catala...	62	3e-06
137	gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase...	62	3e-06
138	gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA,...	62	3e-06
139	dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds	62	3e-06
140	emb|AJ616025.1| Homogyne alpina mRNA for catalase (cat1 gene)	60	1e-05
141	gb|DQ004737.1| Phaseolus lunatus catalase (CAT1) mRNA, partial cds	60	1e-05
142	gb|AY507670.1| Malus x domestica catalase (CAT) mRNA, partial cds	58	4e-05
143	gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, com...	58	4e-05
144	emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 ...	56	2e-04
145	gb|U89384.1|PAU89384 Pseudomonas aeruginosa paraquat inducible c...	54	6e-04
146	gb|U34896.1|PAU34896 Pseudomonas aeruginosa catalase (katB) gene...	54	6e-04
147	emb|Y13220.1|CRCATALAS Chlamydomonas reinhardtii mRNA for catalase	52	0.003
148	gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA...	52	0.003
149	gb|AF016902.1|AF016902 Chlamydomonas reinhardtii catalase (CAT) ...	52	0.003
150	gb|BC051626.1| Danio rerio catalase, mRNA (cDNA clone MGC:56675 ...	50	0.010
151	gb|AF170069.1| Danio rerio catalase mRNA, complete cds	50	0.010
152	emb|AJ007505.1|DRE7505 Danio rerio mRNA for catalase	50	0.010
153	gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome	50	0.010
154	emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (par...	50	0.010
155	emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene)	50	0.010
156	ref|NM_130912.1| Danio rerio catalase (cat), mRNA	50	0.010
157	ref|XM_365841.1| Magnaporthe grisea 70-15 hypothetical protein (...	48	0.040
158	emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase	48	0.040
159	ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.16
160	ref|XM_463869.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.16
161	ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.16
162	gb|DQ493908.1| Anguilla anguilla catalase mRNA, partial cds	46	0.16
163	gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome	46	0.16
164	emb|Z99108.2|BSUB0005 Bacillus subtilis complete genome (section...	46	0.16
165	emb|Z82044.1|BSZ82044 Bacillus subtilis 25 kb genomic DNA segmen...	46	0.16
166	emb|Z54143.2|SSCATMR Secale cereale mRNA for catalase (cat1a gene)	46	0.16
167	emb|X97673.1|XOKATX X.oryzae katX gene	46	0.16
168	emb|X61626.1|OSCATAL O.sativa mRNA for catalase	46	0.16
169	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	46	0.16
170	gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds	46	0.16
171	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.16
172	gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds	46	0.16
173	dbj|AB046412.1| Bacillus subtilis katA gene for catalase, comple...	46	0.16
174	gb|AE004875.1| Pseudomonas aeruginosa PAO1, section 436 of 529 o...	46	0.16
175	dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic D...	46	0.16
176	dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D...	46	0.16
177	emb|AJ234404.1|HVU234404 Hordeum vulgare partial mRNA; clone cMW...	46	0.16
178	dbj|AK099923.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.16
179	dbj|AK099231.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.16
180	emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl...	46	0.16
181	dbj|AK065094.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.16
182	gb|CP000009.1| Gluconobacter oxydans 621H, complete genome	46	0.16
183	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	46	0.16
184	gb|AF021939.1|AF021939 Hordeum vulgare catalase 2 (CAT2) gene, p...	46	0.16
185	gb|U20778.1|HVU20778 Hordeum vulgare catalase (Cat2) mRNA, compl...	46	0.16
186	gb|M80796.1|BACDNA Bacillus subtilis vegetative catalase (kat-19...	46	0.16
187	gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, compl...	46	0.16
188	dbj|D29966.1|RICCA Rice CatA gene for catalase, complete cds	46	0.16
189	gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-...	44	0.62
190	gb|CP000001.1| Bacillus cereus E33L, complete genome	44	0.62
191	emb|X05549.1|IBCATR Seet potato mRNA for catalase (EC 1.11.1.6)	44	0.62
192	gb|AY159321.1| Simian immunodeficiency virus isolate SIVdrl1FAO,...	44	0.62
193	gb|U64156.1|HIVU64156 HIV-1 isolate MM351 from Australia, revers...	44	0.62
194	gb|AY433680.1| Aedes aegypti ASAP ID: 37745 catalase mRNA sequence	42	2.4
195	gb|DQ440117.1| Aedes aegypti clone AE-5918 catalase mRNA, partia...	42	2.4
196	gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl...	42	2.4
197	gb|AC115122.4| Mus musculus BAC clone RP24-108L20 from chromosom...	42	2.4
198	gb|AY802593.1| HIV-1 isolate CA10424 from USA reverse transcript...	42	2.4
199	gb|AY802587.1| HIV-1 isolate CA4230 from USA reverse transcripta...	42	2.4
200	gb|AE012515.1| Xanthomonas campestris pv. campestris str. ATCC 3...	42	2.4
201	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	42	2.4
202	gb|DQ024058.1| HIV-1 isolate mA142 from Martinique reverse trans...	42	2.4
203	gb|AF260737.1|AF260737 Cucurbita pepo catalase mRNA, partial cds	42	2.4
204	gb|AF155110.1|AF155110 Homo sapiens NY-REN-45 antigen mRNA, comp...	42	2.4
205	gb|AC148978.3| Mus musculus BAC clone RP23-359K8 from 14, comple...	42	2.4
206	gb|AY365745.1| HIV-1 isolate 106239 from Argentina pol protein (...	42	2.4
207	dbj|D55647.1|CUCCAT3 Pumpkin mRNA for catalase (cat3), complete cds	42	2.4
208	gb|DQ025189.1| HIV-1 isolate pE90394 from Puerto Rico reverse tr...	40	9.6
209	gb|DQ025104.1| HIV-1 isolate pE85105 from Puerto Rico reverse tr...	40	9.6
210	ref|NM_194840.1| Oryza sativa (japonica cultivar-group) putative...	40	9.6
211	gb|AY603335.1| Haemonchus contortus catalase mRNA, complete cds	40	9.6
212	gb|AY701391.1| HIV-1 isolate RW0550 from USA reverse transcripta...	40	9.6
213	gb|AY388831.1| HIV-1 from USA isolate P00046 nonfunctional pol p...	40	9.6
214	gb|AY388830.1| HIV-1 from USA isolate P00046 nonfunctional pol p...	40	9.6
215	gb|AY388829.1| HIV-1 from USA isolate P00046 nonfunctional pol p...	40	9.6
216	gb|AY362104.1| HIV-1 isolate 111925 from United Kingdom pol prot...	40	9.6
217	gb|AY362101.1| HIV-1 isolate 134795 from United Kingdom pol prot...	40	9.6
218	gb|AY362100.1| HIV-1 isolate 134284 from United Kingdom pol prot...	40	9.6
219	gb|AY316083.1| HIV-1 from Spain isolate 67.00 pol protein (pol) ...	40	9.6
220	gb|AY471869.1| HIV-1 isolate 206140 from USA pol protein (pol) g...	40	9.6
221	gb|AY528204.1| HIV-1 isolate A0387 from USA pol protein (pol) ge...	40	9.6
222	gb|AY528203.1| HIV-1 isolate A0386 from USA pol protein (pol) ge...	40	9.6
223	gb|AY528202.1| HIV-1 isolate A0385 from USA pol protein (pol) ge...	40	9.6
224	gb|AY527896.1| HIV-1 isolate A0079 from USA pol protein (pol) ge...	40	9.6
225	gb|AY527895.1| HIV-1 isolate A0078 from USA pol protein (pol) ge...	40	9.6
226	gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com...	40	9.6
227	gb|AY149565.1| HIV-1 isolate DK.IM.123-f.RT reverse transcriptas...	40	9.6
228	gb|AY275769.1| HIV-1 isolate 128PR_RT from Brazil pol protein (p...	40	9.6
229	gb|AY815698.1| Schistosoma japonicum SJCHGC08499 protein mRNA, c...	40	9.6
230	gb|AY334713.1| HIV-1 isolate 51581.f from Puerto Rico pol protei...	40	9.6
231	gb|AY580245.1| Metridium senile catalase mRNA, partial cds	40	9.6
232	gb|AY580238.1| Obelia sp. KJP-2004 catalase mRNA, partial cds	40	9.6
233	gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp...	40	9.6
234	gb|AY714472.1| HIV-1 isolate F56706_RT from USA reverse transcri...	40	9.6
235	gb|AY714470.1| HIV-1 from USA reverse transcriptase (Pol) gene, ...	40	9.6
236	gb|AY714434.1| HIV-1 isolate F74928_RT from USA reverse transcri...	40	9.6
237	ref|XM_742595.1| Aspergillus fumigatus Af293 catalase A (Afu6g03...	40	9.6
238	gb|AY165273.1| HIV-1 isolate 01SE-22264 from Sweden gag-pol fusi...	40	9.6
239	gb|AY378080.1| Tetrahymena thermophila putative catalase (CAT) m...	40	9.6
240	gb|DQ157817.1| HIV-1 isolate PE.5895 from Peru protease (pol) ge...	40	9.6
241	emb|AL606504.14| Human DNA sequence from clone RP11-358K2 on chr...	40	9.6
242	gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl...	40	9.6
243	gb|AF454535.1| HIV-1 isolate 66936VI from Czech Republic reverse...	40	9.6
244	gb|AY213503.1| HIV-1 isolate BRP2177RT from Brazil reverse trans...	40	9.6
245	gb|AY213272.1| HIV-1 isolate BRRJ917RT from Brazil reverse trans...	40	9.6
246	gb|AY260398.1| HIV-1 isolate 213 from France reverse transcripta...	40	9.6
247	gb|AY260380.1| HIV-1 isolate 195 from France reverse transcripta...	40	9.6
248	gb|AY075969.1| HIV-1 isolate 91USG191814pc2 from USA pol polypro...	40	9.6
249	gb|DQ087444.1| Cerebratulus lacteus catalase mRNA, partial cds	40	9.6
250	gb|AY877247.1| HIV-1 isolate BR02SP167 from Brazil reverse trans...	40	9.6
251	gb|AY877199.1| HIV-1 isolate BR02SP183 from Brazil reverse trans...	40	9.6
252	gb|DQ455125.1| Medicago truncatula cDNA-AFLP fragment BC21M31_53...	40	9.6
253	emb|AL596129.27| Mouse DNA sequence from clone RP23-294E23 on ch...	40	9.6
254	gb|DQ059651.1| HIV-1 isolate TV811 from Canada reverse transcrip...	40	9.6
255	emb|AJ419504.1|HIM419504 Human immunodeficiency virus type 1 par...	40	9.6
256	emb|AJ419503.1|HIM419503 Human immunodeficiency virus type 1 par...	40	9.6
257	gb|AY801196.1| HIV-1 isolate CA34461 from USA reverse transcript...	40	9.6
258	gb|AY801175.1| HIV-1 isolate CA48112 from USA reverse transcript...	40	9.6
259	gb|AY801006.1| HIV-1 isolate CA9339 from USA reverse transcripta...	40	9.6
260	gb|AY800826.1| HIV-1 isolate CA38923 from USA reverse transcript...	40	9.6
261	gb|AY800825.1| HIV-1 isolate CA23866 from USA reverse transcript...	40	9.6
262	gb|AY802331.1| HIV-1 isolate CA34658 from USA reverse transcript...	40	9.6
263	gb|AY802716.1| HIV-1 isolate CA34319 from USA reverse transcript...	40	9.6
264	gb|AY802695.1| HIV-1 isolate CA38099 from USA reverse transcript...	40	9.6
265	gb|AY802638.1| HIV-1 isolate CA9908 from USA reverse transcripta...	40	9.6
266	gb|AY802637.1| HIV-1 isolate CA9945 from USA reverse transcripta...	40	9.6
267	gb|AY802261.1| HIV-1 isolate CA42734 from USA reverse transcript...	40	9.6
268	gb|AY802088.1| HIV-1 isolate CA41281 from USA reverse transcript...	40	9.6
269	gb|AY802087.1| HIV-1 isolate CA23850 from USA reverse transcript...	40	9.6
270	gb|AY802072.1| HIV-1 isolate CA48146 from USA reverse transcript...	40	9.6
271	gb|AY802071.1| HIV-1 isolate CA37957 from USA reverse transcript...	40	9.6
272	gb|AY802070.1| HIV-1 isolate CA37955 from USA reverse transcript...	40	9.6
273	gb|AY802069.1| HIV-1 isolate CA48556 from USA reverse transcript...	40	9.6
274	gb|AY802068.1| HIV-1 isolate CA34970 from USA reverse transcript...	40	9.6
275	gb|AY802067.1| HIV-1 isolate CA23736 from USA reverse transcript...	40	9.6
276	gb|AY802028.1| HIV-1 isolate CA48162 from USA reverse transcript...	40	9.6
277	gb|AY802027.1| HIV-1 isolate CA38013 from USA reverse transcript...	40	9.6
278	gb|AY802026.1| HIV-1 isolate CA34332 from USA reverse transcript...	40	9.6
279	gb|AY802025.1| HIV-1 isolate CA21221 from USA reverse transcript...	40	9.6
280	gb|AY801890.1| HIV-1 isolate CA37850 from USA reverse transcript...	40	9.6
281	gb|AY801889.1| HIV-1 isolate CA35213 from USA reverse transcript...	40	9.6
282	gb|AY801888.1| HIV-1 isolate CA20096 from USA reverse transcript...	40	9.6
283	gb|AY801797.1| HIV-1 isolate CA19882 from USA reverse transcript...	40	9.6
284	gb|AY801674.1| HIV-1 isolate CA21206 from USA reverse transcript...	40	9.6
285	gb|AY800715.1| HIV-1 isolate CA1437 from USA reverse transcripta...	40	9.6
286	gb|AF459197.1| HIV-1 isolate patient AD-110 from USA pol protein...	40	9.6
287	gb|AF517515.1| HIV-1 from Italy patient 30, off-therapy group, p...	40	9.6
288	gb|AF517488.1| HIV-1 from Italy patient 30, off-therapy group, p...	40	9.6
289	gb|AF347403.1| HIV-1 isolate 986192 from Germany truncated pol p...	40	9.6
290	gb|AF347367.1| HIV-1 isolate 984898 from Germany pol protein (po...	40	9.6
291	gb|AF347305.1| HIV-1 isolate 974412 from Germany pol protein (po...	40	9.6
292	gb|AF347298.1| HIV-1 isolate 970850 from Germany pol protein (po...	40	9.6
293	gb|AF347279.1| HIV-1 isolate 5483 from Germany pol protein (pol)...	40	9.6
294	gb|AF347208.1| HIV-1 isolate 2570 from Germany truncated pol pro...	40	9.6
295	gb|AF347179.1| HIV-1 isolate 001936-2 from Germany pol protein (...	40	9.6
296	gb|AC135319.28| Medicago truncatula clone mth2-6g4, complete seq...	40	9.6
297	gb|AF357723.1| HIV1 isolate 680046h031998 from USA pol protein (...	40	9.6
298	gb|AF357610.1| HIV1 isolate 280745l022598 from USA pol protein (...	40	9.6
299	dbj|AB213691.1| Human immunodeficiency virus 1 genes for gag-pol...	40	9.6
300	dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple...	40	9.6
301	gb|AC106732.2| Homo sapiens chromosome 5 clone CTD-2275D24, comp...	40	9.6
302	gb|AF480744.1| HIV-1 isolate VT02rt from Brazil reverse transcri...	40	9.6
303	gb|AC074105.3| Oryza sativa chromosome 10 clone OSJNBa0030B02, c...	40	9.6
304	gb|DQ370267.1| HIV-1 isolate 308a-872 from Italy pol protein (po...	40	9.6
305	gb|DQ370204.1| HIV-1 isolate 1406A-2845 from Italy pol protein (...	40	9.6
306	gb|AF360825.1|AF360825 HIV-1 isolate LI75ARG from Argentina reve...	40	9.6
307	gb|AF349318.1|AF349318 HIV-1 isolate RDI002 from USA pol polypro...	40	9.6
308	gb|AF349317.1|AF349317 HIV-1 isolate RDI001 from USA pol polypro...	40	9.6
309	gb|AY042732.1| HIV-1 isolate 36010-32 reverse transcriptase (pol...	40	9.6
310	gb|AY042731.1| HIV-1 isolate 36010-0 reverse transcriptase (pol)...	40	9.6
311	gb|AY032506.1| HIV-1 isolate NC6600-2000 from USA pol polyprotei...	40	9.6
312	gb|AY032477.1| HIV-1 isolate NC6571-2000 from USA pol polyprotei...	40	9.6
313	gb|AY032325.1| HIV-1 isolate NC6368-2000 from USA pol polyprotei...	40	9.6
314	gb|AY031902.1| HIV-1 isolate NC5348-1999 from USA pol polyprotei...	40	9.6
315	gb|AY031885.1| HIV-1 isolate NC5331-1999 from USA pol polyprotei...	40	9.6
316	gb|AY031867.1| HIV-1 isolate NC5312-1999 from USA pol polyprotei...	40	9.6
317	gb|AY031838.1| HIV-1 isolate NC5281-1999 from USA pol polyprotei...	40	9.6
318	gb|AY031732.1| HIV-1 isolate NC5166-1999 from USA pol polyprotei...	40	9.6
319	gb|AY031483.1| HIV-1 isolate NC4824-1999 from USA pol polyprotei...	40	9.6
320	gb|AY031315.1| HIV-1 isolate NC4472-1999 from USA pol polyprotei...	40	9.6
321	gb|AY031243.1| HIV-1 isolate NC4385-1999 from USA pol polyprotei...	40	9.6
322	gb|AY031114.1| HIV-1 isolate NC4125-1999 from USA pol polyprotei...	40	9.6
323	gb|AY031017.1| HIV-1 isolate NC4022-1999 from USA pol polyprotei...	40	9.6
324	gb|AY030960.1| HIV-1 isolate NC3962-1998 from USA pol polyprotei...	40	9.6
325	gb|AY030907.1| HIV-1 isolate NC3902-1999 from USA pol polyprotei...	40	9.6
326	gb|AY030854.1| HIV-1 isolate NC2309-1999 from USA pol polyprotei...	40	9.6
327	gb|AY030776.1| HIV-1 isolate NC1872-1998 from USA pol polyprotei...	40	9.6
328	gb|AY030711.1| HIV-1 isolate NC1623-1998 from USA pol polyprotei...	40	9.6
329	gb|AY030556.1| HIV-1 isolate NC1411-1998 from USA pol polyprotei...	40	9.6
330	gb|DQ024658.1| HIV-1 isolate pC58692 from Puerto Rico reverse tr...	40	9.6
331	gb|DQ024489.1| HIV-1 isolate pC49522 from Puerto Rico reverse tr...	40	9.6
332	gb|DQ024345.1| HIV-1 isolate pB39592 from Puerto Rico reverse tr...	40	9.6
333	gb|DQ024294.1| HIV-1 isolate mf057 from Martinique reverse trans...	40	9.6
334	gb|DQ024283.1| HIV-1 isolate mf002 from Martinique reverse trans...	40	9.6
335	gb|DQ024262.1| HIV-1 isolate me267 from Martinique reverse trans...	40	9.6
336	gb|DQ024117.1| HIV-1 isolate mC141 from Martinique reverse trans...	40	9.6
337	gb|DQ023887.1| HIV-1 isolate gD026 from Guadeloupe reverse trans...	40	9.6
338	gb|DQ023807.1| HIV-1 isolate gB213 from Guadeloupe reverse trans...	40	9.6
339	gb|DQ023795.1| HIV-1 isolate gB146 from Guadeloupe reverse trans...	40	9.6
340	gb|AY756840.1| HIV-1 isolate 3086 from Malawi pol protein (pol) ...	40	9.6
341	gb|AF330773.1|AF330773 HIV-1 patient 13 reverse transcriptase (p...	40	9.6
342	emb|AJ577871.1|HIM577871 Human immunodeficiency virus 1 partial ...	40	9.6
343	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
344	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
345	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
346	gb|AF266535.1|AF266535 HIV-1 clone L092RT from Italy reverse tra...	40	9.6
347	gb|AF301318.1|AF301318 HIV-1 clone AA1295 from USA reverse trans...	40	9.6
348	gb|AF301298.1|AF301298 HIV-1 clone AA0409 from USA reverse trans...	40	9.6
349	gb|AY901796.1| HIV-1 isolate 1211 protease (pol) gene, partial cds	40	9.6
350	gb|AY995449.1| HIV-1 isolate 2209-1044A from Italy pol protein (...	40	9.6
351	gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10...	40	9.6
352	gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23...	40	9.6
353	gb|AF514256.1| HIV-1 isolate 7858-090700 from USA reverse transc...	40	9.6
354	gb|AF514159.1| HIV-1 isolate 3902-012500 from USA reverse transc...	40	9.6
355	gb|AF514150.1| HIV-1 isolate 2309-111699 from USA reverse transc...	40	9.6
356	gb|AF514009.1| HIV-1 isolate 796-011999 from USA reverse transcr...	40	9.6
357	gb|AF456533.1| HIV-1 isolate AR15800 from Argentina pol protein ...	40	9.6
358	gb|AY003331.1| HIV-1 isolate 066F04 from USA pol protein (pol) g...	40	9.6
359	gb|AY000467.1| HIV-1 isolate 038G10 from USA pol protein (pol) g...	40	9.6
360	gb|AY000466.1| HIV-1 isolate 072E07 from USA pol protein (pol) g...	40	9.6
361	gb|AY000465.1| HIV-1 isolate 088B02 from USA pol protein (pol) g...	40	9.6
362	gb|AY000464.1| HIV-1 isolate 062D07 from USA pol protein (pol) g...	40	9.6
363	gb|AY000463.1| HIV-1 isolate 062D03 from USA pol protein (pol) g...	40	9.6
364	gb|AY000462.1| HIV-1 isolate 038G05 from USA pol protein (pol) g...	40	9.6
365	gb|AY000461.1| HIV-1 isolate 062D02 from USA pol protein (pol) g...	40	9.6
366	gb|AY000459.1| HIV-1 isolate 072E04 from USA pol protein (pol) g...	40	9.6
367	gb|AY000458.1| HIV-1 isolate 088A09 from USA pol protein (pol) g...	40	9.6
368	gb|AY000456.1| HIV-1 isolate 072E02 from USA pol protein (pol) g...	40	9.6
369	gb|AY000455.1| HIV-1 isolate 079C03 from USA pol protein (pol) g...	40	9.6
370	gb|AY000448.1| HIV-1 isolate 079C01 from USA pol protein (pol) g...	40	9.6
371	gb|AY000441.1| HIV-1 isolate 088B06 from USA pol protein (pol) g...	40	9.6
372	gb|AY000439.1| HIV-1 isolate 062D04 from USA pol protein (pol) g...	40	9.6
373	gb|AY000438.1| HIV-1 isolate 088A03 from USA pol protein (pol) g...	40	9.6
374	gb|AY000435.1| HIV-1 isolate 088B09 from USA pol protein (pol) g...	40	9.6
375	gb|AY000434.1| HIV-1 isolate 088B08 from USA pol protein (pol) g...	40	9.6
376	gb|AY000433.1| HIV-1 isolate 088B05 from USA pol protein (pol) g...	40	9.6
377	gb|AY000432.1| HIV-1 isolate 062D05 from USA pol protein (pol) g...	40	9.6
378	gb|AY000429.1| HIV-1 isolate 038G12 from USA pol protein (pol) g...	40	9.6
379	gb|AY000428.1| HIV-1 isolate 038G11 from USA pol protein (pol) g...	40	9.6
380	gb|AY000427.1| HIV-1 isolate 038G08 from USA pol protein (pol) g...	40	9.6
381	gb|AY000426.1| HIV-1 isolate 038G04 from USA pol protein (pol) g...	40	9.6
382	gb|AY000425.1| HIV-1 isolate 038G03 from USA pol protein (pol) g...	40	9.6
383	gb|AY000424.1| HIV-1 isolate 072E05 from USA pol protein (pol) g...	40	9.6
384	gb|AY000423.1| HIV-1 isolate 062D08 from USA pol protein (pol) g...	40	9.6
385	gb|AY000422.1| HIV-1 isolate 062D01 from USA pol protein (pol) g...	40	9.6
386	gb|AY000421.1| HIV-1 isolate 038G06 from USA pol protein (pol) g...	40	9.6
387	gb|AY102485.1| HIV-1 isolate SU502 from Sudan pol protein (pol) ...	40	9.6
388	gb|AY153945.1| HIV-1 isolate G240 from Thailand reverse transcri...	40	9.6
389	gb|AY153921.1| HIV-1 isolate G212 from Thailand reverse transcri...	40	9.6
390	gb|AF090531.1|AF090531 HIV-1 isolate 260Pt8W8C from USA reverse ...	40	9.6
391	gb|AF090530.1|AF090530 HIV-1 isolate 260Pt8BC from USA reverse t...	40	9.6
392	gb|AF090512.1|AF090512 HIV-1 isolate 260Pt29W8P from USA reverse...	40	9.6
393	gb|AF090511.1|AF090511 HIV-1 isolate 260Pt29BC from USA reverse ...	40	9.6
394	emb|BX293550.6| Zebrafish DNA sequence from clone CH211-276D14 i...	40	9.6
395	dbj|AP003527.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
396	gb|AY441935.1| HIV-1 isolate SP36_00 from Brazil nonfunctional r...	40	9.6
397	dbj|AP005309.5| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
398	dbj|AP006451.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
399	dbj|AP005604.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
400	gb|AY670050.1| HIV-1 isolate 02cl5.24 from United Kingdom pol pr...	40	9.6
401	gb|AY670049.1| HIV-1 isolate 02cl5.23 from United Kingdom pol pr...	40	9.6
402	gb|AY670048.1| HIV-1 isolate 02cl5.22 from United Kingdom pol pr...	40	9.6
403	gb|AY670046.1| HIV-1 isolate 02cl5.20 from United Kingdom pol pr...	40	9.6
404	gb|AY669980.1| HIV-1 isolate 00cl3.9 from United Kingdom pol pro...	40	9.6
405	gb|AY669966.1| HIV-1 isolate 02cl2.57 from United Kingdom pol pr...	40	9.6
406	gb|AY669965.1| HIV-1 isolate 02cl2.56 from United Kingdom pol pr...	40	9.6
407	gb|AY669964.1| HIV-1 isolate 02cl2.55 from United Kingdom pol pr...	40	9.6
408	gb|AY669959.1| HIV-1 isolate 02cl2.50 from United Kingdom pol pr...	40	9.6
409	gb|AY669914.1| HIV-1 isolate 00cl2.5 from United Kingdom pol pro...	40	9.6
410	emb|AJ276532.1|HIM276532 Human immunodeficiency virus type 1 par...	40	9.6
411	emb|AJ425908.1|HIM425908 Human immunodeficiency virus type 1 par...	40	9.6
412	emb|X80505.1|ASEXECD A.salmonicida genes exeC and exeD	40	9.6
413	gb|AF098633.1|AF098633 Mus musculus GLUT4 vesicle protein mRNA, ...	40	9.6
414	emb|AJ332571.1|HSA332571 Homo sapiens genomic sequence surroundi...	40	9.6
415	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	40	9.6
416	gb|AY906963.1| HIV-1 isolate Dj336 from Djibouti nonfunctional p...	40	9.6
417	gb|AY771592.1| HIV-1 isolate BREPM275 from Brazil, complete genome	40	9.6
418	gb|AY771583.1| HIV-1 isolate BREPMPOL275 from Brazil pol protein...	40	9.6
419	gb|AY771531.1| HIV-1 isolate BREPMPOL207 from Brazil pol protein...	40	9.6
420	gb|AY771453.1| HIV-1 isolate BREPMPOL101 from Brazil pol protein...	40	9.6
421	gb|AF101425.1|AF101425 Cichorium intybus catalase mRNA, partial cds	40	9.6
422	gb|AY801640.1| HIV-1 isolate CA17396 from USA reverse transcript...	40	9.6
423	gb|AY802003.1| HIV-1 isolate CA21154 from USA reverse transcript...	40	9.6
424	gb|AY802195.1| HIV-1 isolate CA24527 from USA reverse transcript...	40	9.6
425	gb|AY802196.1| HIV-1 isolate CA34911 from USA reverse transcript...	40	9.6
426	gb|U39841.1|CPU39841 Cavia porcellus catalase mRNA, partial cds	40	9.6
427	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	9.6
428	emb|AL606599.3|OSJN00034 Oryza sativa genomic DNA, chromosome 4,...	40	9.6
429	emb|AL606443.3|OSJN00008 Oryza sativa genomic DNA, chromosome 4,...	40	9.6
430	gb|AY855793.1| HIV-1 isolate 1355-492A from Italy pol protein (p...	40	9.6
431	gb|AY855745.1| HIV-1 isolate 555A from Italy pol protein (pol) g...	40	9.6
432	gb|AY855624.1| HIV-1 isolate 205A from Italy pol protein (pol) g...	40	9.6
433	gb|AY855618.1| HIV-1 isolate 194A from Italy pol protein (pol) g...	40	9.6
434	gb|AC153843.6| Mus musculus 10 BAC RP23-273P15 (Roswell Park Can...	40	9.6
435	gb|U87630.1|AFU87630 Aspergillus fumigatus catalase gene, comple...	40	9.6
436	gb|AY365977.1| HIV-1 isolate 120063 from Argentina pol protein (...	40	9.6
437	gb|AY365716.1| HIV-1 isolate 105048 from Argentina pol protein (...	40	9.6
438	gb|AY365715.1| HIV-1 isolate 105044 from Argentina pol protein (...	40	9.6
439	gb|AY365536.1| HIV-1 isolate 96926 from Argentina pol protein (p...	40	9.6
440	gb|U83329.1|PFU83329 Pseudomonas fluorescens catalase (catB) gen...	40	9.6
441	gb|U64125.1|HIVU64125 HIV-1 isolate DH365 from Australia, revers...	40	9.6
442	gb|U64124.1|HIVU64124 HIV-1 isolate DH321 from Australia, revers...	40	9.6
443	gb|U64123.1|HIVU64123 HIV-1 isolate DH289 from Australia, revers...	40	9.6
444	gb|U64122.1|HIVU64122 HIV-1 isolate DH200 from Australia, revers...	40	9.6
445	gb|DQ089181.1| Capra hircus voucher YP 2860 control region, part...	40	9.6
446	gb|DQ089160.1| Capra hircus voucher YP 2790 control region, part...	40	9.6
447	gb|AF538304.1| HIV-1 clone C24 from Australia gag protein (gag) ...	40	9.6
448	dbj|AB037061.1| Human immunodeficiency virus type 1 RT gene for ...	40	9.6

---

>gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, complete cds
          Length = 1879

 Score = 1354 bits (683), Expect = 0.0
 Identities = 689/691 (99%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 466

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 467  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 526

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 586

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 587  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 646

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 647  gacgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacacctac 706

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 707  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 766

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 767  ggtgtgaagtgcctcttggatgatgaagctgttactgttggaggcacctgccacacccat 826

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 827  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 886

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 946

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 1006

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1007 aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 1066

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            |||||||||||||||||||||||||||||||
Sbjct: 1067 cctggaatccactactctgatgataagctgc 1097

---

>emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase
          Length = 1869

 Score = 1346 bits (679), Expect = 0.0
 Identities = 688/691 (99%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 448  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 507

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 508  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 567

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 568  ttccctgacatggtccatgctttcaagccaagttcgaagaccaacatgcaggagaactgg 627

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 628  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 687

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 688  gacgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacacctac 747

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 807

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 808  ggtgtgaagtgcctcttggatgatgaagctgttactgttggaggcacctgccacacccat 867

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 868  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 927

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 928  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 987

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 988  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 1047

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1048 aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 1107

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            |||||||||||||||||||||||||||||||
Sbjct: 1108 cctggaatccactactctgatgataagctgc 1138

---

>gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, partial cds
          Length = 2130

 Score = 1239 bits (625), Expect = 0.0
 Identities = 631/633 (99%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 488  agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 547

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 548  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 607

                                                                        
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 608  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 667

                                                                        
Query: 252  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 668  ttgacgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacacct 727

                                                                        
Query: 312  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 728  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 787

                                                                        
Query: 372  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 788  gtggtgtgaagtgcctcttggatgatgaagctgttactgttggaggcacctgccacaccc 847

                                                                        
Query: 432  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 848  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 907

                                                                        
Query: 492  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 908  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 967

                                                                        
Query: 552  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 968  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 1027

                                                                        
Query: 612  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1028 agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 1087

                                             
Query: 672  tccctggaatccactactctgatgataagctgc 704
            |||||||||||||||||||||||||||||||||
Sbjct: 1088 tccctggaatccactactctgatgataagctgc 1120



 Score =  121 bits (61), Expect = 3e-24
 Identities = 61/61 (100%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 49  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 108

            
Query: 74  g 74
           |
Sbjct: 109 g 109

---

>emb|Z99634.1|SCCATALAS Secale cereale mRNA for catalase (cat2 gene)
          Length = 809

 Score =  985 bits (497), Expect = 0.0
 Identities = 587/617 (95%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 225

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 285

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 286 cctgacatggtccatgctttcaagccaagtccaaagaccaacatgcaagagaactggaga 345

                                                                       
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
            |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 346 atagttgacttctcttcgcaccacccggagagtctgcacatgttcaccttcctctttgat 405

                                                                       
Query: 257 gatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctacacc 316
           |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| 
Sbjct: 406 gatgttcgcattccactcaactacaggcacatggacggttttggtgtcaacacctacacg 465

                                                                       
Query: 317 ttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgtggt 376
           || |||||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 466 tttatcagcagcgatgggaaggctcacctggttaaattccattggaaacccacatgtggt 525

                                                                       
Query: 377 gtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccatgcc 436
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 526 gtgaagtgcctcttggatgatgatgctgttactgttggaggcacctgccacacccatgcc 585

                                                                       
Query: 437 acaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttcatc 496
           |||||||||||||||||||||||||| ||||||||||||||||  |||||| ||||||| 
Sbjct: 586 acaaaggacttgactgattctattgcggctgggaattacccagtgtggaaggttttcatt 645

                                                                       
Query: 497 cagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaag 556
           |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||
Sbjct: 646 cagaccgttgatgctgatcatgaggataaatttgactttgaccctcttgatgtcaccaag 705

                                                                       
Query: 557 acctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaac 616
           |||||||||||||| ||||||| |||||||||||||||||||||||| || |||||||||
Sbjct: 706 acctggccagaggatatcatccaactgcaaccagttggacggatggtgctcaacaagaac 765

                            
Query: 617 attgacaatttcttcgc 633
           || || |||||||||||
Sbjct: 766 atcgataatttcttcgc 782

---

>dbj|AK100019.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013145C05, full
            insert sequence
          Length = 1877

 Score =  839 bits (423), Expect = 0.0
 Identities = 624/691 (90%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||  | |||||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 524  ggaagccctgagacattgagggatccacgtggttttgctgtcaagttttacactagagag 583

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 584  ggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatgaaa 643

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 644  ttccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaactgg 703

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |||
Sbjct: 704  agaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctcttt 763

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 764  gacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacctac 823

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |||
Sbjct: 824  accctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacctgt 883

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||||
Sbjct: 884  ggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagccat 943

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||| |
Sbjct: 944  gccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagctttac 1003

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||||
Sbjct: 1004 atccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtcacc 1063

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||| 
Sbjct: 1064 aagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaacaaa 1123

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||||
Sbjct: 1124 aacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattgtc 1183

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            ||||||||||| |||||||||||||||||||
Sbjct: 1184 cctggaatccattactctgatgataagctgc 1214

---

>dbj|AK069446.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019H14, full
            insert sequence
          Length = 1898

 Score =  839 bits (423), Expect = 0.0
 Identities = 624/691 (90%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||  | |||||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 436  ggaagccctgagacattgagggatccacgtggttttgctgtcaagttttacactagagag 495

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 496  ggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatgaaa 555

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 556  ttccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaactgg 615

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |||
Sbjct: 616  agaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctcttt 675

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 676  gacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacctac 735

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |||
Sbjct: 736  accctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacctgt 795

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||||
Sbjct: 796  ggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagccat 855

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||| |
Sbjct: 856  gccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagctttac 915

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||||
Sbjct: 916  atccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtcacc 975

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||| 
Sbjct: 976  aagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaacaaa 1035

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||||
Sbjct: 1036 aacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattgtc 1095

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            ||||||||||| |||||||||||||||||||
Sbjct: 1096 cctggaatccattactctgatgataagctgc 1126

---

>dbj|D26484.1|RICPOSCATB Oryza sativa (japonica cultivar-group) mRNA for catalase, complete
            cds
          Length = 1832

 Score =  831 bits (419), Expect = 0.0
 Identities = 623/691 (90%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||  | |||||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 461  ggaagccctgagacattgagggatccacgtggttttgctgtcaagttttacactagagag 520

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            ||||| ||||| ||||||||||||||||||||||  ||||||||||||||||||||||| 
Sbjct: 521  ggtaattttgatcttgttgggaacaatatgcctggcttttttatccgagatgggatgaaa 580

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 581  ttccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaactgg 640

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |||
Sbjct: 641  agaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctcttt 700

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 701  gacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacctac 760

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |||
Sbjct: 761  accctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacctgt 820

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||||
Sbjct: 821  ggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagccat 880

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||| |
Sbjct: 881  gccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagctttac 940

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||||
Sbjct: 941  atccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtcacc 1000

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||| 
Sbjct: 1001 aagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaacaaa 1060

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||||
Sbjct: 1061 aacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattgtc 1120

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            ||||||||||| |||||||||||||||||||
Sbjct: 1121 cctggaatccattactctgatgataagctgc 1151

---

>gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRNA, complete cds
          Length = 1479

 Score =  823 bits (415), Expect = 0.0
 Identities = 622/691 (90%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            |||||| |||||||  | |||||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 331  ggaagctctgagacattgagggatccacgtggttttgctgtcaagttttacactagagag 390

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 391  ggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatgaaa 450

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 451  ttccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaactgg 510

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |||
Sbjct: 511  agaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctcttt 570

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 571  gacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacctac 630

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |||
Sbjct: 631  accctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacctgt 690

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||||
Sbjct: 691  ggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagccat 750

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            ||||| ||||||||||||||||||||||||||  ||||||||||||| |||||||||| |
Sbjct: 751  gccacgaaggacttgactgattctattgcagcaaggaattacccagagtggaagctttac 810

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||||
Sbjct: 811  atccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtcacc 870

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||| 
Sbjct: 871  aagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaacaaa 930

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||||
Sbjct: 931  aacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattgtc 990

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            ||||||||||| |||||||||||||||||||
Sbjct: 991  cctggaatccattactctgatgataagctgc 1021

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  779 bits (393), Expect = 0.0
 Identities = 573/633 (90%)
 Strand = Plus / Plus

                                                                            
Query: 72       agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
                ||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 30430254 agggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatga 30430313

                                                                            
Query: 132      agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
                | ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 30430314 aattccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaact 30430373

                                                                            
Query: 192      ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
                ||||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |
Sbjct: 30430374 ggagaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctct 30430433

                                                                            
Query: 252      ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
                |||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 30430434 ttgacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacct 30430493

                                                                            
Query: 312      acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
                ||||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |
Sbjct: 30430494 acaccctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacct 30430553

                                                                            
Query: 372      gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
                ||||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||
Sbjct: 30430554 gtggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagcc 30430613

                                                                            
Query: 432      atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
                ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 30430614 atgccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagcttt 30430673

                                                                            
Query: 492      tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
                 ||||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||
Sbjct: 30430674 acatccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtca 30430733

                                                                            
Query: 552      ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
                ||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 30430734 ccaagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaaca 30430793

                                                                            
Query: 612      agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
                | |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||
Sbjct: 30430794 aaaacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattg 30430853

                                                 
Query: 672      tccctggaatccactactctgatgataagctgc 704
                ||||||||||||| |||||||||||||||||||
Sbjct: 30430854 tccctggaatccattactctgatgataagctgc 30430886



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                            
Query: 14       ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
                ||||||||||||||  | |||||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 30429845 ggaagccctgagacattgagggatccacgtggttttgctgtcaagttttacactagagag 30429904

                 
Query: 74       g 74
                |
Sbjct: 30429905 g 30429905



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 258      atgttggcattccactcaac 277
                ||||||||||||||||||||
Sbjct: 17591242 atgttggcattccactcaac 17591261

---

>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0017G10
          Length = 166700

 Score =  779 bits (393), Expect = 0.0
 Identities = 573/633 (90%)
 Strand = Plus / Plus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             ||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 67615 agggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatga 67674

                                                                         
Query: 132   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
             | ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 67675 aattccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaact 67734

                                                                         
Query: 192   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
             ||||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |
Sbjct: 67735 ggagaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctct 67794

                                                                         
Query: 252   ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
             |||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 67795 ttgacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacct 67854

                                                                         
Query: 312   acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
             ||||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |
Sbjct: 67855 acaccctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacct 67914

                                                                         
Query: 372   gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
             ||||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||
Sbjct: 67915 gtggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagcc 67974

                                                                         
Query: 432   atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
             ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 67975 atgccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagcttt 68034

                                                                         
Query: 492   tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
              ||||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||
Sbjct: 68035 acatccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtca 68094

                                                                         
Query: 552   ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
             ||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 68095 ccaagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaaca 68154

                                                                         
Query: 612   agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
             | |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||
Sbjct: 68155 aaaacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattg 68214

                                              
Query: 672   tccctggaatccactactctgatgataagctgc 704
             ||||||||||||| |||||||||||||||||||
Sbjct: 68215 tccctggaatccattactctgatgataagctgc 68247



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                         
Query: 14    ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
             ||||||||||||||  | |||||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 67206 ggaagccctgagacattgagggatccacgtggttttgctgtcaagttttacactagagag 67265

              
Query: 74    g 74
             |
Sbjct: 67266 g 67266

---

>dbj|D64013.1| Oryza sativa (japonica cultivar-group) CatB gene for catalase,
            complete cds
          Length = 4985

 Score =  771 bits (389), Expect = 0.0
 Identities = 572/633 (90%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            ||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 2968 agggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatga 3027

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            | ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 3028 aattccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaact 3087

                                                                        
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
            ||||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |
Sbjct: 3088 ggagaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctct 3147

                                                                        
Query: 252  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
            |||||||||| ||||| ||||||||| | ||||||||||| |||||||||||||||||||
Sbjct: 3148 ttgacgatgtaggcatcccactcaaccacaggcacatggagggttttggtgtcaacacct 3207

                                                                        
Query: 312  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
            ||||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |
Sbjct: 3208 acaccctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacct 3267

                                                                        
Query: 372  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
            ||||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||
Sbjct: 3268 gtggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagcc 3327

                                                                        
Query: 432  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
            ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 3328 atgccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagcttt 3387

                                                                        
Query: 492  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
             ||||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||
Sbjct: 3388 acatccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtca 3447

                                                                        
Query: 552  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
            ||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 3448 ccaagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaaca 3507

                                                                        
Query: 612  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
            | |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||
Sbjct: 3508 aaaacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattg 3567

                                             
Query: 672  tccctggaatccactactctgatgataagctgc 704
            ||||||||||||| |||||||||||||||||||
Sbjct: 3568 tccctggaatccattactctgatgataagctgc 3600



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||  | ||||| |||||||||||||| || ||||| ||||| ||||||
Sbjct: 2559 ggaagccctgagacattgagggaaccacgtggttttgctgtcaagttttacactagagag 2618

             
Query: 74   g 74
            |
Sbjct: 2619 g 2619

---

>gb|AY103601.1| Zea mays PCO144994 mRNA sequence
          Length = 2149

 Score =  664 bits (335), Expect = 0.0
 Identities = 602/691 (87%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 569  ggaagccctgagaccttgagggatccacgtggttttgctgtcaagttctacaccagagag 628

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            |||||||||||||| || || ||||| |||||||||||||| || |||||||||||||| 
Sbjct: 629  ggtaactttgacctcgtgggtaacaacatgcctgtgtttttcatacgagatgggatgaaa 688

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||| ||||||||||| | ||| ||||||||  ||||||||||||||
Sbjct: 689  ttccctgacatggtccacgctttcaagccgaatccaaagaccaatttgcaggagaactgg 748

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| |||| || ||||| || |||||||| ||||| || ||||||||||||||||| |||
Sbjct: 749  agaatagtagatttcttctctcaccacccagagagcctacacatgttcaccttcctcttt 808

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||||||||| ||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 809  gacgatgttggcatcccactcaactacaggcacatggagggctttggtgtcaatacctac 868

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||||| |||| ||||||||||||| ||||||| || || ||||||||||| ||||| |||
Sbjct: 869  accttgatcaacagggatggaaagcctcaccttgtgaaattccattggaagcctacttgt 928

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            |||||||| ||| |  | || |||||||| || |||||||||||||||||||||| ||||
Sbjct: 929  ggtgtgaaatgcttgctcgacgatgaagctgtgactgttggaggcacctgccacagccat 988

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            || || |||||  |   |||||| || ||||||||||||||||| ||||||||||| | |
Sbjct: 989  gcgacgaaggatctatatgattccatcgcagctgggaattaccctgaatggaagctctac 1048

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| ||||||  ||| || |||||||  |||||||||||||| || |||||||||
Sbjct: 1049 atccagactattgatcttgaccatgaggataagtttgactttgacccgctcgatgtcacc 1108

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||| ||||| |||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 1109 aagacctggcctgaggatatcatcccgctgcagcccgttggacggatggtcctgaacaag 1168

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            ||| | ||||| ||||| || || ||||||||| ||||||||||||||||  | | ||| 
Sbjct: 1169 aacgtcgacaacttctttgcagagaatgaacagattgctttctgcccagcgattattgtt 1228

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            |||||||| ||||| ||||||||||||||||
Sbjct: 1229 cctggaattcactattctgatgataagctgc 1259

---

>gb|AF475100.1| Triticum aestivum catalase isozyme mRNA, partial cds
          Length = 807

 Score =  660 bits (333), Expect = 0.0
 Identities = 406/432 (93%), Gaps = 1/432 (0%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 373 ggaagccctgagaccttgagggatccacgtggttttgcagtgaagttctacaccagagag 432

                                                                       
Query: 74  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 433 ggtaactttgaccttgttgggaacaatatgcctgtgtttttcatccgagatgggatgaag 492

                                                                       
Query: 134 ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 493 ttccctgacatggtccatgctttcaagccaagtccaaagaccaacatgcaggagaactgg 552

                                                                       
Query: 194 agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
           ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 553 agaatagttgacttcttctcgcaccacccggagagtctgcacatgttcaccttcctcttt 612

                                                                       
Query: 254 gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
           || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 613 gatgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacacctac 672

                                                                       
Query: 314 accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
           |||||||| |||| |||||||||||| ||||| ||||||||||||||||| ||||| || 
Sbjct: 673 accttaatnagcanggatggaaaggcgcaccttgttaagttccattggaagcctacntgn 732

                                                                       
Query: 374 ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
           || ||||||||||||||  |||||||| || ||||||| ||||||||||||| || ||||
Sbjct: 733 ggggtgaagtgcctcttanatgatgaaaccnttactgtaggaggcacctgccnca-ccat 791

                       
Query: 434 gccacaaaggac 445
           ||| |||| |||
Sbjct: 792 gccncaaangac 803

---

>emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (EC 1.11.1.6)
          Length = 2079

 Score =  648 bits (327), Expect = 0.0
 Identities = 600/691 (86%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 499  ggaagccctgagaccttgagggatccacgtggttttgctgtcaagttctacaccagagag 558

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            |||||||||||||| || || ||||| |||||||||||||| || |||||||||||||| 
Sbjct: 559  ggtaactttgacctcgtgggtaacaacatgcctgtgtttttcatacgagatgggatgaaa 618

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||| ||||||||||| | ||| ||||||||  ||||||||||||||
Sbjct: 619  ttccctgacatggtccacgctttcaagccgaatccaaagaccaatttgcaggagaactgg 678

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| |||| || ||||| || |||||||| ||||| || ||||||||||||||||| |||
Sbjct: 679  agaatagtagatttcttctctcaccacccagagagcctacacatgttcaccttcctcttt 738

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||||||||| ||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 739  gacgatgttggcatcccactcaactacaggcacatggagggctttggtgtcaatacctac 798

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
             |||| |||| ||||||||||||| ||||||| || || ||||||||||| ||||| |||
Sbjct: 799  tccttgatcaacagggatggaaagcctcaccttgtgaaattccattggaagcctacttgt 858

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
            |||||||| ||| |  | ||  ||||||| || |||||||||||||||||||||| ||||
Sbjct: 859  ggtgtgaaatgcttgctcgacaatgaagctgtgactgttggaggcacctgccacagccat 918

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            || || |||||  |   |||||| || ||||||||||||||||| ||||||||||| | |
Sbjct: 919  gcgacgaaggatctatatgattccatcgcagctgggaattaccctgaatggaagctctac 978

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| ||||||  ||| || |||||||  |||||||||||||| || |||||||||
Sbjct: 979  atccagactattgatcttgaccatgaggataagtttgactttgacccgctcgatgtcacc 1038

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||| ||||| |||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 1039 aagacctggcctgaggatatcatcccgctgcagcccgttggacggatggtcctgaacaag 1098

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            ||| | ||||| ||||| || || ||||||||| ||||||||||||||||  | | ||| 
Sbjct: 1099 aacgtcgacaacttctttgcagagaatgaacagattgctttctgcccagcgattagtgtt 1158

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            |||||||| ||||| ||||||||||||||||
Sbjct: 1159 cctggaattcactattctgatgataagctgc 1189

---

>gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence
          Length = 1928

 Score =  632 bits (319), Expect = e-178
 Identities = 598/691 (86%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 406  ggaagccctgagaccttgagggatccacgtggttttgctgtcaagttctacaccagagag 465

                                                                        
Query: 74   ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
            |||||||||||||| || || ||||| |||||||||||||| || |||||||||||||| 
Sbjct: 466  ggtaactttgacctcgtgggtaacaacatgcctgtgtttttcatacgagatgggatgaaa 525

                                                                        
Query: 134  ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
            ||||||||||||||||| ||||||||||| | ||| ||||||||  ||||||||||||||
Sbjct: 526  ttccctgacatggtccacgctttcaagccgaatccaaagaccaatttgcaggagaactgg 585

                                                                        
Query: 194  agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
            ||| |||| || ||||| || |||||||| ||||| || ||||||||||||||||| |||
Sbjct: 586  agaatagtagatttcttctctcaccacccagagagcctacacatgttcaccttcctcttt 645

                                                                        
Query: 254  gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
            |||||||||||||| ||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 646  gacgatgttggcatcccactcaactacaggcacatggagggctttggtgtcaatacctac 705

                                                                        
Query: 314  accttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgt 373
            ||||| |||| ||||||||||||| ||||||| || || ||||||||||| |||||   |
Sbjct: 706  accttgatcaacagggatggaaagcctcaccttgtgaaattccattggaagcctactcct 765

                                                                        
Query: 374  ggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacacccat 433
             ||||||| ||| |  | ||  ||||||| || |||||||||||||||||||||| ||||
Sbjct: 766  tgtgtgaaatgcttgctcgacaatgaagctgtgactgttggaggcacctgccacagccat 825

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            || || |||||  |   |||||| || ||||||||||||||||| ||||||||||| | |
Sbjct: 826  gcgacgaaggatctatatgattccatcgcagctgggaattaccctgaatggaagctctac 885

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            |||||||| ||||||  ||| || |||||||  |||||||||||||| || |||||||||
Sbjct: 886  atccagactattgatcttgaccatgaggataagtttgactttgacccgctcgatgtcacc 945

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||| ||||| |||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 946  aagacctggcctgaggatatcatcccgctgcagcccgttggacggatggtcctgaacaag 1005

                                                                        
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 673
            ||| | ||||| ||||| || || ||||||||| ||||||||||||||||  | | ||| 
Sbjct: 1006 aacgtcgacaacttctttgcagagaatgaacagattgctttctgcccagcgattattgtt 1065

                                           
Query: 674  cctggaatccactactctgatgataagctgc 704
            |||||||| ||||| ||||||||||||||||
Sbjct: 1066 cctggaattcactattctgatgataagctgc 1096

---

>gb|U16132.1|HVU16132 Hordeum vulgare catalase mRNA, partial cds
          Length = 326

 Score =  630 bits (318), Expect = e-177
 Identities = 324/326 (99%)
 Strand = Plus / Plus

                                                                       
Query: 253 tgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacaccta 312
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1   tgacgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacaccta 60

                                                                       
Query: 313 caccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatg 372
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  caccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatg 120

                                                                       
Query: 373 tggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccca 432
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 121 tggtgtgaagtgcctcttggatgatgaagctgttactgttggaggcacctgccacaccca 180

                                                                       
Query: 433 tgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagctttt 492
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagctttt 240

                                                                       
Query: 493 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 552
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 300

                                     
Query: 553 caagacctggccagaggacatcatcc 578
           ||||||||||||||||||||||||||
Sbjct: 301 caagacctggccagaggacatcatcc 326

---

>emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1
          Length = 6933

 Score =  557 bits (281), Expect = e-155
 Identities = 545/633 (86%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            |||||||||||||||| || || ||||| |||||||||||||| || |||||||||||||
Sbjct: 4648 agggtaactttgacctcgtgggtaacaacatgcctgtgtttttcatacgagatgggatga 4707

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            | ||||||||||||||||| |  |||||||| | ||| ||||||||  ||||||||||||
Sbjct: 4708 aattccctgacatggtccacgtcttcaagccgaatccaaagaccaatttgcaggagaact 4767

                                                                        
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
            ||||| |||| || ||||| || |||||||| ||||| || ||||||||||||||||| |
Sbjct: 4768 ggagaatagtagatttcttctctcaccacccagagagcctacacatgttcaccttcctct 4827

                                                                        
Query: 252  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
            |||||||||||||||| ||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 4828 ttgacgatgttggcatcccactcaactacaggcacatggagggctttggtgtcaatacct 4887

                                                                        
Query: 312  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
            ||||||| |||| ||||||||||||| ||||||| || || ||||||||||| ||||| |
Sbjct: 4888 acaccttgatcaacagggatggaaagcctcaccttgtgaaattccattggaagcctactt 4947

                                                                        
Query: 372  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
            |||||||||| ||| |  | ||  ||||||| || |||||||||||||||||||||| ||
Sbjct: 4948 gtggtgtgaaatgcttgctcgacaatgaagctgtgactgttggaggcacctgccacagcc 5007

                                                                        
Query: 432  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
            |||| || |||||  |   |||||| || ||||||||||||||||| ||||||||||| |
Sbjct: 5008 atgcgacgaaggatctatatgattccatcgcagctgggaattaccctgaatggaagctct 5067

                                                                        
Query: 492  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
             ||||||||| ||||||  ||| || |||||||  |||||||||||||| || |||||||
Sbjct: 5068 acatccagactattgatcttgaccatgaggataagtttgactttgacccgctcgatgtca 5127

                                                                        
Query: 552  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
            ||||||||||||| ||||| |||||||| ||||| || |||||||||||||| |||||||
Sbjct: 5128 ccaagacctggcctgaggatatcatcccgctgcagcccgttggacggatggtcctgaaca 5187

                                                                        
Query: 612  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
            ||||| | ||||| ||||| || || ||||||||| ||||||||||||||||  | | ||
Sbjct: 5188 agaacgtcgacaacttctttgcagagaatgaacagattgctttctgcccagcgattattg 5247

                                             
Query: 672  tccctggaatccactactctgatgataagctgc 704
            | |||||||| ||||| ||||||||||||||||
Sbjct: 5248 ttcctggaattcactattctgatgataagctgc 5280



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                        
Query: 14   ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
            ||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 3911 ggaagccctgagaccttgagggatccacgtggttttgctgtcaagttctacaccagagag 3970

             
Query: 74   g 74
            |
Sbjct: 3971 g 3971

---

>ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2)
            transcript variant AT4G35090.1 mRNA, complete cds
          Length = 1856

 Score =  230 bits (116), Expect = 5e-57
 Identities = 527/664 (79%)
 Strand = Plus / Plus

                                                                        
Query: 41   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 430  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 489

                                                                        
Query: 101  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 490  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 549

                                                                        
Query: 161  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 550  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 609

                                                                        
Query: 221  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 610  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 669

                                                                        
Query: 281  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 340
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 670  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 729

                                                                        
Query: 341  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 400
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 730  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 789

                                                                        
Query: 401  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 460
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 790  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 849

                                                                        
Query: 461  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 850  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 909

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 910  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 969

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 970  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1029

                                                                        
Query: 641  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 700
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1030 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1089

                
Query: 701  ctgc 704
            ||||
Sbjct: 1090 ctgc 1093

---

>ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2)
            transcript variant AT4G35090.2 mRNA, complete cds
          Length = 2259

 Score =  230 bits (116), Expect = 5e-57
 Identities = 527/664 (79%)
 Strand = Plus / Plus

                                                                        
Query: 41   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 429  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 488

                                                                        
Query: 101  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 489  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 548

                                                                        
Query: 161  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 549  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 608

                                                                        
Query: 221  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 609  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 668

                                                                        
Query: 281  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 340
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 669  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 728

                                                                        
Query: 341  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 400
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 729  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 788

                                                                        
Query: 401  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 460
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 789  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 848

                                                                        
Query: 461  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 849  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 908

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 909  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 968

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 969  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1028

                                                                        
Query: 641  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 700
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1029 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1088

                
Query: 701  ctgc 704
            ||||
Sbjct: 1089 ctgc 1092

---

>gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds
          Length = 1510

 Score =  230 bits (116), Expect = 5e-57
 Identities = 527/664 (79%)
 Strand = Plus / Plus

                                                                        
Query: 41   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 358  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 417

                                                                        
Query: 101  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 418  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 477

                                                                        
Query: 161  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 478  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 537

                                                                        
Query: 221  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 538  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 597

                                                                        
Query: 281  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 340
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 598  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 657

                                                                        
Query: 341  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 400
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 658  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 717

                                                                        
Query: 401  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 460
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 718  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 777

                                                                        
Query: 461  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 778  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 837

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 838  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 897

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 898  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 957

                                                                        
Query: 641  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 700
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 958  gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1017

                
Query: 701  ctgc 704
            ||||
Sbjct: 1018 ctgc 1021

---

>gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds
          Length = 1775

 Score =  230 bits (116), Expect = 5e-57
 Identities = 527/664 (79%)
 Strand = Plus / Plus

                                                                        
Query: 41   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 430  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 489

                                                                        
Query: 101  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 490  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 549

                                                                        
Query: 161  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 550  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 609

                                                                        
Query: 221  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 610  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 669

                                                                        
Query: 281  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 340
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 670  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 729

                                                                        
Query: 341  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 400
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 730  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 789

                                                                        
Query: 401  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 460
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 790  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 849

                                                                        
Query: 461  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 850  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 909

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 910  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 969

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 970  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1029

                                                                        
Query: 641  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 700
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1030 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1089

                
Query: 701  ctgc 704
            ||||
Sbjct: 1090 ctgc 1093

---

>gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.140) mRNA, complete
            cds
          Length = 1759

 Score =  230 bits (116), Expect = 5e-57
 Identities = 527/664 (79%)
 Strand = Plus / Plus

                                                                        
Query: 41   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 430  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 489

                                                                        
Query: 101  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 490  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 549

                                                                        
Query: 161  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 550  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 609

                                                                        
Query: 221  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 610  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 669

                                                                        
Query: 281  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 340
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 670  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 729

                                                                        
Query: 341  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 400
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 730  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 789

                                                                        
Query: 401  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 460
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 790  gcaattcttgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 849

                                                                        
Query: 461  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 850  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 909

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 910  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 969

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 970  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1029

                                                                        
Query: 641  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 700
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1030 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1089

                
Query: 701  ctgc 704
            ||||
Sbjct: 1090 ctgc 1093

---

>gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, complete cds
          Length = 1917

 Score =  216 bits (109), Expect = 7e-53
 Identities = 532/673 (79%)
 Strand = Plus / Plus

                                                                        
Query: 10   gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
            |||||| |||||||||||  | || || ||| | |||||||| |||||||||||||| ||
Sbjct: 395  gagggggagccctgagactttgagagacccaagaggttttgctgtgaagttctacactag 454

                                                                        
Query: 70   agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
            ||||||||||||||| ||||| ||||| ||| | || |||||||||||||| ||||| ||
Sbjct: 455  agagggtaactttgatcttgtggggaataatttcccagtgttttttatccgtgatggcat 514

                                                                        
Query: 130  gaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaa 189
             || ||||||||||||||||| || || |||||||  ||||| ||  |||| || |||||
Sbjct: 515  taaattccctgacatggtccacgcattgaagccaaacccgaaaacacacatccaagagaa 574

                                                                        
Query: 190  ctggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            ||||||  |  ||||||| || || |||||||| ||||||||||| ||||| || || ||
Sbjct: 575  ctggaggatccttgactttttctctcaccacccagagagtctgcatatgtttacatttct 634

                                                                        
Query: 250  atttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacac 309
             ||||| ||  |||| |||||     |||||||||| ||||| ||||  |||||  ||||
Sbjct: 635  ctttgatgacattggtattcctacagactataggcatatggatggttcaggtgtgcacac 694

                                                                        
Query: 310  ctacaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctac 369
            ||||||  |  |||||| ||| || || || ||    ||||||||||| |||||||| ||
Sbjct: 695  ctacacacttgtcagcaaggaagggaaagcccattatgttaagttccactggaaacccac 754

                                                                        
Query: 370  atgtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacac 429
            |||||| ||||| |  || ||||||||||| || |||   ||||||||  ||   || | 
Sbjct: 755  atgtggagtgaaatctctgttggatgatgaggctgttgtggttggaggtgccaatcatag 814

                                                                        
Query: 430  ccatgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagct 489
             |||||||| |||||  | |||||| | ||||| ||||| || ||||| || ||||||||
Sbjct: 815  tcatgccaccaaggatcttactgatgccattgctgctggtaactaccctgagtggaagct 874

                                                                        
Query: 490  tttcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgt 549
             |  || ||||  || ||| | ||||| ||||| || || || |||||||| ||||||||
Sbjct: 875  ctatattcagataatggatccggatcatgaggacaggttcgattttgacccacttgatgt 934

                                                                        
Query: 550  caccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaa 609
            ||||||||| ||||| || || ||| | || || || ||||||||||| |||||  ||||
Sbjct: 935  caccaagacatggcctgaagatatcttgcctctccagccagttggacgcatggtcttgaa 994

                                                                        
Query: 610  caagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcac 669
            |||||| || || || ||||| || || ||||||||||| ||||| ||||||||| ||| 
Sbjct: 995  caagaatatcgataacttctttgcagagaatgaacagctagctttttgcccagcaatcat 1054

                         
Query: 670  tgtccctggaatc 682
            ||| |||||||||
Sbjct: 1055 tgtgcctggaatc 1067

---

>emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase
          Length = 1803

 Score =  214 bits (108), Expect = 3e-52
 Identities = 525/664 (79%)
 Strand = Plus / Plus

                                                                        
Query: 41   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 412  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 471

                                                                        
Query: 101  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
             | ||||| || || ||||| ||||||||||||||||||||||| ||||| ||| | |||
Sbjct: 472  tttcctgttttcttcatccgcgatgggatgaagttccctgacattgtccacgctcttaag 531

                                                                        
Query: 161  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 532  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 591

                                                                        
Query: 221  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 592  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 651

                                                                        
Query: 281  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 340
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 652  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 711

                                                                        
Query: 341  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 400
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 712  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 771

                                                                        
Query: 401  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 460
            ||  ||  | ||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 772  gcaattcgtcttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 831

                                                                        
Query: 461  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 832  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 891

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 892  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 951

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 952  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1011

                                                                        
Query: 641  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 700
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1012 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1071

                
Query: 701  ctgc 704
            ||||
Sbjct: 1072 ctgc 1075

---

>gb|AY641732.1| Camellia sinensis catalase mRNA, partial cds
          Length = 782

 Score =  208 bits (105), Expect = 2e-50
 Identities = 507/641 (79%)
 Strand = Plus / Plus

                                                                       
Query: 64  caccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgaga 123
           |||||||||||| |||||||| || || || |||||| | || || |||||  |||| ||
Sbjct: 1   caccagagaggggaactttgatctggtgggaaacaatttccccgtttttttcgtccgtga 60

                                                                       
Query: 124 tgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgca 183
           ||| ||||||||||| ||||||||||| ||| | || || |  || ||  |  |||| ||
Sbjct: 61  tggaatgaagttcccagacatggtccacgctcttaaacccaaccccaaatctcacatcca 120

                                                                       
Query: 184 ggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcac 243
           |||||| |||||| |  ||||||||||||| ||||| || |||||| |||| ||||||||
Sbjct: 121 ggagaattggagaatccttgacttcttttctcaccatccagagagtttgcatatgttcac 180

                                                                       
Query: 244 cttcctatttgacgatgttggcattccactcaactataggcacatggacggttttggtgt 303
           |||||| ||||| ||||  ||  |||| |   |||| ||||||||||| || | ||||||
Sbjct: 181 cttcctctttgatgatgcgggtgttccgcaagactacaggcacatggaaggctctggtgt 240

                                                                       
Query: 304 caacacctacaccttaatcagcagggatggaaaggctcacctggttaagttccattggaa 363
            ||||||||||| ||||||| ||  | ||| |||||||||   || ||||| ||||||||
Sbjct: 241 taacacctacactttaatcaacaaagctgggaaggctcactatgtcaagtttcattggaa 300

                                                                       
Query: 364 acctacatgtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctg 423
           |||||| ||||| ||||||||  | ||||| || || ||| |||  ||||| ||  |   
Sbjct: 301 acctacctgtggagtgaagtgtttgttggaggaagaggccattaaggttgggggagctaa 360

                                                                       
Query: 424 ccacacccatgccacaaaggacttgactgattctattgcagctgggaattacccagaatg 483
            |||| ||||||||| |||||  ||  ||| || || ||||||||||| ||||| |||||
Sbjct: 361 tcacagccatgccaccaaggatctgtatgactcaatagcagctgggaactaccctgaatg 420

                                                                       
Query: 484 gaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccctct 543
           ||| |||||||||||||  || ||| ||||||| || || |||||||| ||||| || ||
Sbjct: 421 gaaacttttcatccagataatcgatcctgatcatgaagacagatttgattttgatccact 480

                                                                       
Query: 544 tgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatggt 603
           |||||| |||||||||||||| ||||||||||| || ||||| || || || ||  ||||
Sbjct: 481 tgatgtaaccaagacctggcctgaggacatcatacctctgcagccggtgggccgcttggt 540

                                                                       
Query: 604 actgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagc 663
             |||| |||||||| || || ||||| || || ||||| |||||||| || ||||| ||
Sbjct: 541 cttgaataagaacatggataacttctttgcagagaatgagcagcttgcattttgccctgc 600

                                                    
Query: 664 agtcactgtccctggaatccactactctgatgataagctgc 704
             ||| ||| |||||  || |||| || |||||||||||||
Sbjct: 601 tatcattgtacctggtgtctactattcagatgataagctgc 641

---

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score =  176 bits (89), Expect = 6e-41
 Identities = 497/633 (78%)
 Strand = Plus / Minus

                                                                          
Query: 72     agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
              |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 157193 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 157134

                                                                          
Query: 132    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
              ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 157133 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 157074

                                                                          
Query: 192    ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
              ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 157073 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 157014

                                                                          
Query: 252    ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
              | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 157013 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 156954

                                                                          
Query: 312    acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
              |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 156953 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 156894

                                                                          
Query: 372    gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
              |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 156893 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 156834

                                                                          
Query: 432    atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
              |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 156833 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 156774

                                                                          
Query: 492    tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
              | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 156773 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtga 156714

                                                                          
Query: 552    ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
              ||||||||||||| ||||| ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 156713 ccaagacctggcctgaggatatcttgcctcttcaacctgttggacgtatggtgttgaaca 156654

                                                                          
Query: 612    agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
              ||||||||||||| ||||| || || ||||| || ||||||||||| || ||| | | ||
Sbjct: 156653 agaacattgacaacttctttgcagagaatgagcaacttgctttctgtcctgcaattattg 156594

                                               
Query: 672    tccctggaatccactactctgatgataagctgc 704
              |||| || || || ||||| |||||||||||||
Sbjct: 156593 tcccagggatacattactcagatgataagctgc 156561



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                
Query: 41     cgtggttttgcagtgaagttctacaccagagagg 74
              |||||||||||||| |||||||||||||||||||
Sbjct: 157302 cgtggttttgcagtcaagttctacaccagagagg 157269

---

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score =  176 bits (89), Expect = 6e-41
 Identities = 497/633 (78%)
 Strand = Plus / Minus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 27271 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 27212

                                                                         
Query: 132   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
             ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 27211 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 27152

                                                                         
Query: 192   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
             ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 27151 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 27092

                                                                         
Query: 252   ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
             | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 27091 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 27032

                                                                         
Query: 312   acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
             |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 27031 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 26972

                                                                         
Query: 372   gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
             |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 26971 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 26912

                                                                         
Query: 432   atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
             |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 26911 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 26852

                                                                         
Query: 492   tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
             | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 26851 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtga 26792

                                                                         
Query: 552   ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
             ||||||||||||| ||||| ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 26791 ccaagacctggcctgaggatatcttgcctcttcaacctgttggacgtatggtgttgaaca 26732

                                                                         
Query: 612   agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
             ||||||||||||| ||||| || || ||||| || ||||||||||| || ||| | | ||
Sbjct: 26731 agaacattgacaacttctttgcagagaatgagcaacttgctttctgtcctgcaattattg 26672

                                              
Query: 672   tccctggaatccactactctgatgataagctgc 704
             |||| || || || ||||| |||||||||||||
Sbjct: 26671 tcccagggatacattactcagatgataagctgc 26639



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 41    cgtggttttgcagtgaagttctacaccagagagg 74
             |||||||||||||| |||||||||||||||||||
Sbjct: 27380 cgtggttttgcagtcaagttctacaccagagagg 27347

---

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score =  176 bits (89), Expect = 6e-41
 Identities = 497/633 (78%)
 Strand = Plus / Minus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 58226 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 58167

                                                                         
Query: 132   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
             ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 58166 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 58107

                                                                         
Query: 192   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
             ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 58106 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 58047

                                                                         
Query: 252   ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
             | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 58046 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 57987

                                                                         
Query: 312   acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
             |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 57986 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 57927

                                                                         
Query: 372   gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
             |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 57926 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 57867

                                                                         
Query: 432   atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
             |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 57866 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 57807

                                                                         
Query: 492   tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
             | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 57806 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtga 57747

                                                                         
Query: 552   ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
             ||||||||||||| ||||| ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 57746 ccaagacctggcctgaggatatcttgcctcttcaacctgttggacgtatggtgttgaaca 57687

                                                                         
Query: 612   agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 671
             ||||||||||||| ||||| || || ||||| || ||||||||||| || ||| | | ||
Sbjct: 57686 agaacattgacaacttctttgcagagaatgagcaacttgctttctgtcctgcaattattg 57627

                                              
Query: 672   tccctggaatccactactctgatgataagctgc 704
             |||| || || || ||||| |||||||||||||
Sbjct: 57626 tcccagggatacattactcagatgataagctgc 57594



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 41    cgtggttttgcagtgaagttctacaccagagagg 74
             |||||||||||||| |||||||||||||||||||
Sbjct: 58335 cgtggttttgcagtcaagttctacaccagagagg 58302

---

>emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit 1 (EC 1.11.1.6)
          Length = 1666

 Score =  157 bits (79), Expect = 6e-35
 Identities = 154/179 (86%)
 Strand = Plus / Plus

                                                                        
Query: 482  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
            |||||||| ||||||||||| |||||| |||| || || |||| ||||||||||||||||
Sbjct: 847  tggaagctcttcatccagacaattgatcctgaccatgaagataaatttgactttgaccct 906

                                                                        
Query: 542  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
            |||||||| || ||||||||||| ||||||||| | || ||||| || ||||| ||  ||
Sbjct: 907  cttgatgtgactaagacctggcctgaggacatcttgcccctgcagcctgttggccgcttg 966

                                                                       
Query: 602  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            ||  |||| |||||||||||||| |||||||| ||||||||||||||||| || |||||
Sbjct: 967  gttttgaataagaacattgacaacttcttcgccgaaaatgaacagcttgcattttgccc 1025



 Score =  145 bits (73), Expect = 2e-31
 Identities = 124/141 (87%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           ||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||
Sbjct: 379 ggaagccctgaaaccctcagggatcctcgtggttttgcagtgaagttctacacccgagag 438

                                                                       
Query: 74  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
           ||||| ||||| ||||| || |||||| | || || || ||||| || ||||| ||||| 
Sbjct: 439 ggtaattttgatcttgtgggaaacaatttcccagtcttctttattcgtgatggaatgaaa 498

                                
Query: 134 ttccctgacatggtccatgct 154
           |||||||| ||||||||||||
Sbjct: 499 ttccctgatatggtccatgct 519

---

>emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 gene)
          Length = 1813

 Score =  149 bits (75), Expect = 1e-32
 Identities = 126/143 (88%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 342 agccctgaaaccctgagggatcctcgtggttttgcagtgaagttttacaccagagagggt 401

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           || |||||||| ||||| |||||| | ||||| |||||| | || ||||| ||||| |||
Sbjct: 402 aattttgacctggttggaaacaatttccctgtcttttttgttcgtgatggaatgaaattc 461

                                  
Query: 137 cctgacatggtccatgctttcaa 159
           || ||||||||||||||| ||||
Sbjct: 462 ccggacatggtccatgctctcaa 484



 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 451 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
           |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| |||||| |
Sbjct: 776 tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaattgatcc 835

                                                                       
Query: 511 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           |||||| ||||| ||||||||||||||||| |||||||| || ||||||||||| || ||
Sbjct: 836 tgatcatgaggacagatttgactttgacccacttgatgtaactaagacctggcctgaaga 895

                                                                       
Query: 571 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
            ||  | || ||||| |||||||| ||  |||| ||||| || |||||||| || |||||
Sbjct: 896 tattcttcctctgcagccagttggccgtctggttctgaataaaaacattgataacttctt 955

                                         
Query: 631 cgcggaaaatgaacagcttgctttctgccc 660
            || || |||||||| ||||| || |||||
Sbjct: 956 tgcagagaatgaacaacttgcattttgccc 985



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatg 260
           |||||||||| || |||||||| || || |||||||||||||||||||||||||| ||| 
Sbjct: 526 ttgacttcttctcccaccacccagaaagcctgcacatgttcaccttcctatttgatgatc 585

                                                               
Query: 261 ttggcattccactcaactataggcacatggacggttttggtgtcaacaccta 312
           | ||  ||||||   | || ||||||||||| || | |||||| ||||||||
Sbjct: 586 tgggagttccacaagattacaggcacatggaaggctctggtgttaacaccta 637

---

>gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, complete cds
          Length = 1800

 Score =  149 bits (75), Expect = 1e-32
 Identities = 171/203 (84%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            ||||| ||||| || || || ||||||||||| ||||||||||| |||||| ||||||| 
Sbjct: 857  attgctgctggtaactatccggaatggaagctcttcatccagacgattgatcctgatcat 916

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||| ||||||||||||||||||||||| |||||||| ||||| || |||||  | 
Sbjct: 917  gaggataggtttgactttgaccctcttgatgtgaccaagacatggccggaagacattttg 976

                                                                        
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 637
            || || || || ||||| ||  |||| |||||||||||||| ||||| ||||| || || 
Sbjct: 977  cctcttcagcctgttggccgcttggtcctgaacaagaacatcgacaacttctttgctgag 1036

                                   
Query: 638  aatgaacagcttgctttctgccc 660
            ||||| |||||||| ||||||||
Sbjct: 1037 aatgagcagcttgcattctgccc 1059



 Score =  139 bits (70), Expect = 1e-29
 Identities = 226/278 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           |||||||| |||||| | || ||||| ||||||||||| || |||||||| ||| |||||
Sbjct: 413 ggaagccccgagaccttgagagatcctcgtggttttgctgtcaagttctatacccgagag 472

                                                                       
Query: 74  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
           ||||||||||| ||||| ||||||||  | |||||||| || || || ||||| ||||||
Sbjct: 473 ggtaactttgatcttgtggggaacaacttccctgtgttcttcattcgtgatggaatgaag 532

                                                                       
Query: 134 ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
           |||||||||||||| |||||  | ||||| |  || ||| || |||| |||||| | |||
Sbjct: 533 ttccctgacatggtgcatgccctgaagcccaaccccaagtcccacattcaggaggattgg 592

                                                                       
Query: 194 agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
           ||  |  |||| ||||| || ||||| || || ||| ||||||||||| ||||||| |||
Sbjct: 593 aggatccttgatttcttctctcaccatcctgaaagtttgcacatgttctccttcctcttt 652

                                                 
Query: 254 gacgatgttggcattccactcaactataggcacatgga 291
           || ||| |||||||||| |   |||| |||||||||||
Sbjct: 653 gatgatattggcattcctcaagactacaggcacatgga 690



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 350 aagttccattggaaacctacatgtggtgtgaag 382
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 749 aagttccactggaagcctacttgtggtgtgaag 781

---

>ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalase AT1G20630 (CAT1)
           mRNA, complete cds
          Length = 1929

 Score =  147 bits (74), Expect = 6e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggtaacttt 82
           ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 422 gagactctcagagatccccgtggttttgctgttaagttttacaccagagaggggaacttt 481

                                                                       
Query: 83  gaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgac 142
           || ||||||||||||||  | ||||| || ||  |||| ||||| ||||| |||||||||
Sbjct: 482 gatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatgaaattccctgac 541

                                                                       
Query: 143 atggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggagagtagtt 202
           ||||||||||| || || || | ||| ||| |  |||| ||||||||||||||  || | 
Sbjct: 542 atggtccatgcattgaaaccgaatcccaagtctcacattcaggagaactggaggatactg 601

                                                 
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgtt 240
           |||||||| || |||||||| |||||| ||||||||||
Sbjct: 602 gacttcttctcccaccacccagagagtttgcacatgtt 639

---

>gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, complete cds
          Length = 1928

 Score =  147 bits (74), Expect = 6e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggtaacttt 82
           ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 421 gagactctcagagatccccgtggttttgctgttaagttttacaccagagaggggaacttt 480

                                                                       
Query: 83  gaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgac 142
           || ||||||||||||||  | ||||| || ||  |||| ||||| ||||| |||||||||
Sbjct: 481 gatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatgaaattccctgac 540

                                                                       
Query: 143 atggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggagagtagtt 202
           ||||||||||| || || || | ||| ||| |  |||| ||||||||||||||  || | 
Sbjct: 541 atggtccatgcattgaaaccgaatcccaagtctcacattcaggagaactggaggatactg 600

                                                 
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgtt 240
           |||||||| || |||||||| |||||| ||||||||||
Sbjct: 601 gacttcttctcccaccacccagagagtttgcacatgtt 638

---

>gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence
          Length = 1794

 Score =  147 bits (74), Expect = 6e-32
 Identities = 263/326 (80%)
 Strand = Plus / Plus

                                                                       
Query: 11  aggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccaga 70
           ||||| || ||||| || || |||||||| ||||||||||| || ||||| |||||||||
Sbjct: 420 aggggtagtcctgaaactctgagggatcctcgtggttttgctgtcaagttttacaccaga 479

                                                                       
Query: 71  gagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatg 130
           ||||| |||||||| || || ||||||||  | || || || || ||||| ||||| |||
Sbjct: 480 gagggaaactttgatctggtagggaacaacttccccgtcttcttcatccgtgatggaatg 539

                                                                       
Query: 131 aagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaac 190
           |||||||||||||||||||||||| | ||||||| ||| ||| || | || |||||||| 
Sbjct: 540 aagttccctgacatggtccatgctctgaagccaaatcctaagtcccatatccaggagaat 599

                                                                       
Query: 191 tggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttccta 250
           ||||| ||  |||| || || || || || || || || |||||||||||||| ||||| 
Sbjct: 600 tggagggtccttgattttttctctcatcatcccgaaagcctgcacatgttcactttcctc 659

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           || |||||| |||| |||||||   | || ||||| |||||||| | ||||||| |||| 
Sbjct: 660 ttcgacgatattggtattccacaagattacaggcatatggacgggtctggtgtccacaca 719

                                     
Query: 311 tacaccttaatcagcagggatggaaa 336
           | ||| || |||| ||||| ||||||
Sbjct: 720 ttcacattgatcaacagggctggaaa 745



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                        
Query: 455  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
            |||||||||||||| ||||| || ||||||||||| ||||| ||||  || ||| | || 
Sbjct: 864  tctattgcagctggaaattatcctgaatggaagctcttcattcagattatggatccagaa 923

                                                                        
Query: 515  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 574
            || || || | |||||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 924  catgaagacaaatttgactttgatccacttgatgtgacaaaaacttggccagaggacatc 983

                                                                        
Query: 575  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 634
             | ||  |||| || || ||| |  | || ||||||||||||||||| || |||||    
Sbjct: 984  ttgcctttgcagccggtgggaagattagttctgaacaagaacattgataacttctttaat 1043

                                      
Query: 635  gaaaatgaacagcttgctttctgccc 660
            || ||||| ||||| |||||||||||
Sbjct: 1044 gagaatgagcagctagctttctgccc 1069

---

>gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds
          Length = 1479

 Score =  147 bits (74), Expect = 6e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggtaacttt 82
           ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 340 gagactctcagagatccccgtggttttgctgttaagttttacaccagagaggggaacttt 399

                                                                       
Query: 83  gaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgac 142
           || ||||||||||||||  | ||||| || ||  |||| ||||| ||||| |||||||||
Sbjct: 400 gatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatgaaattccctgac 459

                                                                       
Query: 143 atggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggagagtagtt 202
           ||||||||||| || || || | ||| ||| |  |||| ||||||||||||||  || | 
Sbjct: 460 atggtccatgcattgaaaccgaatcccaagtctcacattcaggagaactggaggatactg 519

                                                 
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgtt 240
           |||||||| || |||||||| |||||| ||||||||||
Sbjct: 520 gacttcttctcccaccacccagagagtttgcacatgtt 557

---

>emb|X94447.1|ATCATAL A.thaliana cat gene for catalase
          Length = 3677

 Score =  147 bits (74), Expect = 6e-32
 Identities = 458/586 (78%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 2190 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 2249

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 2250 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 2309

                                                                        
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
            ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 2310 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 2369

                                                                        
Query: 252  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
            | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 2370 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 2429

                                                                        
Query: 312  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
            |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 2430 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 2489

                                                                        
Query: 372  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 431
            |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 2490 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 2549

                                                                        
Query: 432  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 491
            |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 2550 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 2609

                                                                        
Query: 492  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 551
            | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 2610 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtaa 2669

                                                                        
Query: 552  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 611
            ||||||||||||| || || ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 2670 ccaagacctggcctgaagatatcttgcctctccaacctgttggacgtatggtgttgaaca 2729

                                                          
Query: 612  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctg 657
            ||||||||||||| ||||| || || ||||| || ||||| |||||
Sbjct: 2730 agaacattgacaacttctttgcagagaatgagcaacttgccttctg 2775



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 41   cgtggttttgcagtgaagttctacaccagagagg 74
            |||||||||||||| |||||||||||||||||||
Sbjct: 2081 cgtggttttgcagtcaagttctacaccagagagg 2114

---

>gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630) mRNA, complete
           cds
          Length = 1746

 Score =  147 bits (74), Expect = 6e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggtaacttt 82
           ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 422 gagactctcagagatccccgtggttttgctgttaagttttacaccagagaggggaacttt 481

                                                                       
Query: 83  gaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgac 142
           || ||||||||||||||  | ||||| || ||  |||| ||||| ||||| |||||||||
Sbjct: 482 gatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatgaaattccctgac 541

                                                                       
Query: 143 atggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggagagtagtt 202
           ||||||||||| || || || | ||| ||| |  |||| ||||||||||||||  || | 
Sbjct: 542 atggtccatgcattgaaaccgaatcccaagtctcacattcaggagaactggaggatactg 601

                                                 
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgtt 240
           |||||||| || |||||||| |||||| ||||||||||
Sbjct: 602 gacttcttctcccaccacccagagagtttgcacatgtt 639

---

>gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA, complete cds
          Length = 1736

 Score =  147 bits (74), Expect = 6e-32
 Identities = 164/194 (84%)
 Strand = Plus / Plus

                                                                        
Query: 452  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 511
            ||||||||||| | ||||||||| || ||||||||||||||||| ||||| || ||| | 
Sbjct: 820  gattctattgcggatgggaattatccggaatggaagcttttcattcagactatggatccg 879

                                                                        
Query: 512  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 571
            ||||| |||||||| |||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 880  gatcatgaggataggtttgactttgacccgcttgatgtgaccaagacctggcccgaggat 939

                                                                        
Query: 572  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            ||| | ||  |||| || || || || |||||  |||||||||||||||| || ||||| 
Sbjct: 940  atcttgcctttgcagcctgtgggtcgtatggttttgaacaagaacattgataacttcttt 999

                          
Query: 632  gcggaaaatgaaca 645
            ||||| ||||||||
Sbjct: 1000 gcggagaatgaaca 1013



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 284 cacatggacggttttggtgtcaacacctacac 315
           ||||||||||||| ||||||||||||||||||
Sbjct: 652 cacatggacggttctggtgtcaacacctacac 683



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcac 243
           ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 571 gactttttctcgcaccatcccgagagtctacacatgttcac 611

---

>gb|AY170463.1| Morus alba catalase (CAT1) mRNA, partial cds
          Length = 585

 Score =  141 bits (71), Expect = 4e-30
 Identities = 293/367 (79%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 118 agccctgaaaccctaagggatcctcgtggttttgctgtgaagttctacaccagagagggt 177

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           || ||||| || || || |||||| | ||||| || || ||||| ||||| || || |||
Sbjct: 178 aattttgatctcgtcggaaacaatttccctgtcttcttcatccgtgatggaattaaattc 237

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           || ||||||||||||||| | ||||| |  || ||| |  |||| |||||    ||||||
Sbjct: 238 ccagacatggtccatgctcttaagcccaacccaaagtctcacatccaggaattttggaga 297

                                                                       
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
            |  | |||||||| || ||||| || |||||  ||||||||||||||||||||||||| 
Sbjct: 298 atcttggacttcttctcacaccatccagagagcttgcacatgttcaccttcctatttgat 357

                                                                       
Query: 257 gatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctacacc 316
           ||  ||||  | ||||   | || ||||||||||| || |  ||||| ||||||||||| 
Sbjct: 358 gacattggtgtcccacaagattacaggcacatggatggctccggtgttaacacctacact 417

                                                                       
Query: 317 ttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatgtggt 376
            | |||  || || |||||||||||||   || || |||||||||||||| || ||||||
Sbjct: 418 ctgatcgacaaggctggaaaggctcactatgtgaaattccattggaaacccacctgtggt 477

                  
Query: 377 gtgaagt 383
           || ||||
Sbjct: 478 gtcaagt 484

---

>gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA, complete cds
          Length = 1791

 Score =  139 bits (70), Expect = 1e-29
 Identities = 106/118 (89%)
 Strand = Plus / Plus

                                                                       
Query: 30  tcagggatccacgtggttttgcagtgaagttctacaccagagagggtaactttgaccttg 89
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||| || |
Sbjct: 402 tcagggatcctcgtggttttgctgtgaagttctacaccagagagggtaactttgatctgg 461

                                                                     
Query: 90  ttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggt 147
           | ||||||||| | ||||| ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 462 tggggaacaatttccctgtcttttttatccgtgatggtatgaaattccctgatatggt 519



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 335/434 (77%)
 Strand = Plus / Plus

                                                                        
Query: 206  ttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgttggc 265
            ||||| || ||||| || |||||| ||||||||||||| || || ||||| ||| | || 
Sbjct: 578  ttcttctcccaccatcctgagagtttgcacatgttcacttttctctttgatgatatcgga 637

                                                                        
Query: 266  attccactcaactataggcacatggacggttttggtgtcaacacctacaccttaatcagc 325
            |||||    ||||| ||||||||||| |||| |||||| ||||| ||||| ||||| | |
Sbjct: 638  attcctgcaaactacaggcacatggaaggttctggtgttaacacatacactttaattaac 697

                                                                        
Query: 326  agggatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgc 385
            | || ||||||  |  ||   || |||||||| |||||||| |||||||| |||||| ||
Sbjct: 698  aaggctggaaaaacatactacgtgaagttccactggaaaccaacatgtggggtgaagagc 757

                                                                        
Query: 386  ctcttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggac 445
            || ||||| ||||| ||| |||  ||||||||  |   ||||| |||||| ||  |||||
Sbjct: 758  ctgttggaggatgaggccattaaagttggaggagctaaccacagccatgctacgcaggac 817

                                                                        
Query: 446  ttgactgattctattgcagctgggaattacccagaatggaagcttttcatccagaccatt 505
             |   ||| || ||||||  |||||| || || || |||||||||||||||||||| || 
Sbjct: 818  ctctatgactcaattgcaagtgggaactatcctgagtggaagcttttcatccagacaata 877

                                                                        
Query: 506  gatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggcca 565
            ||  | | | | || |||| ||||||||||||||| || ||||| || || || ||||| 
Sbjct: 878  gacccagctgatgaagataaatttgactttgaccccctagatgttacaaaaacatggcct 937

                                                                        
Query: 566  gaggacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaat 625
            ||||| ||  | || || || ||||| || ||  | ||  ||||||||||||||||||| 
Sbjct: 938  gaggatattttgcccctacagccagtgggtcgtttagtgttgaacaagaacattgacaac 997

                          
Query: 626  ttcttcgcggaaaa 639
            ||||| || |||||
Sbjct: 998  ttctttgcagaaaa 1011

---

>gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, complete cds
          Length = 1725

 Score =  139 bits (70), Expect = 1e-29
 Identities = 262/326 (80%)
 Strand = Plus / Plus

                                                                       
Query: 11  aggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccaga 70
           ||||| || ||||| || || |||||||| ||||||||||| || ||||| |||||||||
Sbjct: 350 aggggtagtcctgaaactctgagggatcctcgtggttttgctgtcaagttttacaccaga 409

                                                                       
Query: 71  gagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatg 130
           ||||| |||||||| || || ||||||||  | || || || || ||||| ||||| |||
Sbjct: 410 gagggaaactttgatctggtagggaacaacttccccgtcttcttcatccgtgatggaatg 469

                                                                       
Query: 131 aagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaac 190
           |||||||||||||||||||||||| | ||||||| ||| ||| || | || |||||||| 
Sbjct: 470 aagttccctgacatggtccatgctctgaagccaaatcctaagtcccatatccaggagaat 529

                                                                       
Query: 191 tggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttccta 250
           ||||| ||  |||| || || || || || || || || |||||||||||||| ||||| 
Sbjct: 530 tggagggtccttgattttttctctcatcatcccgaaagcctgcacatgttcactttcctc 589

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           || |||||| |||| ||||| |   | || ||||| |||||||| | ||||||| |||| 
Sbjct: 590 ttcgacgatattggtattccccaagattacaggcatatggacgggtctggtgtccacaca 649

                                     
Query: 311 tacaccttaatcagcagggatggaaa 336
           | ||| || |||| ||||| ||||||
Sbjct: 650 ttcacattgatcaacagggctggaaa 675



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 526 atttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 574
           |||||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 865 atttgactttgatccacttgatgtgacaaaaacttggccagaggacatc 913



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 455 tctattgcagctgggaattacccagaatggaa 486
           |||||||||||||| ||||| || ||||||||
Sbjct: 794 tctattgcagctggaaattatcctgaatggaa 825

---

>gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds
          Length = 1648

 Score =  135 bits (68), Expect = 2e-28
 Identities = 242/300 (80%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           |||||| || ||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 276 gaggggtagtcctgaaactctgagggatcctcgtggttttgctgtcaagttctacaccag 335

                                                                       
Query: 70  agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
           |||||| || ||||| || || ||||||||  | || || || || ||||| ||||| ||
Sbjct: 336 agagggaaattttgatctggtagggaacaactttcccgtcttcttcatccgtgatggaat 395

                                                                       
Query: 130 gaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaa 189
           ||||||||||||||||||||||||| | ||||||| ||| ||| || | || ||||||||
Sbjct: 396 gaagttccctgacatggtccatgctctgaagccaaatcctaagtcccatatccaggagaa 455

                                                                       
Query: 190 ctggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            |||||  |  |||| || || || || || || || || |||||||||||||| |||||
Sbjct: 456 ttggaggatccttgattttttctctcatcatcccgaaagcctgcacatgttcactttcct 515

                                                                       
Query: 250 atttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacac 309
            || |||||| |||| |||||||   | || ||||| |||||||| | ||||||| ||||
Sbjct: 516 cttcgacgatattggtattccacaagattacaggcatatggacgggtctggtgtccacac 575



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 135/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           |||||||||||||| ||||| || ||||||||||| ||||| ||||  || ||| | |||
Sbjct: 721 tctattgcagctggaaattatcctgaatggaagctcttcattcagattatggatccagat 780

                                                                       
Query: 515 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 574
           || || || | |||||||||||| || |||||||| || || || ||||||||||| |||
Sbjct: 781 catgaagacaaatttgactttgatccacttgatgtgacaaaaacttggccagaggatatc 840

                                                          
Query: 575 atcccactgcaaccagttggacggatggtactgaacaagaacattga 621
            | ||  |||| || || ||| |  |||| |||||||||||||||||
Sbjct: 841 ttgcctttgcagccggtgggaagattggttctgaacaagaacattga 887

---

>emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 gene)
          Length = 1693

 Score =  135 bits (68), Expect = 2e-28
 Identities = 242/300 (80%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           |||||| || ||||| || || ||||| || ||||||||||| || ||||||||||||||
Sbjct: 307 gaggggtagtcctgaaactctgagggaccctcgtggttttgctgtcaagttctacaccag 366

                                                                       
Query: 70  agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
           |||||| |||||||| || || ||||||||  | ||||| || || ||||| ||||| ||
Sbjct: 367 agagggaaactttgatctggtagggaacaacttccctgtcttcttcatccgtgatggaat 426

                                                                       
Query: 130 gaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaa 189
           ||||||||||||||||||||| ||  | ||||||| ||| ||| || | || ||||||||
Sbjct: 427 gaagttccctgacatggtccacgcgctgaagccaaatcctaagtcccatatccaggagaa 486

                                                                       
Query: 190 ctggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            ||||||||  |||| || || || ||    || || ||||||||||||||||| |||||
Sbjct: 487 ttggagagtccttgattttttctctcatgttcctgaaagtctgcacatgttcactttcct 546

                                                                       
Query: 250 atttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacac 309
            || |||||| |||| |||||||   | || ||||| ||||| |||| ||||||| ||||
Sbjct: 547 cttcgacgatattggtattccacaagattacaggcatatggatggttctggtgtccacac 606



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 752 tctattgctgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 811

                                                                   
Query: 515 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           || || || |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 812 catgaagacagatttgattttgatccacttgatgtgacaaaaacttggccagagga 867

---

>gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds
          Length = 1735

 Score =  129 bits (65), Expect = 1e-26
 Identities = 203/249 (81%)
 Strand = Plus / Plus

                                                                        
Query: 452  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 511
            ||||| ||||| ||||| || ||||| || ||||||||||| ||||||||||||||| | 
Sbjct: 785  gattcgattgctgctggaaactaccccgagtggaagctttttatccagaccattgatccg 844

                                                                        
Query: 512  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 571
            |||||||||||| |  | ||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 845  gatcacgaggatcggctcgactttgacccgcttgatgttaccaagacctggcctgaggat 904

                                                                        
Query: 572  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            ||| | ||  |||| || || || ||  ||||  |||||||||| |||||||| ||||| 
Sbjct: 905  atctttccgttgcagcctgtgggtcgtctggttttgaacaagaatattgacaacttcttt 964

                                                                        
Query: 632  gcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactct 691
            || || ||||||||||| || || || || ||  ||| ||| ||||||||| | || |||
Sbjct: 965  gctgagaatgaacagctggcattttgtcctgctatcattgttcctggaatctattattct 1024

                     
Query: 692  gatgataag 700
            |||||||||
Sbjct: 1025 gatgataag 1033



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           ||||| || ||||||||||| ||  | ||||| |||||||||||||||||| ||||||||
Sbjct: 350 agccccgaaaccctcagggaccctagaggtttcgcagtgaagttctacacccgagagggt 409

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||||||  | || || |||||| | || ||||| ||||| || ||||| ||||| || 
Sbjct: 410 aactttgatttggtgggaaacaatttcccggtgttctttattcgtgatggaatgaaattt 469

                      
Query: 137 cctgacatggt 147
           || ||||||||
Sbjct: 470 cccgacatggt 480



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 284 cacatggacggttttggtgtcaacacctacac 315
           ||||||||||| |  |||||||||||||||||
Sbjct: 617 cacatggacggatccggtgtcaacacctacac 648

---

>emb|Z99633.1|SACATALAS Soldanella alpina mRNA for catalase (cat1 gene)
          Length = 1772

 Score =  127 bits (64), Expect = 5e-26
 Identities = 202/248 (81%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           ||||||||||| || ||||| || ||||||||||||||||| |||||||| |||||||||
Sbjct: 377 agccctgagactcttagggaccctcgtggttttgcagtgaaattctacacaagagagggt 436

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||||||| | || || |||||| | || || || ||| | || ||||| ||||| || 
Sbjct: 437 aactttgacttggtgggaaacaatttcccagttttctttgttcgtgatggaatgaaattt 496

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           || ||||||||||||||| | ||||| |  || ||| |  |||| ||||| || ||||||
Sbjct: 497 cccgacatggtccatgctcttaagcccaaccccaagtcacacattcaggaaaattggaga 556

                                                                       
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
            || | |||||||| || |||||||| |||||| |||| |||||||| ||||| || |||
Sbjct: 557 atactcgacttcttctctcaccacccagagagtttgcatatgttcactttccttttcgac 616

                   
Query: 257 gatgttgg 264
           ||| ||||
Sbjct: 617 gatcttgg 624



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 347 gttaagttccattggaaacctacatgtggtgtgaa 381
           ||||||||||||||||||||||||||||| |||||
Sbjct: 707 gttaagttccattggaaacctacatgtggagtgaa 741

---

>gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catalase mRNA, complete cds
          Length = 1845

 Score =  127 bits (64), Expect = 5e-26
 Identities = 190/232 (81%)
 Strand = Plus / Plus

                                                                       
Query: 30  tcagggatccacgtggttttgcagtgaagttctacaccagagagggtaactttgaccttg 89
           ||||||| || || |||||||| ||||||||||||||||||||||||||||||||  | |
Sbjct: 434 tcagggaccctcgaggttttgctgtgaagttctacaccagagagggtaactttgatatgg 493

                                                                       
Query: 90  ttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtcc 149
           | || |||||| | |||||||| || ||||| ||||| ||||||||||| || ||||| |
Sbjct: 494 taggaaacaatttccctgtgttcttcatccgtgatggtatgaagttccccgatatggtgc 553

                                                                       
Query: 150 atgctttcaagccaagtccgaagaccaacatgcaggagaactggagagtagttgacttct 209
           ||||| |||| || |  || ||  || |||| || ||||| ||||||||  | || ||||
Sbjct: 554 atgctctcaaacccaaccccaaatcccacatccaagagaattggagagtcctcgatttct 613

                                                               
Query: 210 tttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgt 261
           | || ||||| || |||||| ||||||||||||| ||||| ||||| |||||
Sbjct: 614 tctcccaccatcccgagagtttgcacatgttcactttcctctttgatgatgt 665



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                        
Query: 521  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
            |||| ||||||||||||||| || ||||| |||||||| ||||| ||||||||  | || 
Sbjct: 925  gataaatttgactttgacccactagatgttaccaagacttggcctgaggacattttgccg 984

                                                                        
Query: 581  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 640
            ||||| ||||| || ||  ||||  ||||||| ||||||||||| ||||| || ||||||
Sbjct: 985  ctgcagccagtgggtcgtttggttttgaacaaaaacattgacaacttctttgcagaaaat 1044

                    
Query: 641  gaacagct 648
            || |||||
Sbjct: 1045 gagcagct 1052

---

>gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, complete cds
          Length = 1744

 Score =  127 bits (64), Expect = 5e-26
 Identities = 241/300 (80%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           |||||| || ||||| || || ||||| || ||||||||||| || ||||||||||||||
Sbjct: 367 gaggggtagtcctgaaactctgagggaccctcgtggttttgctgtcaagttctacaccag 426

                                                                       
Query: 70  agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
           |||||| |||||||| || || ||||||||  | || || || || ||||| ||||| ||
Sbjct: 427 agagggaaactttgatctggtagggaacaacttccccgtattcttcatccgtgatggaat 486

                                                                       
Query: 130 gaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaa 189
           ||||||||||||||||||||||||| | ||||||| ||| ||| || | || ||||||||
Sbjct: 487 gaagttccctgacatggtccatgctctgaagccaaatcctaagtcccatatccaggagaa 546

                                                                       
Query: 190 ctggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            ||||| ||  |||| || || || ||    || || || |||||||||||||| |||||
Sbjct: 547 ttggagggtccttgattttttctctcatgttcctgaaagcctgcacatgttcactttcct 606

                                                                       
Query: 250 atttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacac 309
            || |||||| |||| |||||||   | || ||||| |||||||| | ||||||| ||||
Sbjct: 607 cttcgacgatattggtattccacaagattacaggcatatggacggatctggtgtccacac 666



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 163/206 (79%)
 Strand = Plus / Plus

                                                                        
Query: 455  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
            |||||||||||||| ||||| || ||||||||||| ||||| ||||| || ||| |   |
Sbjct: 812  tctattgcagctggaaattatcctgaatggaagctcttcattcagactatggatccaagt 871

                                                                        
Query: 515  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 574
            || || || |||||||| || || || |||||||| || || || ||||||||||| |||
Sbjct: 872  catgaagacagatttgatttcgatccgcttgatgtgactaaaacttggccagaggatatc 931

                                                                        
Query: 575  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 634
             | ||  |||| || || ||| |  | || ||||||||||||||||| || |||||    
Sbjct: 932  ttgcctttgcagccggtgggaagattagttctgaacaagaacattgataacttctttaat 991

                                      
Query: 635  gaaaatgaacagcttgctttctgccc 660
            |||||||| ||||| |||||||||||
Sbjct: 992  gaaaatgagcagctagctttctgccc 1017

---

>emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8
          Length = 3947

 Score =  125 bits (63), Expect = 2e-25
 Identities = 168/203 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            ||||||||||| |  || || || ||||| |||||||||||||| |||||| |||| || 
Sbjct: 2420 attgcagctggcacctatcctgagtggaaacttttcatccagacaattgatcctgaccat 2479

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            || |  || ||||| |||||||| |||||||| |||||||||||||| ||||| ||| | 
Sbjct: 2480 gaagccaggtttgattttgacccacttgatgtaaccaagacctggcctgaggatatcttg 2539

                                                                        
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 637
            || ||||| |||||||| ||  ||||  |||| |||||||| ||||| ||||| || |||
Sbjct: 2540 cccctgcagccagttggtcgcttggtcttgaataagaacatcgacaacttctttgctgaa 2599

                                   
Query: 638  aatgaacagcttgctttctgccc 660
            ||||| |||||||||||||||||
Sbjct: 2600 aatgagcagcttgctttctgccc 2622



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                      
Query: 17   agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagg 74
            |||||||| ||||| |||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 1498 agccctgaaaccctgagggatccacgtggatttgcagtgaagttttacaccagagagg 1555



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 242/310 (78%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            ||||||||||||| || || || |||||| | ||||| || || ||||| ||||| ||||
Sbjct: 2034 agggtaactttgatctcgtgggaaacaatttccctgtcttcttcatccgtgatggaatga 2093

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            | ||||| |||||||| |||||  | ||||| |  || ||| |  | || ||||||||||
Sbjct: 2094 aattcccagacatggtgcatgccctgaagcccaaccctaagtctcatattcaggagaact 2153

                                                                        
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
            ||||  |  |||||||||| || ||||| || || ||| ||||||||||| |||||||||
Sbjct: 2154 ggaggattcttgacttcttctcccaccatcctgaaagtttgcacatgttctccttcctat 2213

                                                                        
Query: 252  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 311
            |||| ||| | ||  ||||||   | ||||| || ||||| || | |||||| |||||||
Sbjct: 2214 ttgatgatttgggtgttccacaagattatagacatatggaaggctctggtgttaacacct 2273

                                                                        
Query: 312  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 371
            |||  || |||| || || |||||| || ||    || || || |||||||||||||| |
Sbjct: 2274 acatgttgatcaacaaggctggaaaagcccattatgtgaaatttcattggaaacctactt 2333

                      
Query: 372  gtggtgtgaa 381
            ||||||||||
Sbjct: 2334 gtggtgtgaa 2343

---

>gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, complete cds
          Length = 1792

 Score =  125 bits (63), Expect = 2e-25
 Identities = 147/175 (84%)
 Strand = Plus / Plus

                                                                        
Query: 530  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
            |||||||||||||| |||||||||||||||||||| ||||| ||| | || || || || 
Sbjct: 920  gactttgaccctctcgatgtcaccaagacctggcctgaggatatcttgcctctccagccc 979

                                                                        
Query: 590  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 649
            ||||| || |||||  |||||||||||||||| || ||||| ||||| || || ||||||
Sbjct: 980  gttgggcgtatggtgttgaacaagaacattgataacttctttgcggagaacgagcagctt 1039

                                                                   
Query: 650  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgc 704
            ||||||||||| ||  ||| ||| || || || ||||||||||| ||||||||||
Sbjct: 1040 gctttctgccctgcgatcattgttccggggatacactactctgacgataagctgc 1094



 Score =  121 bits (61), Expect = 3e-24
 Identities = 172/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||| |||||||| |||||||||||||||||||| |||||||| ||||| || ||||| 
Sbjct: 431 cgtggctttgcagtcaagttctacaccagagaggggaactttgatcttgtcggaaacaac 490

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | ||||| || || ||||| || || ||||||||||||||||||||||| ||| |||| 
Sbjct: 491 ttccctgtcttcttcatccgcgacggtatgaagttccctgacatggtccacgctctcaaa 550

                                                                       
Query: 161 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
           ||||  || ||  |  |||| || ||||||||||||||  |||||||||| || ||||||
Sbjct: 551 ccaaacccaaaatcacacatccaagagaactggagagtccttgacttcttctcccaccac 610

                                        
Query: 221 ccggagagtctgcacatgttcaccttcct 249
           || |||||  |  |||||||||| |||||
Sbjct: 611 cctgagagcttaaacatgttcactttcct 639

---

>gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, complete cds
          Length = 1778

 Score =  123 bits (62), Expect = 8e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||| || ||||| |||||||||||||||||||| |||||||| ||||| || ||||| 
Sbjct: 421 cgtggcttcgcagtcaagttctacaccagagagggaaactttgatcttgtcggaaacaac 480

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | ||||| || || ||||| || |||||||||||||||||||||||||| ||| |||| 
Sbjct: 481 ttccctgtcttcttcatccgcgacgggatgaagttccctgacatggtccacgctctcaaa 540

                                                                       
Query: 161 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
           ||||  || ||  |  |||| || ||||||||||||||  |||||||||| || ||||||
Sbjct: 541 ccaaaccccaaatctcacatccaagagaactggagagtccttgacttcttctcccaccac 600

                                                 
Query: 221 ccggagagtctgcacatgttcaccttcctatttgacga 258
           || || || ||  |||||||||| ||||| || |||||
Sbjct: 601 cctgaaagcctcaacatgttcactttcctcttcgacga 638



 Score =  101 bits (51), Expect = 3e-18
 Identities = 144/175 (82%)
 Strand = Plus / Plus

                                                                        
Query: 530  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
            |||||||||||||| |||||||||||||| ||||| || || ||| | || || || || 
Sbjct: 910  gactttgaccctctcgatgtcaccaagacttggcctgaagatatcttgcctctccagccc 969

                                                                        
Query: 590  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 649
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 970  gttgggcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 1029

                                                                   
Query: 650  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgc 704
            || ||||| || ||  ||| ||| || || || ||||||||||| ||||||||||
Sbjct: 1030 gccttctgtcctgctatcattgttccggggatacactactctgacgataagctgc 1084

---

>emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subunit 2
          Length = 1763

 Score =  119 bits (60), Expect = 1e-23
 Identities = 174/212 (82%)
 Strand = Plus / Plus

                                                                       
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 103
           ||||| || ||||| || |||||  ||||||| || ||||| || || ||||||||| | 
Sbjct: 398 ggtttcgctgtgaaattttacactcgagagggaaattttgatctcgtggggaacaatttc 457

                                                                       
Query: 104 cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 163
           ||||||||||| ||||| || || |||||||||||||| |||||||||||| | || |||
Sbjct: 458 cctgtgtttttcatccgtgacggaatgaagttccctgatatggtccatgctcttaaacca 517

                                                                       
Query: 164 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 223
           |  |||||| || |||| ||||| ||||||||  |  | ||||||||||||||||| || 
Sbjct: 518 aacccgaagtcccacattcaggaaaactggaggattctggacttcttttcgcaccatccc 577

                                           
Query: 224 gagagtctgcacatgttcaccttcctatttga 255
           || ||  ||||||||||||||||||| |||||
Sbjct: 578 gaaagcttgcacatgttcaccttcctgtttga 609



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 518 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
           |||||||| ||||| |||||||| |||||||| |||||||| ||||||||||||||| ||
Sbjct: 872 gaggataggtttgattttgacccacttgatgtaaccaagacatggccagaggacatcttc 931

                                                    
Query: 578 ccactgcaaccagttggacggatggtactgaacaagaacat 618
           ||| |||| ||| | || || |||||  | |||||||||||
Sbjct: 932 ccattgcagccaatgggtcgaatggtgttaaacaagaacat 972

---

>emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 gene)
          Length = 1777

 Score =  117 bits (59), Expect = 5e-23
 Identities = 122/143 (85%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 434 agccctgaaaccctgagggatcctcgtggttttgcagtgaagttttacaccagagagggt 493

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           || |||||||| ||||| |||||| | || || |||||| |||| ||||  ||||| |||
Sbjct: 494 aattttgacctggttggaaacaatttccccgtcttttttgtccgtgatgcaatgaaattc 553

                                  
Query: 137 cctgacatggtccatgctttcaa 159
           || |||  | ||| |||||||||
Sbjct: 554 ccggacgcgatccgtgctttcaa 576



 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| || ||| |
Sbjct: 868  tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaatggatcc 927

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            |||||||||||| |||||||||||||||||||||||  | || ||||||||||| || ||
Sbjct: 928  tgatcacgaggacagatttgactttgaccctcttgacttaactaagacctggcctgaaga 987

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
             ||| | || ||||| |||||||| ||  |||| ||||| || ||||| || || |||||
Sbjct: 988  tatccttcccctgcagccagttggccgtttggttctgaataaaaacatcgataacttctt 1047

                                 
Query: 631  cgcggaaaatgaacagcttgc 651
             || || |||||||| |||||
Sbjct: 1048 tgcagagaatgaacaacttgc 1068

---

>emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, partial
          Length = 1610

 Score =  117 bits (59), Expect = 5e-23
 Identities = 122/143 (85%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 128 agccctgaaaccctgagggatcctcgtggttttgcagtgaagttttacaccagagagggt 187

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           || |||||||| ||||| |||||| | || || |||||| |||| ||||  ||||| |||
Sbjct: 188 aattttgacctggttggaaacaatttccccgtcttttttgtccgtgatgcaatgaaattc 247

                                  
Query: 137 cctgacatggtccatgctttcaa 159
           || |||  | ||| |||||||||
Sbjct: 248 ccggacgcgatccgtgctttcaa 270



 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Plus

                                                                       
Query: 451 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
           |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| || ||| |
Sbjct: 562 tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaatggatcc 621

                                                                       
Query: 511 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           |||||||||||| |||||||||||||||||||||||  | || ||||||||||| || ||
Sbjct: 622 tgatcacgaggacagatttgactttgaccctcttgacttaactaagacctggcctgaaga 681

                                                                       
Query: 571 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
            ||| | || ||||| |||||||| ||  |||| ||||| || ||||| || || |||||
Sbjct: 682 tatccttcccctgcagccagttggccgtttggttctgaataaaaacatcgataacttctt 741

                                
Query: 631 cgcggaaaatgaacagcttgc 651
            || || |||||||| |||||
Sbjct: 742 tgcagagaatgaacaacttgc 762

---

>gb|AF151368.1|AF151368 Hevea brasiliensis catalase (cat) mRNA, complete cds
          Length = 1745

 Score =  117 bits (59), Expect = 5e-23
 Identities = 167/203 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            ||||||||||| || || ||||||||||| |||| ||||||||| || ||| ||||||| 
Sbjct: 844  attgcagctggcaactatccagaatggaaactttacatccagacaatggatcctgatcat 903

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            || || | |||||| ||||| || |||||||| || ||||||||||| ||||| ||| | 
Sbjct: 904  gaagacaaatttgattttgatccacttgatgtgactaagacctggcccgaggatatcctg 963

                                                                        
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 637
            || || ||||| ||||| ||  ||||  |||| |||||||||||||||||||| || || 
Sbjct: 964  cctcttcaaccggttggccgcttggtcttgaataagaacattgacaatttctttgctgag 1023

                                   
Query: 638  aatgaacagcttgctttctgccc 660
            ||||| || ||||| ||||||||
Sbjct: 1024 aatgagcaacttgcgttctgccc 1046



 Score =  109 bits (55), Expect = 1e-20
 Identities = 112/131 (85%)
 Strand = Plus / Plus

                                                                       
Query: 32  agggatccacgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgtt 91
           |||||||| || |||||||| |||||||| ||||||||||||||||||||||| || || 
Sbjct: 418 agggatcctcgaggttttgctgtgaagttttacaccagagagggtaactttgatctggtg 477

                                                                       
Query: 92  gggaacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccat 151
           || |||||| | ||||| ||||| ||||| ||||| ||||||||||| ||  |||| |||
Sbjct: 478 ggaaacaatttccctgtttttttcatccgcgatggaatgaagttcccagatgtggtgcat 537

                      
Query: 152 gctttcaagcc 162
           ||||| |||||
Sbjct: 538 gcttttaagcc 548



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 359 tggaaacctacatgtggtgtgaagtg 384
           ||||||||||| ||||||||||||||
Sbjct: 745 tggaaacctacttgtggtgtgaagtg 770

---

>gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds
          Length = 1745

 Score =  115 bits (58), Expect = 2e-22
 Identities = 241/302 (79%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           |||||||| || ||||||||||||||  | || || || || ||||| ||||||||||||
Sbjct: 363 ggaagccccgaaaccctcagggatcccagaggattcgctgtaaagttttacaccagagag 422

                                                                       
Query: 74  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
           |||||||| || || ||||| |||||  | ||||| || ||| |||| ||||| ||||||
Sbjct: 423 ggtaacttcgatctggttggaaacaacttccctgtcttctttgtccgtgatggaatgaag 482

                                                                       
Query: 134 ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
           |||||||||||||| |||||| | || |||| ||| ||| || |||| ||||||||||||
Sbjct: 483 ttccctgacatggttcatgctctaaaaccaaatccaaagtcccacattcaggagaactgg 542

                                                                       
Query: 194 agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
           ||  |  |||| ||||| || ||||| || || ||||| || |||||||  ||||| |||
Sbjct: 543 aggatccttgatttcttctctcaccatccagaaagtcttcatatgttcagtttcctgttt 602

                                                                       
Query: 254 gacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctac 313
           || ||| | || || ||||   | || ||||||||||| ||||  ||||| || ||||||
Sbjct: 603 gatgatctgggtatcccacaagattacaggcacatggaaggttccggtgttaatacctac 662

             
Query: 314 ac 315
           ||
Sbjct: 663 ac 664



 Score =  111 bits (56), Expect = 3e-21
 Identities = 203/252 (80%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||||| ||||| |||||||| || ||| | ||||| || |||||||| || || ||| |
Sbjct: 800  tgattcaattgctgctgggaactatccaaagtggaaactgttcatccaaactatcgatcc 859

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            |||||| || || | |||||||||||||||  | ||||| ||||||| |||||| |||||
Sbjct: 860  tgatcatgaagacaaatttgactttgaccccttagatgtaaccaagatctggcctgagga 919

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
            |||  | ||| | ||||||||||| ||  ||||| |||||||||| || ||||| |||||
Sbjct: 920  cattttgccattacaaccagttggtcgcttggtattgaacaagaatatcgacaacttctt 979

                                                                        
Query: 631  cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 690
             |  || || || ||||||||||| ||||| ||  | | ||||||||| ||||| |||||
Sbjct: 980  tgtagagaacgagcagcttgctttttgccctgccattattgtccctggtatccattactc 1039

                        
Query: 691  tgatgataagct 702
             |||||||||||
Sbjct: 1040 ggatgataagct 1051

---

>gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds
          Length = 1680

 Score =  113 bits (57), Expect = 8e-22
 Identities = 216/269 (80%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||||||||| |||||||| |||||||| || || |||||||| 
Sbjct: 335 cgtggttttgctgtcaagttctacactagagagggaaactttgatctggtagggaacaac 394

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | || || || || ||||| ||||| |||||||||||||||||||| ||| || | |||
Sbjct: 395 ttccccgtcttcttcatccgtgatggaatgaagttccctgacatggttcattctctgaag 454

                                                                       
Query: 161 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
           |||| ||| ||| || | || |||||||| ||||| ||  |||| || || || || || 
Sbjct: 455 ccaaatcctaagtcccatatccaggagaattggagggtccttgattttttctctcatcat 514

                                                                       
Query: 221 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 280
           || || || |||||||||||||| |||||||| || ||| |||| || ||||   | || 
Sbjct: 515 cctgaaagcctgcacatgttcactttcctattcgatgatattggtataccacaagattac 574

                                        
Query: 281 aggcacatggacggttttggtgtcaacac 309
           |||||||||||||| | ||||||| ||||
Sbjct: 575 aggcacatggacggatctggtgtccacac 603



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           |||||||||||||| ||||| || ||||||||||||||||| |||||||| ||| | | |
Sbjct: 749 tctattgcagctggaaattatcctgaatggaagcttttcattcagaccatggatccagct 808

                                                                   
Query: 515 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           || || || |||||||| ||||| || || ||||| || || || |||||||||||
Sbjct: 809 catgaagacagatttgattttgatccactcgatgtgacaaaaacttggccagagga 864

---

>gb|AY987854.1| Euphorbia characias catalase mRNA, complete cds
          Length = 1761

 Score =  113 bits (57), Expect = 8e-22
 Identities = 234/293 (79%)
 Strand = Plus / Plus

                                                                       
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 103
           ||||||||||| |||||||||||  ||||||| || || ||||| || || |||||| | 
Sbjct: 435 ggttttgcagtcaagttctacactcgagagggcaatttcgacctagtgggaaacaatttc 494

                                                                       
Query: 104 cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 163
           || ||||| || ||||| |||||||||||||| || |||||||| |||||| ||||||||
Sbjct: 495 ccagtgttcttcatccgtgatgggatgaagtttccagacatggttcatgctctcaagcca 554

                                                                       
Query: 164 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 223
           | ||| ||| |  |||| || || || |||||  |  |||||||||| || ||||| || 
Sbjct: 555 aatccaaagtcacacatccaagaaaattggaggattcttgacttcttctcccaccatcct 614

                                                                       
Query: 224 gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 283
           || || || |||||||||||||||||||| |||||| | ||  ||||||   | || |||
Sbjct: 615 gaaagcctccacatgttcaccttcctattcgacgatatcggagttccacaggattacagg 674

                                                                
Query: 284 cacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaa 336
           || |||||||| |  ||||| ||||||||||| || |||| || || ||||||
Sbjct: 675 catatggacggctcgggtgtgaacacctacacattgatcaacaaggctggaaa 727



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 458 attgcagctgggaattacccagaatggaagcttttcatccagac 501
           ||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 849 attgcagctggaaactatccagaatggaaacttttcattcagac 892

---

>gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, complete cds
          Length = 1658

 Score =  113 bits (57), Expect = 8e-22
 Identities = 171/209 (81%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||| ||||| || |||||||||||||||||||| |||||||| ||||| || ||||| 
Sbjct: 413 cgtggctttgccgtcaagttctacaccagagagggaaactttgatcttgtcggaaacaac 472

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | ||||| || || ||||| || || ||||||||||||||||||||||| ||| | |||
Sbjct: 473 ttccctgtcttcttcatccgcgacggtatgaagttccctgacatggtccacgctcttaag 532

                                                                       
Query: 161 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
           ||||  || ||  |  |||| || ||||||||||||||  |||||||||| || ||||||
Sbjct: 533 ccaaacccaaaatctcacatccaagagaactggagagtccttgacttcttctcccaccac 592

                                        
Query: 221 ccggagagtctgcacatgttcaccttcct 249
           || |||||  |  |||||||||| |||||
Sbjct: 593 cctgagagcttaaacatgttcactttcct 621



 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                        
Query: 530  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
            |||||||||||||| ||||| |||||||||||||| |||||  || | || || || || 
Sbjct: 902  gactttgaccctctcgatgtgaccaagacctggcctgaggatctcttgcctctccagccc 961

                                                                        
Query: 590  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 649
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 962  gttggtcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 1021

                                                                   
Query: 650  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgc 704
            || |||||||| ||  ||| ||| || || || |||||||||||||| |||||||
Sbjct: 1022 gccttctgccctgcgatcattgttccggggatacactactctgatgacaagctgc 1076

---

>emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 gene)
          Length = 1688

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                        
Query: 452  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 511
            ||||| ||||| ||||| || || ||||| ||||| || |||||||| |  || ||| ||
Sbjct: 803  gattcaattgctgctggaaactatccagagtggaaactgttcatccaaattatcgatcct 862

                                                                        
Query: 512  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 571
            ||||| || || ||||||||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 863  gatcatgaagacagatttgactttgaccccctagatgtaaccaagacctggcctgaggac 922

                                                                        
Query: 572  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            ||| | ||| |||| |||||||| ||  ||||| |||| ||||| || || || ||||| 
Sbjct: 923  atcttgccattgcagccagttggtcgcttggtattgaataagaatatcgataacttcttt 982

                                
Query: 632  gcggaaaatgaacagcttgc 651
            || || ||||||||||||||
Sbjct: 983  gcagagaatgaacagcttgc 1002



 Score =  107 bits (54), Expect = 5e-20
 Identities = 195/242 (80%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           ||||||||||| ||||||||||| ||  | || ||||| || || || ||||||||||||
Sbjct: 365 ggaagccctgaaaccctcagggaccccagaggatttgctgtaaaattttacaccagagag 424

                                                                       
Query: 74  ggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaag 133
           || ||||||||  | ||||| |||||  | || || || ||| |||| ||||||||||||
Sbjct: 425 ggcaactttgatttggttggaaacaacttccccgtcttctttgtccgtgatgggatgaag 484

                                                                       
Query: 134 ttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactgg 193
           |||||||||||||| |||||  | || |||| ||| ||| || |||| ||||||||||||
Sbjct: 485 ttccctgacatggttcatgcactgaaaccaaatccaaagtcccacattcaggagaactgg 544

                                                                       
Query: 194 agagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctattt 253
           ||  |  |||| ||||| || || || || || |||||||| |||||| ||||||| |||
Sbjct: 545 aggatccttgatttcttctctcatcatccagaaagtctgcatatgttctccttcctgttt 604

             
Query: 254 ga 255
           ||
Sbjct: 605 ga 606

---

>gb|AF443179.1|AF443179 Nicotiana tabacum catalase mRNA, partial cds
          Length = 683

 Score =  111 bits (56), Expect = 3e-21
 Identities = 239/300 (79%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           |||||| || ||||| || || ||||| || ||||||||||| || ||||||||||||||
Sbjct: 159 gaggggtagtcctgaaactctgagggaccctcgtggttttgctgtcaagttctacaccag 218

                                                                       
Query: 70  agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
           |||||| |||||||| || || ||||||||  | || || || || ||||| ||||| ||
Sbjct: 219 agagggaaactttgatctggtagggaacaacttccccgtcttcttcatccgtgatggaat 278

                                                                       
Query: 130 gaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaa 189
           ||||||||||||||||||||| ||  | ||||||| ||| ||  || | || ||||||||
Sbjct: 279 gaagttccctgacatggtccacgcgctgaagccaaatcctaaatcccatatccaggagaa 338

                                                                       
Query: 190 ctggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            ||||| ||  |||| || || || ||    || || || |||||||||||||| |||||
Sbjct: 339 ttggagggtccttgattttttctctcatgttcctgaaagcctgcacatgttcactttcct 398

                                                                       
Query: 250 atttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacac 309
            || |||||| |||| |||||||   | || ||||| |||||||||| ||||||| ||||
Sbjct: 399 cttcgacgatattggtattccacaagattacaggcatatggacggttctggtgtccacac 458



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 604 tctattgccgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 663

                            
Query: 515 cacgaggatagatttga 531
           || || || ||||||||
Sbjct: 664 catgaagacagatttga 680

---

>dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds
          Length = 1800

 Score =  111 bits (56), Expect = 3e-21
 Identities = 167/204 (81%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||||| |||||||| || || ||||| || |||||||||||||| ||||| |||||  |
Sbjct: 883  tgattcaattgcagcaggcaactaccccgagtggaagcttttcattcagactattgaccc 942

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            |||||| || || | || ||||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 943  tgatcatgaagacaaatatgactttgaccctctagatgtaaccaagacatggcctgagga 1002

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
             ||| | || ||||| |||||||| || |||||  |||| |||||||| || || |||||
Sbjct: 1003 tatcttgcccctgcagccagttggccgcatggttttgaataagaacatcgataacttctt 1062

                                    
Query: 631  cgcggaaaatgaacagcttgcttt 654
             || || |||||||| || |||||
Sbjct: 1063 tgcagagaatgaacaactggcttt 1086



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| || || || ||||| || |||||||| ||||||||||||||||| ||||||
Sbjct: 449 agccctgaaacactgagagatccccgaggttttgctgtgaagttctacaccagggagggt 508

                                                                   
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaa 132
           || ||||| || || || |||||  | ||||| ||||| ||||| ||||| |||||
Sbjct: 509 aattttgatctcgtgggcaacaacttccctgtatttttcatccgtgatggtatgaa 564

---

>gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, complete cds
          Length = 4780

 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                        
Query: 530  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
            |||||||||||||| ||||| |||||||||||||| |||||  || | || || || || 
Sbjct: 3648 gactttgaccctctcgatgtgaccaagacctggcctgaggatctcttgcctctccagccc 3707

                                                                        
Query: 590  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 649
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 3708 gttggtcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 3767

                                                                   
Query: 650  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgc 704
            || |||||||| ||  ||| ||| || || || |||||||||||||| |||||||
Sbjct: 3768 gccttctgccctgcgatcattgttccggggatacactactctgatgacaagctgc 3822



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            |||| |||||||| ||||| || |||||  | ||||| || || ||||| || || ||||
Sbjct: 3190 agggaaactttgatcttgtcggaaacaacttccctgtcttcttcatccgcgacggtatga 3249

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            ||||||||||||||||||| ||| | |||||||  || ||  |  |||| || |||||||
Sbjct: 3250 agttccctgacatggtccacgctcttaagccaaacccaaaatctcacatccaagagaact 3309

                                                                      
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            |||||||  |||||||||| || |||||||| |||||  |  |||||||||| |||||
Sbjct: 3310 ggagagtccttgacttcttctcccaccaccctgagagcttaaacatgttcactttcct 3367



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 41   cgtggttttgcagtgaagttctacaccagagagg 74
            ||||| ||||| || |||||||||||||||||||
Sbjct: 2690 cgtggctttgccgtcaagttctacaccagagagg 2723

---

>gb|AF243518.1|AF243518 Helianthus annuus catalase 3 (CATA3) mRNA, complete cds
          Length = 1860

 Score =  109 bits (55), Expect = 1e-20
 Identities = 118/139 (84%)
 Strand = Plus / Plus

                                                                        
Query: 510  ctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagg 569
            ||||||| || |||||  ||||||||||||| || |||| ||||| ||||||||| ||||
Sbjct: 864  ctgatcatgaagataggcttgactttgacccgctcgatggcaccatgacctggcccgagg 923

                                                                        
Query: 570  acatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttct 629
            ||||||| ||  |||| || ||||| || |||||  ||||||||||||||||||| ||||
Sbjct: 924  acatcatacctttgcagcccgttgggcgtatggtgttgaacaagaacattgacaacttct 983

                               
Query: 630  tcgcggaaaatgaacagct 648
            | || ||||||||||||||
Sbjct: 984  ttgctgaaaatgaacagct 1002



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 56  aagttctacaccagagagggtaactttgac 85
           ||||||||||||||||||||||||||||||
Sbjct: 410 aagttctacaccagagagggtaactttgac 439

---

>ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.1 mRNA, complete cds
          Length = 1832

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 834  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 893

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 894  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 953

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 954  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1007



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 417 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 476

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 477 actccggtgttcttcatccgtgatgggattcagttccc 514



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 627 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 686

                
Query: 311 tacac 315
           |||||
Sbjct: 687 tacac 691

---

>ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.2 mRNA, complete cds
          Length = 1931

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 834  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 893

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 894  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 953

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 954  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1007



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 417 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 476

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 477 actccggtgttcttcatccgtgatgggattcagttccc 514



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 627 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 686

                
Query: 311 tacac 315
           |||||
Sbjct: 687 tacac 691

---

>ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.5 mRNA, complete cds
          Length = 1817

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 433 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 492

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 493 actccggtgttcttcatccgtgatgggattcagttccc 530



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 643 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 702

                
Query: 311 tacac 315
           |||||
Sbjct: 703 tacac 707

---

>ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.4 mRNA, complete cds
          Length = 1930

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 433 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 492

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 493 actccggtgttcttcatccgtgatgggattcagttccc 530



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 643 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 702

                
Query: 311 tacac 315
           |||||
Sbjct: 703 tacac 707

---

>ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.3 mRNA, complete cds
          Length = 1901

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 433 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 492

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 493 actccggtgttcttcatccgtgatgggattcagttccc 530



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 643 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 702

                
Query: 311 tacac 315
           |||||
Sbjct: 703 tacac 707

---

>gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds
          Length = 1759

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 832  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 891

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 892  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 951

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 952  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1005



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 415 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 474

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 475 actccggtgttcttcatccgtgatgggattcagttccc 512



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 625 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 684

                
Query: 311 tacac 315
           |||||
Sbjct: 685 tacac 689

---

>gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds
          Length = 1757

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 829  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 888

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 889  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 948

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 949  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1002



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 412 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 471

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 472 actccggtgttcttcatccgtgatgggattcagttccc 509



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 622 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 681

                
Query: 311 tacac 315
           |||||
Sbjct: 682 tacac 686

---

>emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZD06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1709

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 458 attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
           |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 810 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 869

                                                                       
Query: 518 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
           |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 870 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 929

                                                                 
Query: 578 ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
           || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 930 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 983



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 20  cctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggtaac 79
           ||||||||| | ||||||   ||||||||||| || ||||| |||||||||||||| |||
Sbjct: 372 cctgagaccatgagggatattcgtggttttgctgtcaagttttacaccagagagggaaac 431

                                                                      
Query: 80  tttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttccc 138
           ||||| |||||||||||||| |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 432 tttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattcagttccc 490



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 603 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 662

                
Query: 311 tacac 315
           |||||
Sbjct: 663 tacac 667

---

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
             complete sequence
          Length = 143879

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                         
Query: 458   attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
             |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 35671 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 35730

                                                                         
Query: 518   gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
             |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 35731 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 35790

                                                                   
Query: 578   ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
             || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 35791 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 35844



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             |||| |||||||| ||||||||||||||  | ||||| || ||  |||| ||||| ||||
Sbjct: 38695 aggggaactttgatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatga 38754

                                                                         
Query: 132   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
             | |||||||||||||||||||| || || || | ||| ||| |  |||| ||||||||||
Sbjct: 38755 aattccctgacatggtccatgcattgaaaccgaatcccaagtctcacattcaggagaact 38814

                                                              
Query: 192   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgtt 240
             ||||  || | |||||||| || |||||||| |||||| ||||||||||
Sbjct: 38815 ggaggatactggacttcttctcccaccacccagagagtttgcacatgtt 38863



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 23    gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagg 74
             ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||
Sbjct: 38468 gagactctcagagatccccgtggttttgctgttaagttttacaccagagagg 38519



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 251   tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
             ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 35464 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 35523

                  
Query: 311   tacac 315
             |||||
Sbjct: 35524 tacac 35528



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 35285 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 35344

                    
Query: 132   agttccc 138
             |||||||
Sbjct: 35345 agttccc 35351



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 41    cgtggttttgcagtgaagttctacaccagagagg 74
             ||||||||||| || ||||| |||||||||||||
Sbjct: 35162 cgtggttttgctgtcaagttttacaccagagagg 35195

---

>gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana BAC F5M15 from chromosome I,
             complete sequence
          Length = 99231

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                         
Query: 458   attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
             |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 19444 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 19385

                                                                         
Query: 518   gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
             |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 19384 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 19325

                                                                   
Query: 578   ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
             || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 19324 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 19271



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 139/169 (82%)
 Strand = Plus / Minus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             |||| |||||||| ||||||||||||||  | ||||| || ||  |||| ||||| ||||
Sbjct: 16420 aggggaactttgatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatga 16361

                                                                         
Query: 132   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
             | |||||||||||||||||||| || || || | ||| ||| |  |||| ||||||||||
Sbjct: 16360 aattccctgacatggtccatgcattgaaaccgaatcccaagtctcacattcaggagaact 16301

                                                              
Query: 192   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgtt 240
             ||||  || | |||||||| || |||||||| |||||| ||||||||||
Sbjct: 16300 ggaggatactggacttcttctcccaccacccagagagtttgcacatgtt 16252



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 23    gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagg 74
             ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||
Sbjct: 16647 gagactctcagagatccccgtggttttgctgttaagttttacaccagagagg 16596



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                         
Query: 251   tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
             ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 19651 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 19592

                  
Query: 311   tacac 315
             |||||
Sbjct: 19591 tacac 19587



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 19830 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 19771

                    
Query: 132   agttccc 138
             |||||||
Sbjct: 19770 agttccc 19764



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 41    cgtggttttgcagtgaagttctacaccagagagg 74
             ||||||||||| || ||||| |||||||||||||
Sbjct: 19953 cgtggttttgctgtcaagttttacaccagagagg 19920

---

>gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds
          Length = 1756

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           |||||| || ||||| || || ||||| || ||||||||||| || ||||||||||||||
Sbjct: 379 gaggggtagtcctgaaactctgagggaccctcgtggttttgctgtcaagttctacaccag 438

                                                                       
Query: 70  agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
           |||||| |||||||| || || ||||||||  | || || || || ||||| ||||| ||
Sbjct: 439 agagggaaactttgatctggtagggaacaacttccccgtcttcttcatccgtgatggaat 498

                                
Query: 130 gaagttccctgacatggtcca 150
           |||||||||||||||||||||
Sbjct: 499 gaagttccctgacatggtcca 519



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 824 tctattgccgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 883

                                                                   
Query: 515 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           || || || |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 884 catgaagacagatttgattttgatccacttgatgttacaaaaacttggccagagga 939

---

>emb|AJ302710.1|BPE302710 Betula pendula partial mRNA for catalase (cat gene)
          Length = 451

 Score =  103 bits (52), Expect = 8e-19
 Identities = 139/168 (82%)
 Strand = Plus / Plus

                                                                       
Query: 493 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 552
           ||||||||  |||||  ||||||| ||||| | ||||||||||||||| |||||||| ||
Sbjct: 121 catccagataattgaccctgatcatgaggacaaatttgactttgacccacttgatgtgac 180

                                                                       
Query: 553 caagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaa 612
           ||| | |||||| ||||||||  | || ||||| |||||||| ||  ||||  |||||||
Sbjct: 181 caaaatctggcccgaggacattctgcccctgcagccagttggccgcttggtcttgaacaa 240

                                                           
Query: 613 gaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
           |||||| ||||| |||||||| || |||||||| ||||| || |||||
Sbjct: 241 gaacatcgacaacttcttcgcagagaatgaacaacttgcattttgccc 288

---

>gb|AY338958.1| Cucumis sativus catalase-like (cat) mRNA, partial sequence
          Length = 275

 Score =  101 bits (51), Expect = 3e-18
 Identities = 117/139 (84%)
 Strand = Plus / Plus

                                                                       
Query: 177 acatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcaca 236
           |||| |||||||| |||||| |  ||||||||||||| ||||| || || ||| || |||
Sbjct: 4   acattcaggagaattggagaatccttgacttcttttctcaccatcctgaaagtttgaaca 63

                                                                       
Query: 237 tgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggacggtt 296
           ||||||| || |||||||||||| ||||||| ||||   | || ||||||||||||||||
Sbjct: 64  tgttcacatttctatttgacgatattggcatcccacaagattacaggcacatggacggtt 123

                              
Query: 297 ttggtgtcaacacctacac 315
             |||||||||||||||||
Sbjct: 124 caggtgtcaacacctacac 142

---

>gb|AY162277.1| Prunus armeniaca catalase1 (CAT1) mRNA, partial cds
          Length = 572

 Score =  101 bits (51), Expect = 3e-18
 Identities = 120/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||||| ||||| || ||||||| |||||||||||| |||||||||||||||
Sbjct: 118 agccctgaaaccctgagggaccctcgtggttctgcagtgaagttttacaccagagagggt 177

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           || |||||||| ||||| |||||| | || || |||||| |||| ||||  ||||| |||
Sbjct: 178 aattttgacctggttggaaacaatttccccgtcttttttgtccgtgatgcaatgaaattc 237

                                  
Query: 137 cctgacatggtccatgctttcaa 159
           || |||  | ||| |||||||||
Sbjct: 238 ccggacgcgatccgtgctttcaa 260

---

>emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catalase (cat gene)
          Length = 992

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           ||||||||||| || || || ||||| ||||| || || || ||||| || ||| | |||
Sbjct: 91  tctattgcagcaggcaactatccagagtggaaactgtttattcagactatagatccagat 150

                                                                       
Query: 515 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 574
           ||||| || |||||||| |||||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 151 cacgaagacagatttgattttgacccacttgatgtgaccaaaacatggcctgaggatatc 210

                                                                       
Query: 575 atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 634
            | || || || ||||| || || |||||  |||||||||||||||| || ||||| || 
Sbjct: 211 ttgcctctccagccagtcggtcgcatggttttgaacaagaacattgataacttctttgct 270

                                     
Query: 635 gaaaatgaacagcttgctttctgccc 660
           || ||||||||| | |||||||||||
Sbjct: 271 gagaatgaacagttggctttctgccc 296

---

>emb|AJ295295.1|BPE295295 Betula pendula partial mRNA for catalase (cat gene)
          Length = 451

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 131/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 493 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 552
           ||||||||  |||||  ||||||| ||||| | ||||||||||||||| |||||||| ||
Sbjct: 121 catccagataattgaccctgatcatgaggacaaatttgactttgacccacttgatgtgac 180

                                                                       
Query: 553 caagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaa 612
           ||| | |||||| ||||||||  | || ||||| |||||||| ||  ||||  |||||||
Sbjct: 181 caaaatctggcccgaggacattctgcccctgcagccagttggccgcttggtcttgaacaa 240

                                                 
Query: 613 gaacattgacaatttcttcgcggaaaatgaacagcttg 650
           |||||| ||||| |||||||| || |||||||| ||||
Sbjct: 241 gaacatcgacaacttcttcgcagagaatgaacaacttg 278

---

>emb|AJ538651.1|NTA538651 Nicotiana tabacum cDNA-AFLP-fragment BC33-M2-001
          Length = 346

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           |||||| || ||||| || || ||||| || ||||| ||||| || ||||||||||||||
Sbjct: 220 gaggggtagtcctgaaactctgagggaccctcgtgggtttgctgtcaagttctacaccag 161

                                                                       
Query: 70  agagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggat 129
           |||||| |||||||| || || ||||||||  | || || || || ||||| ||||| ||
Sbjct: 160 agagggaaactttgatctggtagggaacaacttccccgtcttcttcatccgcgatggaat 101

                                                                       
Query: 130 gaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaa 189
           |||||||| |||||||||||||||| | ||||| | ||| ||| || | || ||||||||
Sbjct: 100 gaagttccttgacatggtccatgctgtgaagcccaatcccaagtcccagatccaggagaa 41

                 
Query: 190 ctggag 195
            |||||
Sbjct: 40  ttggag 35

---

>gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, complete cds
          Length = 1769

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||| || ||||| ||||||||||||||||| || |||||||| ||||| || ||||| 
Sbjct: 420 cgtggcttcgcagtcaagttctacaccagagaagggaactttgatcttgtcggaaacaac 479

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | ||||| || || ||  | || |||||||||||||||||||||||||| ||| | || 
Sbjct: 480 ttccctgtcttcttcataagggacgggatgaagttccctgacatggtccacgctcttaaa 539

                                                                       
Query: 161 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
           ||||  || ||  |  |||| || || |||||||||||  |||||||||| || ||||||
Sbjct: 540 ccaaaccctaaatctcacatccaagaaaactggagagtccttgacttcttctcacaccac 599

                                                 
Query: 221 ccggagagtctgcacatgttcaccttcctatttgacga 258
           || |||||  || |||||||||| ||||| ||||||||
Sbjct: 600 cctgagagcttgaacatgttcactttcctctttgacga 637



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 182/227 (80%)
 Strand = Plus / Plus

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            |||||| ||||||||  ||| || ||||| ||||| || ||||| || |||||||| || 
Sbjct: 813  gccacacaggacttgtatgactccattgctgctggaaactaccctgagtggaagctcttt 872

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            ||||||  ||||||| | | | |||| || |  || ||||||||||| || |||||||||
Sbjct: 873  atccaggtcattgatccagctgacgaagacaagttcgactttgacccactcgatgtcacc 932

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||| ||| |  |  | || || ||||| ||||| || |||||  ||||||||
Sbjct: 933  aagacctggcctgagaatcttttgcctctccaacccgttggtcgtatggtgttgaacaag 992

                                                           
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            ||||||||||| ||||| ||||| ||||| |||||||| || |||||
Sbjct: 993  aacattgacaacttctttgcggagaatgagcagcttgccttttgccc 1039

---

>gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, complete cds
          Length = 1778

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||| || ||||| ||||||||||||||||| || |||||||| ||||| || ||||| 
Sbjct: 400 cgtggcttcgcagtcaagttctacaccagagaagggaactttgatcttgtcggaaacaac 459

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | ||||| || || ||  | || |||||||||||||||||||||||||| ||| | || 
Sbjct: 460 ttccctgtcttcttcataagggacgggatgaagttccctgacatggtccacgctcttaaa 519

                                                                       
Query: 161 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 220
           ||||  || ||  |  |||| || || |||||||||||  |||||||||| || ||||||
Sbjct: 520 ccaaaccctaaatctcacatccaagaaaactggagagtccttgacttcttctcacaccac 579

                                                 
Query: 221 ccggagagtctgcacatgttcaccttcctatttgacga 258
           || |||||  || |||||||||| ||||| ||||||||
Sbjct: 580 cctgagagcttgaacatgttcactttcctctttgacga 617



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 182/227 (80%)
 Strand = Plus / Plus

                                                                        
Query: 434  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 493
            |||||| ||||||||  ||| || ||||| ||||| || ||||| || |||||||| || 
Sbjct: 793  gccacacaggacttgtatgactccattgctgctggaaactaccctgagtggaagctcttt 852

                                                                        
Query: 494  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 553
            ||||||  ||||||| | | | |||| || |  || ||||||||||| || |||||||||
Sbjct: 853  atccaggtcattgatccagctgacgaagacaagttcgactttgacccactcgatgtcacc 912

                                                                        
Query: 554  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 613
            ||||||||||| ||| |  |  | || || ||||| ||||| || |||||  ||||||||
Sbjct: 913  aagacctggcctgagaatcttttgcctctccaacccgttggtcgtatggtgttgaacaag 972

                                                           
Query: 614  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            ||||||||||| ||||| ||||| ||||| |||||||| || |||||
Sbjct: 973  aacattgacaacttctttgcggagaatgagcagcttgccttttgccc 1019

---

>gb|U43147.1|ATU43147 Arabidopsis thaliana catalase 3 (CAT3) gene, complete cds
          Length = 4058

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 2740 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 2799

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 2800 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 2859

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 2860 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaacttcttc 2913



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 2354 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 2413

                   
Query: 132  agttccc 138
            |||||||
Sbjct: 2414 agttccc 2420



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 41   cgtggttttgcagtgaagttctacaccagagagg 74
            ||||||||||| || ||||| |||||||||||||
Sbjct: 2232 cgtggttttgctgtcaagttttacaccagagagg 2265

---

>gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) and catalase 1 (CAT1) genes,
            complete cds
          Length = 7707

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 2738 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 2797

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 2798 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 2857

                                                                  
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
            || |||||||| ||||| ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 2858 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaacttcttc 2911



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            |||| |||||||| ||||||||||||||  | ||||| || ||  |||| ||||| ||||
Sbjct: 5762 aggggaactttgatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatga 5821

                                                                        
Query: 132  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
            | |||||||||||||||||||| || || || | ||| ||| |  |||| ||||||||||
Sbjct: 5822 aattccctgacatggtccatgcattgaaaccgaatcccaagtctcacattcaggagaact 5881

                                                             
Query: 192  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgtt 240
            ||||  || | |||||||| || |||||||| |||||| ||||||||||
Sbjct: 5882 ggaggatactggacttcttctcccaccacccagagagtttgcacatgtt 5930



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 23   gagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagg 74
            ||||| ||||| ||||| ||||||||||| || ||||| |||||||||||||
Sbjct: 5535 gagactctcagagatccccgtggttttgctgttaagttttacaccagagagg 5586



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                        
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
            |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 2352 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 2411

                   
Query: 132  agttccc 138
            |||||||
Sbjct: 2412 agttccc 2418



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 41   cgtggttttgcagtgaagttctacaccagagagg 74
            ||||||||||| || ||||| |||||||||||||
Sbjct: 2230 cgtggttttgctgtcaagttttacaccagagagg 2263

---

>dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds
          Length = 1824

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 170/210 (80%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||||| ||||| ||||| || || || || ||||| || ||||| ||||| || ||| |
Sbjct: 821  tgattcgattgctgctggtaactatcctgagtggaaactattcattcagacaatagatcc 880

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            ||| ||||| || | |||||||||||||||||||||||| |||||||| ||||| |||||
Sbjct: 881  tgagcacgaagacaaatttgactttgaccctcttgatgtaaccaagacttggcccgagga 940

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
            ||| || ||  |||| || ||||| ||  |||| ||||| |||||||| || || |||||
Sbjct: 941  cattatacccttgcagcctgttggtcgcttggtcctgaataagaacatagataacttctt 1000

                                          
Query: 631  cgcggaaaatgaacagcttgctttctgccc 660
             || || |||||||| ||||| || |||||
Sbjct: 1001 tgctgagaatgaacaacttgcattttgccc 1030



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 99
           |||||||| ||||| || ||||||||||||||||||||||| |||||||| |||||
Sbjct: 414 ggttttgctgtgaaattttacaccagagagggtaactttgatcttgttggaaacaa 469

---

>emb|Z12021.1|GMCATALG G.max gene for catalase
          Length = 4687

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 237/300 (79%)
 Strand = Plus / Plus

                                                                        
Query: 17   agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
            ||||| || ||||||||||||||  | |||||||| || || ||||||||||||||||||
Sbjct: 2359 agccccgaaaccctcagggatcccagaggttttgctgtcaaattctacaccagagagggt 2418

                                                                        
Query: 77   aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
            ||||| |||||||| || |||||  | ||||| || ||  |||| |||||  | ||||| 
Sbjct: 2419 aacttcgaccttgtgggaaacaacttccctgtcttcttcgtccgcgatggcctcaagttt 2478

                                                                        
Query: 137  cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
            ||||||||||| |||||  |||| || |  || ||| || |||| |||||||| ||||| 
Sbjct: 2479 cctgacatggttcatgccctcaaacccaacccaaagtcccacatccaggagaattggagg 2538

                                                                        
Query: 197  gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
             |  |||| ||||| || ||||| || || || || ||||||||| ||||| |||| |||
Sbjct: 2539 atccttgatttcttctcccaccatcccgaaagccttcacatgttctccttcttattcgac 2598

                                                                        
Query: 257  gatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctacacc 316
            || ||||| || || |   | || ||||| ||||| || || ||||||||||||||||||
Sbjct: 2599 gacgttggtatccctcaagattacaggcatatggatggcttcggtgtcaacacctacacc 2658



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 108/133 (81%)
 Strand = Plus / Plus

                                                                        
Query: 528  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 587
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 2870 ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 2929

                                                                        
Query: 588  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 647
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 2930 ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 2989

                         
Query: 648  ttgctttctgccc 660
            |||| || |||||
Sbjct: 2990 ttgcattttgccc 3002

---

>gb|AF295641.1| Beta vulgaris catalase (cat) mRNA, partial cds
          Length = 379

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 56  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 115
           ||||||||||||||||||||||||||||| ||||| ||||||||| | ||||||||||| 
Sbjct: 1   aagttctacaccagagagggtaactttgatcttgtggggaacaatttccctgtgtttttc 60

                                           
Query: 116 atccgagatgggatgaagttccctgacatggt 147
           || || ||||| ||||| ||||| || |||||
Sbjct: 61  attcgtgatggaatgaaattcccggatatggt 92



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 ttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgttggc 265
           ||||| || ||||| || |||||| ||||||||||||| ||||| ||||| ||| |||| 
Sbjct: 151 ttcttctctcaccatcctgagagtttgcacatgttcactttcctctttgatgatattgga 210

                                                       
Query: 266 attccactcaactataggcacatggacggttttggtgtcaacac 309
            ||||    ||||| ||||| ||||| |||| |||||| |||||
Sbjct: 211 gttcctgcaaactacaggcatatggaaggttctggtgttaacac 254

---

>gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complete cds
          Length = 1715

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 237/300 (79%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||||||||||||||  | ||||| || ||||| |||||||| |||||||||
Sbjct: 339 agccctgaaaccctcagggatcccagaggtttcgctgtgaaattctacactagagagggt 398

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||| |||||||| || |||||  | ||||| || ||  |||| |||||  | ||||| 
Sbjct: 399 aacttcgaccttgtgggaaacaacttccctgtcttcttcgtccgcgatggcctcaagttt 458

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           |||||||||||||||||| |||| || |  || ||| || |||| |||||||| ||||| 
Sbjct: 459 cctgacatggtccatgctctcaaacccaaccccaagtcccacatccaggagaattggagg 518

                                                                       
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
            |  | || ||||| || ||||| || || || || ||||||||| ||||| |||| || 
Sbjct: 519 atcctcgatttcttctcccaccatcccgaaagccttcacatgttctccttcttattcgat 578

                                                                       
Query: 257 gatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctacacc 316
           || ||||| || || |   | || ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 579 gacgttggtatccctcaagattacaggcatatggatggttttggtgttaacacttacacc 638



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 107/133 (80%)
 Strand = Plus / Plus

                                                                       
Query: 528 ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 587
           ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 850 ttgactttgacccccttgatgtaactaagacctggcctgaggacgttttgcccctccagc 909

                                                                       
Query: 588 cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 647
           | ||||| || |||||  |||| ||||||||||| || ||||| || || || ||||| |
Sbjct: 910 ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaacgaacaac 969

                        
Query: 648 ttgctttctgccc 660
           |||| || |||||
Sbjct: 970 ttgcattttgccc 982

---

>gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete sequence
          Length = 1756

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 131/159 (82%)
 Strand = Plus / Plus

                                                                        
Query: 473  tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 532
            ||||| || ||||| ||||||||||||||||| ||| |||   | |||||||  ||||||
Sbjct: 847  taccccgagtggaaacttttcatccagaccatggatcctgcagatgaggataagtttgac 906

                                                                        
Query: 533  tttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagtt 592
            |||||||| |||||||| ||||||| |||||| ||||| ||  | || |||||||| |||
Sbjct: 907  tttgacccacttgatgtgaccaagatctggcctgaggatattttgcctctgcaaccggtt 966

                                                   
Query: 593  ggacggatggtactgaacaagaacattgacaatttcttc 631
            || ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 967  ggtcgcttggttctgaacaggaccattgacaacttcttc 1005



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 415 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 474

                                                 
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccc 138
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 475 actccggtgttcttcatccgtgatgggattcagttccc 512



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 625 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 684

                
Query: 311 tacac 315
           |||||
Sbjct: 685 tacac 689

---

>dbj|D63384.1|CUSCA Cucumis sativus mRNA for catalase, partial cds, clone CRR1 and 6
          Length = 303

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 116/139 (83%)
 Strand = Plus / Plus

                                                                       
Query: 177 acatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcaca 236
           |||| |||||||| |||||| |  ||||||||||||| ||||| || || ||| || |||
Sbjct: 3   acattcaggagaattggagaatccttgacttcttttctcaccatcctgaaagtatgaaca 62

                                                                       
Query: 237 tgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggacggtt 296
           ||||||| || |||||||||||| ||||||| ||||   | || ||||||||||||||||
Sbjct: 63  tgttcacatttctatttgacgatattggcatcccacaagattacaggcacatggacggtt 122

                              
Query: 297 ttggtgtcaacacctacac 315
             ||||||||||| |||||
Sbjct: 123 caggtgtcaacacatacac 141

---

>gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds
          Length = 1779

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 157/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||||||| | ||||| || || |||||||| ||||||||||| || |||||||| 
Sbjct: 370 agccctgagaccataagggaccctcgaggttttgctgtgaagttctatactagagagggc 429

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           || |||||  | || || |||||| | || || || ||||| || ||||  |||||||||
Sbjct: 430 aattttgatatggtgggaaacaatttcccagtcttctttattcgtgatgcaatgaagttc 489

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           |||||  || ||||||||||||| || | ||||||| || | || |||||| | ||||||
Sbjct: 490 cctgatgtgatccatgctttcaaacccaatccgaagtcccatatccaggagtattggaga 549

                         
Query: 197 gtagttgacttctt 210
           || |||||||||||
Sbjct: 550 gttgttgacttctt 563



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 482 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
           |||||||||||||||||||| || ||| |||| || || || |  ||||||||||| || 
Sbjct: 835 tggaagcttttcatccagacgatggatcctgaacatgaagacaagtttgactttgatcca 894

                                                                       
Query: 542 cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
           |||||||| |||||||| ||||| ||||| ||| | ||  |||| ||||| || ||| ||
Sbjct: 895 cttgatgttaccaagacttggcctgaggatatcttgcccttgcagccagtgggccggttg 954

                                        
Query: 602 gtactgaacaagaacattgacaatttctt 630
           ||| | ||||||||||| || ||||||||
Sbjct: 955 gtattaaacaagaacatagataatttctt 983



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 276 actataggcacatggacggttttggtgt 303
           |||||||||||||||| || ||||||||
Sbjct: 629 actataggcacatggaaggctttggtgt 656

---

>dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete cds
          Length = 1833

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 162/201 (80%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||||| |||||||| || || || || || ||||| || | |||||| ||||||||| |
Sbjct: 834  tgattcaattgcagccggaaactatcctgagtggaaactctacatccaaaccattgatcc 893

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            ||||   || || ||||||||||||||||| |||||||  ||||||||||||||||||||
Sbjct: 894  tgattttgaagacagatttgactttgacccacttgatggaaccaagacctggccagagga 953

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
            | || | || || ||||||||||| ||  ||||  |||| | |||||| ||||| |||||
Sbjct: 954  cctcgtacctctccaaccagttggtcgcttggtcttgaataggaacatcgacaacttctt 1013

                                 
Query: 631  cgcggaaaatgaacagcttgc 651
             || || ||||| || |||||
Sbjct: 1014 tgctgagaatgagcaacttgc 1034



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 101/124 (81%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           |||||||| || || ||||| |||||||||||||||||||| || || ||||| ||||| 
Sbjct: 424 cgtggtttcgctgtcaagttttacaccagagagggtaacttcgatctagttggaaacaac 483

                                                                       
Query: 101 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 160
            | ||||| || || ||||| ||||| |||||||| || ||  || | ||||||||||| 
Sbjct: 484 tttcctgtcttcttcatccgtgatggaatgaagtttccagatgtgattcatgctttcaaa 543

               
Query: 161 ccaa 164
           ||||
Sbjct: 544 ccaa 547

---

>emb|X60169.1|PSCATAL Pisum sativum mRNA for catalase
          Length = 1738

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                        
Query: 524  agatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactg 583
            |||||||| |||||||| |||||||| || ||||| ||||| ||||||||||| || || 
Sbjct: 897  agatttgagtttgacccacttgatgtaactaagacttggcccgaggacatcatacccctt 956

                                                                        
Query: 584  caaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaa 643
            || || || || || |||||  ||||||||||||| || |||||||| || || ||||||
Sbjct: 957  cagcccgtaggtcgcatggtcttgaacaagaacatagataatttctttgctgagaatgaa 1016

                    
Query: 644  cagcttgc 651
            ||||||||
Sbjct: 1017 cagcttgc 1024



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||| | |||||||| || |||||||| ||||| || |||||||||||||||
Sbjct: 390 agccctgaaaccttgagggatccccgaggttttgctgtgaaattttacaccagagagggt 449

                                  
Query: 77  aactttgaccttgttgggaacaa 99
           |||| |||||||||||| |||||
Sbjct: 450 aactatgaccttgttggaaacaa 472



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 cacatgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggac 292
           ||||||||| ||||||||||||| ||||| ||  | ||||   | |||||||| ||||| 
Sbjct: 606 cacatgttctccttcctatttgatgatgtgggtgtcccacaagattataggcatatggat 665

                                   
Query: 293 ggttttggtgtcaacacctacacc 316
           |||||||| || ||||| ||||||
Sbjct: 666 ggttttggagttaacacatacacc 689

---

>gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial cds
          Length = 1134

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 134/164 (81%)
 Strand = Plus / Plus

                                                                       
Query: 497 cagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaag 556
           ||||| || ||| |||| ||||| || | |||||||||||||||||||||||| || |||
Sbjct: 264 cagacaatagatcctgagcacgaagacaaatttgactttgaccctcttgatgttactaag 323

                                                                       
Query: 557 acctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaac 616
           || ||||| |||||||| || ||  |||| || ||||| ||  |||| ||||| ||||||
Sbjct: 324 acttggcctgaggacattatacccttgcagcctgttggtcgcttggtcctgaataagaac 383

                                                       
Query: 617 attgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
           || || |||||||| || || |||||||| ||||| || |||||
Sbjct: 384 atagataatttctttgctgagaatgaacaacttgcattttgccc 427

---

>gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complete cds
          Length = 1831

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 236/300 (78%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           ||||| || ||||||||||||||  | |||||||| || || ||||||||||||||||||
Sbjct: 371 agccccgaaaccctcagggatcccagaggttttgctgtcaaattctacaccagagagggt 430

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||| |||||||| || |||||  | ||||| || ||  |||| |||||  | ||||| 
Sbjct: 431 aacttcgaccttgtgggaaacaacttccctgtcttcttcgtccgcgatggcctcaagttt 490

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           ||||||||||| |||||  |||| || |  || ||| || |||| |||||||| ||||| 
Sbjct: 491 cctgacatggttcatgccctcaaacccaaccccaagtcccacatccaggagaattggagg 550

                                                                       
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
            |  | || ||||| || ||||| || || || || ||||||||| ||||| |||| |||
Sbjct: 551 atcctcgatttcttctcccaccatcccgaaagccttcacatgttctccttcttattcgac 610

                                                                       
Query: 257 gatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctacacc 316
           || ||||| || || |   | || ||||| ||||| || || ||||||||||||||||||
Sbjct: 611 gacgttggtatccctcaagattacaggcatatggatggcttcggtgtcaacacctacacc 670



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 108/133 (81%)
 Strand = Plus / Plus

                                                                        
Query: 528  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 587
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 882  ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 941

                                                                        
Query: 588  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 647
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 942  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 1001

                         
Query: 648  ttgctttctgccc 660
            |||| || |||||
Sbjct: 1002 ttgcattttgccc 1014

---

>gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complete cds
          Length = 1733

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 236/300 (78%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           ||||| || ||||||||||||||  | |||||||| || || ||||||||||||||||||
Sbjct: 386 agccccgaaaccctcagggatcccagaggttttgctgtcaaattctacaccagagagggt 445

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||| |||||||| || |||||  | ||||| || ||  |||| |||||  | ||||| 
Sbjct: 446 aacttcgaccttgtgggaaacaacttccctgtcttcttcgtccgcgatggcctcaagttt 505

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           ||||||||||| |||||  |||| || |  || ||| || |||| |||||||| ||||| 
Sbjct: 506 cctgacatggttcatgccctcaaacccaaccccaagtcccacatccaggagaattggagg 565

                                                                       
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgac 256
            |  | || ||||| || ||||| || || || || ||||||||| ||||| |||| |||
Sbjct: 566 atcctcgatttcttctcccaccatcccgaaagccttcacatgttctccttcttattcgac 625

                                                                       
Query: 257 gatgttggcattccactcaactataggcacatggacggttttggtgtcaacacctacacc 316
           || ||||| || || |   | || ||||| ||||| || || ||||||||||||||||||
Sbjct: 626 gacgttggtatccctcaagattacaggcatatggatggcttcggtgtcaacacctacacc 685



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 108/133 (81%)
 Strand = Plus / Plus

                                                                        
Query: 528  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 587
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 897  ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 956

                                                                        
Query: 588  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 647
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 957  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 1016

                         
Query: 648  ttgctttctgccc 660
            |||| || |||||
Sbjct: 1017 ttgcattttgccc 1029

---

>gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRNA, complete cds
          Length = 1804

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           ||||||||||| || ||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 390 cgtggttttgctgtcaagttctacaccagagagggtaactttgatcttgttggaaacaat 449

---

>gb|DQ226689.1| Boechera divaricarpa isolate SLW-348-443-G06 mRNA sequence
          Length = 719

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                       
Query: 473 tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 532
           ||||| || ||||| |||||||||||||| || ||| |||   | ||||| |  ||||| 
Sbjct: 285 taccccgagtggaaacttttcatccagacgatggatcctgcggatgaggacaagtttgat 344

                                                                       
Query: 533 tttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagtt 592
           |||||||| |||||||| ||||||| |||||| ||||| ||| | || ||||||||||||
Sbjct: 345 tttgacccgcttgatgtgaccaagatctggcctgaggatatcttgcctctgcaaccagtt 404

                                                  
Query: 593 ggacggatggtactgaacaagaacattgacaatttcttc 631
           || ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 405 ggtcgcttggttctgaacaggaccattgacaacttcttc 443



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 310
           ||||| |||||||| |||||||   | || ||||| ||||| ||||| |||||| |||||
Sbjct: 63  tttgatgatgttggtattccacaagattacaggcatatggaaggtttcggtgtccacacc 122

                 
Query: 311 tacacc 316
           ||||||
Sbjct: 123 tacacc 128

---

>gb|DQ124022.1| Coffea arabica clone MN-SSH2-H06 mRNA sequence
          Length = 525

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 461 gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 520
           |||||||| || ||||| || |||||||||||||||||||| |||||| ||||| | || 
Sbjct: 196 gcagctggaaactaccctgagtggaagcttttcatccagacaattgatcctgattatgaa 255

                                                                       
Query: 521 gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 580
           || | || |||||||||||| |||||||| || ||||| ||||| ||||| ||| | || 
Sbjct: 256 gacaaatatgactttgacccacttgatgtgactaagacttggcctgaggatatcttgccc 315

                      
Query: 581 ctgcaaccagt 591
           ||||| |||||
Sbjct: 316 ctgcagccagt 326

---

>gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complete cds
          Length = 1719

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 190/239 (79%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| ||| | ||||| || || |||||||| |||||||| ||||||||||| |||
Sbjct: 371 agccctgaaaccttgagggaccctcgaggttttgccgtgaagttttacaccagagaaggt 430

                                                                       
Query: 77  aactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatgaagttc 136
           ||||||||||||||||| |||||  | || || || ||| | || ||||| |||||||| 
Sbjct: 431 aactttgaccttgttggaaacaaccttcccgtcttctttgtacgtgatggcatgaagttt 490

                                                                       
Query: 137 cctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaactggaga 196
           || || ||||| |||||| | || || | ||| |||| | |||| |||||||| ||||| 
Sbjct: 491 ccagatatggttcatgctcttaaacccaatcccaagaaccacatccaggagaattggagg 550

                                                                      
Query: 197 gtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttga 255
            |  |||||||||| || |||   || || || || ||||||||||||||  |||||||
Sbjct: 551 atccttgacttcttctctcactttccagaaagccttcacatgttcacctttttatttga 609



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 111/135 (82%)
 Strand = Plus / Plus

                                                                        
Query: 526  atttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgca 585
            |||||||||||||||||||||||| || ||||| ||||| |||||||| || ||  ||||
Sbjct: 880  atttgactttgaccctcttgatgttactaagacttggcctgaggacattatacccttgca 939

                                                                        
Query: 586  accagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaaca 645
             || ||||| ||  |||| ||||| || ||||| || |||||||| || || ||||||||
Sbjct: 940  gcctgttggtcgcttggtcctgaataaaaacatagataatttctttgctgagaatgaaca 999

                           
Query: 646  gcttgctttctgccc 660
             ||||| || |||||
Sbjct: 1000 acttgcattttgccc 1014

---

>gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds
          Length = 1761

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 103
           |||||||| || ||||| ||||||||||||||||||||||| |||||||| |||||| | 
Sbjct: 361 ggttttgctgtcaagttttacaccagagagggtaactttgatcttgttggaaacaatgtc 420

                        
Query: 104 cctgtgtttttta 116
           |||||||| ||||
Sbjct: 421 cctgtgttcttta 433

---

>emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8
          Length = 3147

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                        
Query: 122  gatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatg 181
            |||||||||||||||||||| ||||| |||||| ||||||| |  || ||  |  |||| 
Sbjct: 1278 gatgggatgaagttccctgatatggttcatgctctcaagcccaaccctaaatcacacatt 1337

                                                                        
Query: 182  caggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttc 241
            ||||| ||||||||  || |||||||||| || ||||| || |||||  |||||||||||
Sbjct: 1338 caggaaaactggaggatacttgacttcttctcacaccatcccgagagcttgcacatgttc 1397

                                                                        
Query: 242  accttcctatttgacgatgttggcattccactcaactataggcacatggacggttttggt 301
             |||||||  |||||||  ||||  ||||||   | || ||||||||||| || | ||||
Sbjct: 1398 tccttcctgcttgacgacattggtgttccacaagattacaggcacatggaaggctctggt 1457

                       
Query: 302  gtcaacaccta 312
            || ||||||||
Sbjct: 1458 gttaacaccta 1468



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 527  tttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 574
            |||||||||||||| |||||||| |||||||| ||||| || ||||||
Sbjct: 1683 tttgactttgacccacttgatgtaaccaagacttggcctgaagacatc 1730

---

>emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1 gene)
          Length = 1735

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 128 atgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggag 187
           ||||||||||| |||||||| || ||  ||||||| |  || |||||| |||| ||||||
Sbjct: 448 atgaagttcccggacatggtgcacgcgctcaagcccaaccccaagacccacatccaggag 507

                                                                       
Query: 188 aactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttc 247
           |||||| | ||  | |||||||| |||||||||||||||   || |||||||||||||||
Sbjct: 508 aactggcgcgtgctggacttcttctcgcaccacccggagtccctccacatgttcaccttc 567

                      
Query: 248 ctatttgacga 258
           || || |||||
Sbjct: 568 ctcttcgacga 578

---

>dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1, complete cds (exon 1-8)
          Length = 3711

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 167/210 (79%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||||| ||| | ||||| || || ||||| ||||| |||| ||||||||  || ||| |
Sbjct: 2106 tgattcaatttcggctggaaactatccagagtggaaactttacatccagataatggatcc 2165

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            || ||| || || | |||||||||||| || ||||| || ||||| |||||||| |||||
Sbjct: 2166 tgctcatgaagacaaatttgactttgatccacttgacgtgaccaaaacctggcccgagga 2225

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
             ||| | || ||||| |||||||| ||  ||||  |||| ||||||||||| || |||||
Sbjct: 2226 tatcctacccctgcagccagttggccgcctggtcttgaataagaacattgataacttctt 2285

                                          
Query: 631  cgcggaaaatgaacagcttgctttctgccc 660
             || || ||||| |||||||| || |||||
Sbjct: 2286 tgctgagaatgagcagcttgcattttgccc 2315



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                      
Query: 17   agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagg 74
            |||||||| |||||||||||||| || ||||| ||||||||||| |||||||||||||
Sbjct: 1421 agccctgaaaccctcagggatcctcgaggtttcgcagtgaagttttacaccagagagg 1478

---

>gb|AY726007.1| Petunia x hybrida catalase gene, partial cds
          Length = 465

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 458 attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
           ||||||||||| ||||| || |||||||| || || || ||||| || ||| ||| ||||
Sbjct: 145 attgcagctggaaattatcctgaatggaaactctttattcagactatggatcctgctcac 204

                                                                
Query: 518 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           || ||||| ||||| ||||| || |||||||| || ||||| |||||||||||
Sbjct: 205 gaagatagttttgattttgatccacttgatgtgacgaagacttggccagagga 257



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 350 aagttccattggaaacctacatgtggtgtgaagt 383
           |||||||||||||| |||||||||||||| ||||
Sbjct: 37  aagttccattggaagcctacatgtggtgtcaagt 70

---

>emb|AJ973128.1| Andrographis paniculata partial cat gene for putative catalase,
           exons 1-2
          Length = 941

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 166/209 (79%)
 Strand = Plus / Plus

                                                                       
Query: 452 gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 511
           ||||| |||||||| || || || |||||||||||||| ||||||||||| || ||| ||
Sbjct: 615 gattcaattgcagcaggaaactatccagaatggaagctgttcatccagactatagatcct 674

                                                                       
Query: 512 gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 571
           |  || ||||| || || ||||| || || || ||||| |||||||| ||||| ||||| 
Sbjct: 675 gtccatgaggacaggttcgacttcgatccgctggatgtaaccaagacttggcctgaggat 734

                                                                       
Query: 572 atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 631
           ||  | || ||||| || || ||  | |||||  ||||||||||||| ||||| || || 
Sbjct: 735 atattgcccctgcagccggtggggagaatggtgttgaacaagaacatcgacaactttttt 794

                                        
Query: 632 gcggaaaatgaacagcttgctttctgccc 660
           || || ||||| |||||||| ||||||||
Sbjct: 795 gcagagaatgagcagcttgcattctgccc 823



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 116 atccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagacc 175
           ||||||||||| || || ||||| |||||||| ||| | || ||||| | ||| ||| ||
Sbjct: 279 atccgagatggaataaaattccccgacatggttcattccttgaagccgaatcccaagtcc 338

                                                                       
Query: 176 aacatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcac 235
            |||| ||||||||||||||| |  | || |||||||| ||||| || || || || |||
Sbjct: 339 cacatccaggagaactggagaatcctggatttcttttcccaccatcccgaaagcctacac 398

                                  
Query: 236 atgttcaccttcctatttgacga 258
           |||||||||||||| || |||||
Sbjct: 399 atgttcaccttcctcttcgacga 421

---

>emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2
          Length = 1778

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 262
           |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 556 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 615

                
Query: 263 ggcat 267
           |||||
Sbjct: 616 ggcat 620

---

>emb|AJ299450.1|PPI299450 Pinus pinea partial mRNA for catalase 1 (cat1 gene)
          Length = 890

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 160/201 (79%)
 Strand = Plus / Plus

                                                                       
Query: 451 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
           ||||||||| ||||| || || || || |||||||| ||||| |||||||| || ||| |
Sbjct: 562 tgattctatagcagcaggcaactatcctgaatggaaactttttatccagacaatggatcc 621

                                                                       
Query: 511 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           |    | ||||||| || ||||||||| ||| | ||||| || || || ||||| |||||
Sbjct: 622 tcgggatgaggataaatatgactttgatcctttagatgttacgaaaacttggcccgagga 681

                                                                       
Query: 571 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
            ||| | || || ||||| || ||||| |||||  |||||||||| ||||||||||||||
Sbjct: 682 tatctttcctcttcaacctgtaggacgcatggtcttgaacaagaatattgacaatttctt 741

                                
Query: 631 cgcggaaaatgaacagcttgc 651
            || ||||| || ||||||||
Sbjct: 742 tgctgaaaacgagcagcttgc 762



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 203/259 (78%)
 Strand = Plus / Plus

                                                                       
Query: 53  gtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttt 112
           ||||| ||||||||||||||||| ||||| || |||||||| || ||| | ||||| || 
Sbjct: 164 gtgaaattctacaccagagaggggaacttcgatcttgttggaaataattttcctgtattc 223

                                                                       
Query: 113 tttatccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaag 172
           ||| | || ||||| |||||||| || |||||||| ||||| || || |||| ||| || 
Sbjct: 224 tttgttcgcgatggtatgaagtttccagacatggttcatgcattgaaaccaaatcccaaa 283

                                                                       
Query: 173 accaacatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctg 232
           |   |||| || ||  |||||||  |  | || ||||| || |||||||| |||||| ||
Sbjct: 284 agtcacattcaagaagactggaggattctagatttcttctctcaccacccagagagtttg 343

                                                                       
Query: 233 cacatgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggac 292
           || ||||||||||| || ||||| ||| |||| || ||  | ||||| ||||| ||||| 
Sbjct: 344 catatgttcacctttctctttgatgatcttggaatccctttaaactacaggcatatggat 403

                              
Query: 293 ggttttggtgtcaacacct 311
           || | ||||||| ||||||
Sbjct: 404 gggtctggtgtccacacct 422



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 350 aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagc 402
           ||||| |||||||  ||||| ||||| || ||||| || ||||||||||||||
Sbjct: 461 aagtttcattggaggcctacttgtggagttaagtgtctattggatgatgaagc 513

---

>emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene
          Length = 3662

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 203  gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 262
            |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 2399 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 2458

                 
Query: 263  ggcat 267
            |||||
Sbjct: 2459 ggcat 2463

---

>gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, complete cds
          Length = 1824

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 163/205 (79%)
 Strand = Plus / Plus

                                                                        
Query: 451  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 510
            |||| ||||| || |||| || ||||| || |||||||||||||||||||| || ||| |
Sbjct: 810  tgatgctatttcatctggtaactaccctgagtggaagcttttcatccagacgatggatcc 869

                                                                        
Query: 511  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
            || | | |||||||  ||||| || ||||| |||||||| ||||||| |||||| |||||
Sbjct: 870  tgctgatgaggataagtttgatttcgacccgcttgatgtgaccaagatctggcctgagga 929

                                                                        
Query: 571  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 630
             ||  | ||  ||||||||||||| ||  |||| || |||| || |||||| || |||||
Sbjct: 930  tattctgcctttgcaaccagttggtcgcttggttctcaacaggaccattgataacttctt 989

                                     
Query: 631  cgcggaaaatgaacagcttgctttc 655
                |||| ||| ||||||||||||
Sbjct: 990  taatgaaactgagcagcttgctttc 1014



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 56  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 115
           ||||| |||||||||||||| |||||||| |||||||| ||||| |  || ||||| || 
Sbjct: 415 aagttttacaccagagaggggaactttgatcttgttggtaacaacactccagtgttcttc 474

                                                                       
Query: 116 atccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagacc 175
           ||||| || |||||  ||||||| ||  | ||||||||  | ||||| |  |||||||| 
Sbjct: 475 atccgtgacgggatccagttcccggatgttgtccatgccctgaagccgaacccgaagaca 534

                               
Query: 176 aacatgcaggagaactggag 195
           ||||| |||||| |||||||
Sbjct: 535 aacatccaggagtactggag 554

---

>gb|AY110648.1| Zea mays CL1739_1 mRNA sequence
          Length = 1813

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 262
           |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 570 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 629

                
Query: 263 ggcat 267
           |||||
Sbjct: 630 ggcat 634

---

>gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1-like protein
           mRNA, complete cds
          Length = 1746

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 103
           |||||||| || ||||| ||||||||||||||||||||||| || ||||| |||||| | 
Sbjct: 401 ggttttgctgtcaagttttacaccagagagggtaactttgatctagttggaaacaatgtc 460

                        
Query: 104 cctgtgtttttta 116
           |||||||| ||||
Sbjct: 461 cctgtgttcttta 473

---

>gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1-like protein
           mRNA, complete cds
          Length = 1525

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 103
           |||||||| || ||||| ||||||||||||||||||||||| || ||||| |||||| | 
Sbjct: 404 ggttttgctgtcaagttttacaccagagagggtaactttgatctagttggaaacaatgtc 463

                        
Query: 104 cctgtgtttttta 116
           |||||||| ||||
Sbjct: 464 cctgtgttcttta 476

---

>gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end
          Length = 1793

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 262
           |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 568 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 627

                
Query: 263 ggcat 267
           |||||
Sbjct: 628 ggcat 632

---

>ref|XM_470174.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1626

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 482 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
           |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 799 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 858

                                                                       
Query: 542 cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
           || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 859 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 918

                                                                      
Query: 602 gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
           || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 919 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 977



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 520 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 566

---

>gb|AF332973.2| Zantedeschia aethiopica catalase 2 (Cat2) mRNA, complete cds
          Length = 1854

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaggggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccag 69
           ||||||||||||||| ||| ||||||| ||| | || ||||| ||||| || ||||||||
Sbjct: 380 gaggggaagccctgaaaccatcagggacccaagaggctttgctgtgaaattttacaccag 439

                      
Query: 70  agagggtaact 80
           |||||||||||
Sbjct: 440 agagggtaact 450



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 275 aactataggcacatggacggttttggtgtcaacacctacaccttaatca 323
           ||||| ||||||||||| || || || ||||||||||||||||| ||||
Sbjct: 645 aactacaggcacatggaaggcttcggcgtcaacacctacaccttcatca 693



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                        
Query: 529  tgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacc 588
            |||||| ||||| || || | ||||||||||||||| |||||| |  |||| ||||| ||
Sbjct: 899  tgacttcgacccactggacgacaccaagacctggccggaggacctgctccccctgcagcc 958

                                                       
Query: 589  agttggacggatggtactgaacaagaacattgacaatttcttc 631
            ||| || ||  |||| || |||| |||||| ||||| ||||||
Sbjct: 959  agtgggccgcctggttctcaacaggaacatcgacaacttcttc 1001

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                           
Query: 482     tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
               |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1768901 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1768842

                                                                           
Query: 542     cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
               || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1768841 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1768782

                                                                          
Query: 602     gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
               || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1768781 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1768723



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 203     gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
               |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1769180 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 1769134

---

>gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase mRNA, complete cds
          Length = 1861

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 482  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 882  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 941

                                                                        
Query: 542  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 942  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1001

                                                                       
Query: 602  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1002 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1060



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 603 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 649

---

>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08,
             complete sequence
          Length = 133090

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                         
Query: 482   tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
             |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 65461 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 65520

                                                                         
Query: 542   cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
             || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 65521 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 65580

                                                                        
Query: 602   gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
             || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 65581 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 65639



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 203   gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
             |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 65182 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 65228

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                           
Query: 482     tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
               |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1768899 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1768840

                                                                           
Query: 542     cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
               || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1768839 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1768780

                                                                          
Query: 602     gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
               || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1768779 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1768721



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 203     gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
               |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1769178 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 1769132

---

>dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060B21, full
            insert sequence
          Length = 1945

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 482  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1008 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1067

                                                                        
Query: 542  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1068 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1127

                                                                       
Query: 602  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1128 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1186



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 729 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 775

---

>dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C11, full
            insert sequence
          Length = 1763

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 482  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 860  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 919

                                                                        
Query: 542  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 920  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 979

                                                                       
Query: 602  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 980  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1038



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 581 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 627

---

>dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds
          Length = 1778

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 482  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 833  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 892

                                                                        
Query: 542  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 893  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 952

                                                                       
Query: 602  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 953  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1011



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 554 gacttcttgtcccaccacccggagagcctccacatgttcaccttcct 600

---

>dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene for catalase,
            complete cds
          Length = 4167

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 482  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 2594 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 2653

                                                                        
Query: 542  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 601
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 2654 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 2713

                                                                       
Query: 602  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 660
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 2714 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 2772



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 203  gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 249
            |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 2315 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 2361

---

>gb|AF139539.2|AF139539 Raphanus sativus catalase 3 (Cat3) mRNA, complete cds
          Length = 1801

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 56  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 115
           |||||||||||||||||||| |||||||| |||||||| ||||| |  ||||| || || 
Sbjct: 416 aagttctacaccagagaggggaactttgatcttgttggtaacaacactcctgtcttcttc 475

                                     
Query: 116 atccgagatgggatgaagttccctga 141
           ||||| || |||||  ||||||||||
Sbjct: 476 atccgtgacgggattcagttccctga 501



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 276 actataggcacatggacggttttggtgtcaacacctacac 315
           |||||||||||||||| ||||| |||||| ||||||||||
Sbjct: 636 actataggcacatggaaggtttcggtgtccacacctacac 675



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 473 tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 532
           ||||| || |||||||||||||||||||| || ||| |||   | |||||||  || || 
Sbjct: 833 taccctgagtggaagcttttcatccagacaatggatcctgcggatgaggataagttcgat 892

                                                 
Query: 533 tttgaccctcttgatgtcaccaagacctggccagagga 570
           || ||||| |||||||| ||||||| |||||| |||||
Sbjct: 893 ttcgacccgcttgatgtgaccaagatctggcctgagga 930

---

>dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT29P11, TM0193,
             complete sequence
          Length = 102354

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                       
Query: 17    agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagg 74
             |||||||| ||| | |||||||| ||||||||||| |||||||| |||||||||||||
Sbjct: 67474 agccctgaaaccttgagggatcctcgtggttttgctgtgaagttttacaccagagagg 67417



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 180/229 (78%)
 Strand = Plus / Minus

                                                                         
Query: 72    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 131
             ||||||||||||||||||| || |||||  | ||||| || ||  | || ||||| ||||
Sbjct: 66572 agggtaactttgaccttgtgggaaacaacttccctgtcttcttcgtacgtgatggcatga 66513

                                                                         
Query: 132   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 191
             | || || || |||||||||||| | ||||| | ||| ||| |  |||| |||||||| |
Sbjct: 66512 aatttccagatatggtccatgctctgaagcccaatcccaagtctcacatccaggagaatt 66453

                                                                         
Query: 192   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 251
             ||||| |  |||||||||| || |||   || || || || || ||||||||||| ||||
Sbjct: 66452 ggagaatccttgacttcttctcccactttccagaaagccttcatatgttcacctttctat 66393

                                                              
Query: 252   ttgacgatgttggcattccactcaactataggcacatggacggttttgg 300
             |||| ||||| ||  ||||||   | |||||||||||||| ||||||||
Sbjct: 66392 ttgatgatgtgggtgttccacaagattataggcacatggatggttttgg 66344

---

>gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C mRNA, complete cds
          Length = 1503

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 262
           |||||||| || |||||||||||||| || ||||||||||||||||| || |||||  | 
Sbjct: 518 gacttcttctcccaccacccggagagcctccacatgttcaccttcctcttcgacgacatc 577

                                                                
Query: 263 ggcattccactcaactataggcacatggacggttttggtgtcaacacctacac 315
           ||||| ||   | ||||  | |||||||||||||  || ||||||||||||||
Sbjct: 578 ggcatccccgccgactaccgccacatggacggttccggcgtcaacacctacac 630



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 482 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 541
           |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 796 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 855

                                                       
Query: 542 cttgatgtcaccaagacctggccagaggacatcatcccactgca 585
           || || ||||||||||| ||||| ||||||||| |||| |||||
Sbjct: 856 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgca 899

---

>gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, complete cds
          Length = 1837

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           |||||||| || || || ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 406 ggttttgctgtcaaattttacaccagagagggtaactttgatcttgttggaaacaat 462



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 530 gactttgaccctcttgatgtcaccaagacctggccagagga 570
           ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 892 gactttgaccctcttgacgtaaccaagacctggcctgagga 932

---

>gb|AF096252.1|AF096252 Lycopersicon esculentum ethylene-responsive catalase (ER60) mRNA,
           partial cds
          Length = 270

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 455 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 514
           |||| ||||||||| ||||| || ||||||||| | ||||| ||||| || ||| | |||
Sbjct: 133 tctactgcagctggaaattatcctgaatggaagatcttcattcagactatggatccggat 192

                                                                
Query: 515 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccaga 567
           || || || |||||||||||||| || |||||||| || || || ||||||||
Sbjct: 193 catgaagacagatttgactttgatccacttgatgtgacaaaaacttggccaga 245

---

>gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA, partial cds
          Length = 1286

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 207/265 (78%)
 Strand = Plus / Plus

                                                                       
Query: 62  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 121
           |||||||||||||||||||||||||| || || |||||  | || || || ||  |||| 
Sbjct: 203 tacaccagagagggtaactttgacctcgtcggaaacaacttccccgtcttcttcgtccgt 262

                                                                       
Query: 122 gatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatg 181
           |||||  | |||||||| ||||||||||| ||  |||| || | ||| ||| || |||| 
Sbjct: 263 gatggcctcaagttccccgacatggtccacgccctcaaacccaatcccaagtcccacatc 322

                                                                       
Query: 182 caggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttc 241
           |||||||| |||||  |  | || ||||| || |||||||| || || || |||||||||
Sbjct: 323 caggagaattggaggatcctcgatttcttctcccaccaccccgaaagccttcacatgttc 382

                                                                       
Query: 242 accttcctatttgacgatgttggcattccactcaactataggcacatggacggttttggt 301
            ||||| | || || || || || || || |   | || ||||||||||| |||||||||
Sbjct: 383 tccttcttgttcgatgacgtgggtatcccccaggattacaggcacatggatggttttggt 442

                                    
Query: 302 gtcaacacctacaccttaatcagca 326
           |||||||| |||||| | |||||||
Sbjct: 443 gtcaacacatacaccctcatcagca 467

---

>gb|AF170272.1|AF170272 Manihot esculenta catalase CAT1 mRNA, complete cds
          Length = 1792

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 17  agccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagagggt 76
           |||||||| || ||||||||||| || ||||||||    |||||||||||||||||||| 
Sbjct: 355 agccctgaaacactcagggatcctcgaggttttgcgactaagttctacaccagagagggc 414

                   
Query: 77  aactttga 84
           ||||||||
Sbjct: 415 aactttga 422

---

>gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, partial cds
          Length = 1728

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 125/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 456 ctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatc 515
           |||||||  |||| || ||||| || ||||||||||| || ||||| || ||| |||   
Sbjct: 813 ctattgcgtctggtaactaccctgagtggaagctttttattcagacaatggatcctgcgg 872

                                                                       
Query: 516 acgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatca 575
           | |||||||  |||||||| ||||| |||||||| ||||||| |||||| ||||| ||| 
Sbjct: 873 atgaggataagtttgacttcgacccgcttgatgtgaccaagatctggcctgaggatatct 932

                                               
Query: 576 tcccactgcaaccagttggacggatggtactgaaca 611
           | || ||||| || ||||| ||| |||| |||||||
Sbjct: 933 tgcctctgcagcctgttggtcggttggttctgaaca 968



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 56  aagttctacaccagagagggtaactttgaccttgttgggaacaa 99
           ||||| |||||||||||||| |||||||| || ||||| |||||
Sbjct: 413 aagttttacaccagagaggggaactttgatctcgttggaaacaa 456



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 276 actataggcacatggacggttttggtgtcaacacctacac 315
           |||| ||||||||||| ||||| || ||| ||||||||||
Sbjct: 633 actacaggcacatggaaggtttcggcgtccacacctacac 672

---

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                          
Query: 35     gatccacgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttggg 94
              ||||||||||||||||| ||||||||||||||   ||| |||||||  || ||||| || 
Sbjct: 986651 gatccacgtggttttgccgtgaagttctacacagaagatggtaactacgatcttgtaggc 986592

                                     
Query: 95     aacaatatgcctgtgttttttat 117
              || ||||  ||||||||||||||
Sbjct: 986591 aataatacccctgtgttttttat 986569

---

>emb|AJ005939.1|MBA005939 Methanosarcina barkeri kat gene
          Length = 1846

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 35  gatccacgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttggg 94
           ||||||||||||||||| ||||||||||||||   ||| |||||||  || ||||| || 
Sbjct: 566 gatccacgtggttttgccgtgaagttctacacagaagatggtaactacgatcttgtaggc 625

                                  
Query: 95  aacaatatgcctgtgttttttat 117
           || ||||  ||||||||||||||
Sbjct: 626 aataatacccctgtgttttttat 648

---

>gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid binding catalase mRNA, partial
           cds
          Length = 1860

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 99
           ||||||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 350 cgtggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 408



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 530 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 839 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 898

                                 
Query: 590 gttggacggatggtactgaaca 611
           ||||||||  ||||||| ||||
Sbjct: 899 gttggacgattggtacttaaca 920

---

>gb|AF069320.1|AF069320 Mesembryanthemum crystallinum root catalase mRNA, complete cds
          Length = 1847

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 32  agggatccacgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgtt 91
           |||||||| |||||||||||  | ||||||||||| |||||||||||||| ||  | || 
Sbjct: 446 agggatcctcgtggttttgctctcaagttctacactagagagggtaacttcgatttagta 505

                                  
Query: 92  gggaacaatatgcctgtgttttt 114
           || |||||| | |||||||||||
Sbjct: 506 ggaaacaatttccctgtgttttt 528



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                        
Query: 458  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 517
            |||||||||||||||||||| || |||| | | ||||| || || || ||| |||   | 
Sbjct: 875  attgcagctgggaattaccctgagtggaggttgttcattcaaacaatggatcctgcagat 934

                                                                        
Query: 518  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 577
            || |||| ||| |||||||||||  | ||| | |||||||| ||||||||||||||  | 
Sbjct: 935  gaagataaattcgactttgacccgttagatattaccaagacatggccagaggacattctg 994

                                                           
Query: 578  ccactgcaaccagttggacggatggtactgaacaagaacattgacaa 624
            || ||||| ||||| || ||  ||||  ||||||||||||| |||||
Sbjct: 995  cccctgcagccagtgggtcgtttggtgttgaacaagaacatcgacaa 1041

---

>gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase (CAT-1) mRNA, complete
           cds
          Length = 1897

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 41  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 99
           ||||||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 386 cgtggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 444



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 530 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 875 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 934

                                 
Query: 590 gttggacggatggtactgaaca 611
           ||||||||  ||||||| ||||
Sbjct: 935 gttggacgattggtacttaaca 956

---

>gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA, partial cds
          Length = 1416

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                     
Query: 41 cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 99
          ||||||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 31 cgtggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 89



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 530 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 589
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 520 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 579

                                 
Query: 590 gttggacggatggtactgaaca 611
           ||||||||  ||||||| ||||
Sbjct: 580 gttggacgattggtacttaaca 601

---

>dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds
          Length = 1573

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 128 atgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggag 187
           ||||||||||| |||||||| || ||  ||||||| |  || |||||| |||| ||||||
Sbjct: 467 atgaagttcccggacatggtgcacgcgctcaagcccaaccccaagacccacatccaggag 526

                                                                       
Query: 188 aactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttc 247
           |||||| |  |  | |||||||| || ||||||||||||   || |||||||||||||||
Sbjct: 527 aactggcggatcctcgacttcttctcccaccacccggagtcgctccacatgttcaccttc 586

                      
Query: 248 ctatttgacga 258
           || || |||||
Sbjct: 587 ctcttcgacga 597

---

>emb|AJ616025.1| Homogyne alpina mRNA for catalase (cat1 gene)
          Length = 1779

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 117/146 (80%)
 Strand = Plus / Plus

                                                                        
Query: 503  attgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctgg 562
            |||||| ||||||| || ||| |  ||||||||||||| |||||||  || | ||| |||
Sbjct: 874  attgatcctgatcatgaagatcggcttgactttgacccgcttgatgggacaatgacatgg 933

                                                                        
Query: 563  ccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgac 622
            || || |||||||| ||  |||| || |||||| |||||||  |||| ||||| || |||
Sbjct: 934  cctgatgacatcattcctttgcagcctgttggaaggatggttttgaataagaatatcgac 993

                                      
Query: 623  aatttcttcgcggaaaatgaacagct 648
            || ||||| || || |||||||||||
Sbjct: 994  aacttctttgctgagaatgaacagct 1019



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 69  gagagggtaactttgaccttgttgggaacaat 100
           ||||||||||||||||  ||||||| ||||||
Sbjct: 440 gagagggtaactttgatattgttggaaacaat 471

---

>gb|DQ004737.1| Phaseolus lunatus catalase (CAT1) mRNA, partial cds
          Length = 627

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 281 aggcacatggacggttttggtgtcaacacctacaccttaatcagca 326
           ||||||||||| ||||||||||||||||| |||||| | |||||||
Sbjct: 61  aggcacatggatggttttggtgtcaacacttacaccctcatcagca 106



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 526 atttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           ||||||||||||||| |||||||| || |||| |||||| |||||
Sbjct: 306 atttgactttgacccacttgatgtaactaagatctggcctgagga 350

---

>gb|AY507670.1| Malus x domestica catalase (CAT) mRNA, partial cds
          Length = 255

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttga 255
           |||||||| || ||||| || |||||  |||||||||||||||||||||||||
Sbjct: 127 gacttcttctcacaccatccagagagcttgcacatgttcaccttcctatttga 179

---

>gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, complete cds
          Length = 1772

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 56  aagttctacaccagagagggtaactttgaccttgttgggaacaat 100
           |||||||||| ||||| |||||||||||| |||||||| ||||||
Sbjct: 375 aagttctacaacagagggggtaactttgatcttgttggaaacaat 419



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 452 gattctattgcagctgggaattacccagaatggaagcttttcatcca 498
           ||||| ||||||||||| || || || || |||||||||||||||||
Sbjct: 771 gattcaattgcagctggaaactatcctgagtggaagcttttcatcca 817

---

>emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 gene)
          Length = 1716

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 99
           |||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 406 ggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 461



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 524 agatttgactttgaccctcttgatgtcaccaagacctggccagagga 570
           ||||| |||||||| ||||||||||| ||||||| |||||| |||||
Sbjct: 886 agattcgactttgatcctcttgatgtaaccaagatctggcctgagga 932

---

>gb|U89384.1|PAU89384 Pseudomonas aeruginosa paraquat inducible catalase isozyme B
           (katB), ankyrin (ankB) and (radA) genes, complete cds
          Length = 5246

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 116 atccgagatgggatgaagttccctgacatggtccatgctttcaagcc 162
           ||||| |||| ||| |||||||| |||||||||||||| ||||||||
Sbjct: 813 atccgcgatgcgatcaagttcccggacatggtccatgccttcaagcc 859

---

>gb|U34896.1|PAU34896 Pseudomonas aeruginosa catalase (katB) gene, complete cds
          Length = 2086

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 116 atccgagatgggatgaagttccctgacatggtccatgctttcaagcc 162
           ||||| |||| ||| |||||||| |||||||||||||| ||||||||
Sbjct: 813 atccgcgatgcgatcaagttcccggacatggtccatgccttcaagcc 859

---

>emb|Y13220.1|CRCATALAS Chlamydomonas reinhardtii mRNA for catalase
          Length = 1934

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 527  tttgactttgaccctcttgatgtcaccaagacctggcc 564
            ||||||||||||||||| || || ||||||||||||||
Sbjct: 1020 tttgactttgaccctctggacgtgaccaagacctggcc 1057



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgct 154
           ||||| ||||| ||||| || ||||| || || ||||||||||| |||||||| || || 
Sbjct: 588 aacaacatgccggtgttcttcatccgcgacggcatgaagttcccggacatggttcacgcc 647

                   
Query: 155 ttcaagcc 162
           ||||||||
Sbjct: 648 ttcaagcc 655

---

>gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA, complete cds
          Length = 1871

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 14  ggaagccctgagaccctcagggatccacgtggttttgcagtgaagttctacaccagagag 73
           ||||||||||| ||| |||| || ||  | |||||||||   ||||| || |||||||||
Sbjct: 368 ggaagccctgaaaccatcagagaccccagaggttttgcaacaaagttttataccagagag 427

                                     
Query: 74  ggtaactttgaccttgttgggaacaa 99
           |||||||||||  |||| ||||||||
Sbjct: 428 ggtaactttgatattgtggggaacaa 453



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 97/121 (80%)
 Strand = Plus / Plus

                                                                        
Query: 528  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 587
            ||||||||||||| || |||| ||||| ||||||||| |||||  | || || ||||| |
Sbjct: 882  ttgactttgacccgctcgatggcaccatgacctggcctgaggatgtgataccgctgcagc 941

                                                                        
Query: 588  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 647
            | || || || |||||  |||| ||||| ||||| || ||||| || || ||||||||||
Sbjct: 942  ctgtcgggcgtatggtgttgaataagaatattgataacttctttgctgagaatgaacagc 1001

             
Query: 648  t 648
            |
Sbjct: 1002 t 1002

---

>gb|AF016902.1|AF016902 Chlamydomonas reinhardtii catalase (CAT) mRNA, complete cds
          Length = 1835

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 527 tttgactttgaccctcttgatgtcaccaagacctggcc 564
           ||||||||||||||||| || || ||||||||||||||
Sbjct: 915 tttgactttgaccctctggacgtgaccaagacctggcc 952



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgct 154
           ||||| ||||| ||||| || ||||| || || ||||||||||| |||||||| || || 
Sbjct: 483 aacaacatgccggtgttcttcatccgcgacggcatgaagttcccggacatggttcacgcc 542

                   
Query: 155 ttcaagcc 162
           ||||||||
Sbjct: 543 ttcaagcc 550

---

>gb|BC051626.1| Danio rerio catalase, mRNA (cDNA clone MGC:56675 IMAGE:6033748),
           complete cds
          Length = 2260

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 35  gatccacgtggttttgcagtgaagttctacacc 67
           ||||| |||||||| ||||||||||||||||||
Sbjct: 496 gatcctcgtggtttcgcagtgaagttctacacc 528

---

>gb|AF170069.1| Danio rerio catalase mRNA, complete cds
          Length = 1636

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 35  gatccacgtggttttgcagtgaagttctacacc 67
           ||||| |||||||| ||||||||||||||||||
Sbjct: 382 gatcctcgtggtttcgcagtgaagttctacacc 414

---

>emb|AJ007505.1|DRE7505 Danio rerio mRNA for catalase
          Length = 2272

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 35  gatccacgtggttttgcagtgaagttctacacc 67
           ||||| |||||||| ||||||||||||||||||
Sbjct: 480 gatcctcgtggtttcgcagtgaagttctacacc 512

---

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                          
Query: 54     tgaagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttt 113
              |||||||||||||||| ||||| ||||  ||||| || || ||||| | ||| ||||| |
Sbjct: 940017 tgaagttctacaccagcgagggcaactacgacctcgtcggcaacaacacgccggtgttct 939958

                                       
Query: 114    ttatccgagatgggatgaagttccc 138
              ||||||| |||  |||||| |||||
Sbjct: 939957 ttatccgcgatccgatgaaattccc 939933



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                          
Query: 54     tgaagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttt 113
              |||||||||||||||| ||||| ||||  ||||| || || ||||| | ||| ||||| |
Sbjct: 889089 tgaagttctacaccagcgagggcaactacgacctcgtcggcaacaacacgccggtgttct 889030

                                       
Query: 114    ttatccgagatgggatgaagttccc 138
              ||||||| |||  |||||| |||||
Sbjct: 889029 ttatccgcgatccgatgaaattccc 889005

---

>emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (partial)
          Length = 4272

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 72   agggtaactttgaccttgttgggaacaatatgcctgtgtttttta 116
            ||||||||||||| |||||||| |||||| | |||||||| ||||
Sbjct: 2019 agggtaactttgatcttgttggaaacaatgtccctgtgttcttta 2063

---

>emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene)
          Length = 1781

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 527 tttgactttgaccctcttgatgtcaccaagacctggccagaggac 571
           |||||||||||||| || |||| ||||||||| ||||| ||||||
Sbjct: 923 tttgactttgacccgctggatgacaccaagacgtggcccgaggac 967



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 93/116 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 262
           |||||| |||| |||||||| ||||| || ||||  |||  |||||| || |||||||| 
Sbjct: 599 gacttcctttcccaccaccccgagagcctccacaccttcttcttcctcttcgacgatgtc 658

                                                                   
Query: 263 ggcattccactcaactataggcacatggacggttttggtgtcaacacctacacctt 318
           ||||| ||   | ||||  | ||||||||||| || || |||||||||||||||||
Sbjct: 659 ggcatccccaccgactaccgccacatggacggcttcggcgtcaacacctacacctt 714

---

>ref|NM_130912.1| Danio rerio catalase (cat), mRNA
          Length = 2260

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 35  gatccacgtggttttgcagtgaagttctacacc 67
           ||||| |||||||| ||||||||||||||||||
Sbjct: 496 gatcctcgtggtttcgcagtgaagttctacacc 528

---

>ref|XM_365841.1| Magnaporthe grisea 70-15 hypothetical protein (MG10061.4) partial
           mRNA
          Length = 2232

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 293 ggttttggtgtcaacacctacacc 316
           ||||||||||||||||||||||||
Sbjct: 706 ggttttggtgtcaacacctacacc 729

---

>emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase
          Length = 1691

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 44  ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 99
           |||||||| || || || |||||||||||||| |||||||| || ||||| |||||
Sbjct: 380 ggttttgctgtcaaattttacaccagagaggggaactttgatctggttggaaacaa 435

---

>ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1
           mRNA
          Length = 1874

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 673 cacatggacggcttcggcgtcaacacctacacctt 707

---

>ref|XM_463869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1874

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 673 cacatggacggcttcggcgtcaacacctacacctt 707

---

>ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1
           mRNA
          Length = 1876

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 675 cacatggacggcttcggcgtcaacacctacacctt 709

---

>gb|DQ493908.1| Anguilla anguilla catalase mRNA, partial cds
          Length = 779

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 44  ggttttgcagtgaagttctacac 66
           |||||||||||||||||||||||
Sbjct: 478 ggttttgcagtgaagttctacac 500

---

>gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome
          Length = 2575032

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 32     agggatccacgtggttttgcagtgaagttctacac 66
              ||||||||||||||||||||  | |||||||||||
Sbjct: 523021 agggatccacgtggttttgctataaagttctacac 522987

---

>emb|Z99108.2|BSUB0005 Bacillus subtilis complete genome (section 5 of 21): from 813670 to
              1011078
          Length = 197409

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 95     aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 141
              ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 146275 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 146229

---

>emb|Z82044.1|BSZ82044 Bacillus subtilis 25 kb genomic DNA segment (from sspE to katA)
          Length = 24524

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 95    aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 141
             ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 24146 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 24100

---

>emb|Z54143.2|SSCATMR Secale cereale mRNA for catalase (cat1a gene)
          Length = 1747

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 676 cacatggacggcttcggcgtcaacacctacacctt 710

---

>emb|X97673.1|XOKATX X.oryzae katX gene
          Length = 2935

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 95  aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgc 153
           |||||||| || |||||||| ||||  |||| ||| |||||||||||| || |||||||
Sbjct: 863 aacaatatcccggtgtttttcatccaggatgcgatcaagttccctgacctgatccatgc 921

---

>emb|X61626.1|OSCATAL O.sativa mRNA for catalase
          Length = 1865

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 632 cacatggacggcttcggcgtcaacacctacacctt 666

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 95      aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgc 153
               |||||||| || |||||||| ||||  |||| ||| |||||||||||| || |||||||
Sbjct: 3653891 aacaatatcccggtgtttttcatccaggatgcgatcaagttccctgacctgatccatgc 3653949

---

>gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds
          Length = 2036

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                       
Query: 62  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 121
           |||||||||||||| ||||||||  |||| ||||||||  | || || || || || || 
Sbjct: 389 tacaccagagaggggaactttgatattgtggggaacaacttccccgtcttcttcattcgc 448

                                                      
Query: 122 gatgggatgaagttccctgacatggtccatgctttcaagccaa 164
           |||| ||| || ||||||||| || | |||||||| |||||||
Sbjct: 449 gatgcgatcaaattccctgacgtgattcatgcttttaagccaa 491

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 284    cacatggacggttttggtgtcaacacctacacctt 318
              ||||||||||| || || |||||||||||||||||
Sbjct: 826682 cacatggacggcttcggcgtcaacacctacacctt 826648

---

>gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds
          Length = 1754

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                       
Query: 62  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 121
           |||||||||||||| ||||||||  |||| ||||||||  | || || || || || || 
Sbjct: 399 tacaccagagaggggaactttgatattgtggggaacaacttccccgtcttcttcattcgc 458

                                                      
Query: 122 gatgggatgaagttccctgacatggtccatgctttcaagccaa 164
           |||| ||| || ||||||||| || | |||||||| |||||||
Sbjct: 459 gatgcgatcaaattccctgacgtgattcatgcttttaagccaa 501

---

>dbj|AB046412.1| Bacillus subtilis katA gene for catalase, complete cds
          Length = 1827

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 95  aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 141
           ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 547 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 593

---

>gb|AE004875.1| Pseudomonas aeruginosa PAO1, section 436 of 529 of the complete
            genome
          Length = 10429

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 116  atccgagatgggatgaagttccctgacatggtccatgctttcaagcc 162
            ||||| |||| ||| |||||||| || ||||||||||| ||||||||
Sbjct: 5257 atccgcgatgcgatcaagttcccggatatggtccatgccttcaagcc 5211

---

>dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1442_E05
          Length = 162407

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 284   cacatggacggttttggtgtcaacacctacacctt 318
             ||||||||||| || || |||||||||||||||||
Sbjct: 35890 cacatggacggcttcggcgtcaacacctacacctt 35856

---

>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0036E06
          Length = 137926

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 284    cacatggacggttttggtgtcaacacctacacctt 318
              ||||||||||| || || |||||||||||||||||
Sbjct: 104813 cacatggacggcttcggcgtcaacacctacacctt 104779

---

>emb|AJ234404.1|HVU234404 Hordeum vulgare partial mRNA; clone cMWG0652.uni
          Length = 525

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 92  cacatggacggcttcggcgtcaacacctacacctt 126

---

>dbj|AK099923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116M08, full
           insert sequence
          Length = 1875

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 674 cacatggacggcttcggcgtcaacacctacacctt 708

---

>dbj|AK099231.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095I04, full
           insert sequence
          Length = 1873

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 672 cacatggacggcttcggcgtcaacacctacacctt 706

---

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 77/95 (81%)
 Strand = Plus / Minus

                                                                           
Query: 56      aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 115
               |||||||||||| | || || ||||  ||||| || || |||||  |||| ||||| || 
Sbjct: 1984944 aagttctacacccgcgaaggcaactgggacctggtcggcaacaacctgccggtgttcttc 1984885

                                                  
Query: 116     atccgagatgggatgaagttccctgacatggtcca 150
               ||||| || | |||||||||||| |||||||||||
Sbjct: 1984884 atccgcgacgcgatgaagttcccggacatggtcca 1984850

---

>dbj|AK065094.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M08, full
           insert sequence
          Length = 1873

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 672 cacatggacggcttcggcgtcaacacctacacctt 706

---

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                           
Query: 44      ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 103
               |||||||| |||||| |||| |||  ||| || ||||  ||||||||||| ||||| |||
Sbjct: 1249100 ggttttgccgtgaagctctataccgaagaaggcaactgggaccttgttggcaacaacatg 1249041

                                                              
Query: 104     cctgtgttttttatccgagatgggatgaagttccctgacatggtcca 150
               || || ||||| ||||  || |  || |||||||| |||||||||||
Sbjct: 1249040 cccgtctttttcatccaggacgccatcaagttcccggacatggtcca 1248994

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 95      aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgc 153
               |||||||| || |||||||| ||||  |||| ||| |||||||||||| || |||||||
Sbjct: 3651320 aacaatatcccggtgtttttcatccaggatgcgatcaagttccctgacctgatccatgc 3651378

---

>gb|AF021939.1|AF021939 Hordeum vulgare catalase 2 (CAT2) gene, partial cds
          Length = 1326

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 301 cacatggacggcttcggcgtcaacacctacacctt 335

---

>gb|U20778.1|HVU20778 Hordeum vulgare catalase (Cat2) mRNA, complete cds
          Length = 1756

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 284 cacatggacggttttggtgtcaacacctacacctt 318
           ||||||||||| || || |||||||||||||||||
Sbjct: 659 cacatggacggcttcggcgtcaacacctacacctt 693

---

>gb|M80796.1|BACDNA Bacillus subtilis vegetative catalase (kat-19+) gene, complete cds
          Length = 1452

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 95  aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 141
           ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 379 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 425

---

>gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, complete cds,
           alternatively spliced
          Length = 2254

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                       
Query: 62  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 121
           |||||||||||||| ||||||||  |||| ||||||||  | || || || || || || 
Sbjct: 430 tacaccagagaggggaactttgatattgtggggaacaacttccccgtcttcttcattcgc 489

                                                      
Query: 122 gatgggatgaagttccctgacatggtccatgctttcaagccaa 164
           |||| ||| || ||||||||| || | |||||||| |||||||
Sbjct: 490 gatgcgatcaaattccctgacgtgattcatgcttttaagccaa 532

---

>dbj|D29966.1|RICCA Rice CatA gene for catalase, complete cds
          Length = 4670

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 284  cacatggacggttttggtgtcaacacctacacctt 318
            ||||||||||| || || |||||||||||||||||
Sbjct: 2479 cacatggacggcttcggcgtcaacacctacacctt 2513

---

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 32      agggatccacgtggttttgcagtgaa 57
               ||||||||||| ||||||||||||||
Sbjct: 2991731 agggatccacgaggttttgcagtgaa 2991706

---

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 32      agggatccacgtggttttgcagtgaa 57
               ||||||||||| ||||||||||||||
Sbjct: 2994443 agggatccacgaggttttgcagtgaa 2994418

---

>emb|X05549.1|IBCATR Seet potato mRNA for catalase (EC 1.11.1.6)
          Length = 1804

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                       
Query: 107 gtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagccaagt 166
           ||||| |||||||| || || | | ||||||| ||| || |||| || ||||||||||  
Sbjct: 505 gtgttctttatccgggacggaacgcagttcccggacgtgatccacgcgttcaagccaaac 564

                                         
Query: 167 ccgaagaccaacatgcaggagaactggaga 196
           |||||  || |||| |||||||||||||||
Sbjct: 565 ccgaaatcccacatccaggagaactggaga 594

---

>gb|AY159321.1| Simian immunodeficiency virus isolate SIVdrl1FAO, complete genome
          Length = 9732

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 325  cagggatggaaaggctcacctg 346
            ||||||||||||||||||||||
Sbjct: 2567 cagggatggaaaggctcacctg 2588

---

>gb|U64156.1|HIVU64156 HIV-1 isolate MM351 from Australia, reverse transcriptase (pol)
           gene, partial cds
          Length = 726

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 325 cagggatggaaaggctcacctg 346
           ||||||||||||||||||||||
Sbjct: 428 cagggatggaaaggctcacctg 449

---

>gb|AY433680.1| Aedes aegypti ASAP ID: 37745 catalase mRNA sequence
          Length = 696

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 35  gatccacgtggttttgcagtgaagttctacacc 67
           |||||||||||||| || ||||| |||||||||
Sbjct: 444 gatccacgtggtttcgctgtgaaattctacacc 476

---

>gb|DQ440117.1| Aedes aegypti clone AE-5918 catalase mRNA, partial cds
          Length = 1287

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 35  gatccacgtggttttgcagtgaagttctacacc 67
           |||||||||||||| || || ||||||||||||
Sbjct: 142 gatccacgtggtttcgccgtaaagttctacacc 174

---

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                           
Query: 41      cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 100
               ||||||||||| || |||||||||||| | || || ||||| ||||| || || ||||| 
Sbjct: 5983680 cgtggttttgcggtcaagttctacaccggcgaaggcaacttcgacctggtgggcaacaac 5983739

                    
Query: 101     atgcc 105
               |||||
Sbjct: 5983740 atgcc 5983744

---

>gb|AC115122.4| Mus musculus BAC clone RP24-108L20 from chromosome 14, complete
            sequence
          Length = 163480

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 138  ctgacatggtccatgctttca 158
            |||||||||||||||||||||
Sbjct: 5117 ctgacatggtccatgctttca 5097

---

>gb|AY802593.1| HIV-1 isolate CA10424 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 780

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 324 gcagggatggaaaggctcacc 344
           |||||||||||||||||||||
Sbjct: 450 gcagggatggaaaggctcacc 470

---

>gb|AY802587.1| HIV-1 isolate CA4230 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 771

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 324 gcagggatggaaaggctcacc 344
           |||||||||||||||||||||
Sbjct: 450 gcagggatggaaaggctcacc 470

---

>gb|AE012515.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 423
            of 460 of the complete genome
          Length = 10679

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 122  gatgggatgaagttccctgacatggtccatgctttcaagcc 162
            |||| ||| |||||||| ||||||||||| || ||||||||
Sbjct: 4602 gatgcgatcaagttccccgacatggtccacgcgttcaagcc 4562

---

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 122     gatgggatgaagttccctgacatggtccatgctttcaagcc 162
               |||| ||| |||||||| ||||||||||| || ||||||||
Sbjct: 4751968 gatgcgatcaagttccccgacatggtccacgcgttcaagcc 4751928

---

>gb|DQ024058.1| HIV-1 isolate mA142 from Martinique reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 324 gcagggatggaaaggctcacc 344
           |||||||||||||||||||||
Sbjct: 329 gcagggatggaaaggctcacc 349

---

>gb|AF260737.1|AF260737 Cucurbita pepo catalase mRNA, partial cds
          Length = 492

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 606 tgaacaagaacattgacaatttctt 630
           ||||||||||||| |||||||||||
Sbjct: 253 tgaacaagaacatagacaatttctt 277

---

>gb|AF155110.1|AF155110 Homo sapiens NY-REN-45 antigen mRNA, complete cds
          Length = 4422

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   attcggcacgaggggaagccc 21
           |||||||||||||||||||||
Sbjct: 706 attcggcacgaggggaagccc 726

---

>gb|AC148978.3| Mus musculus BAC clone RP23-359K8 from 14, complete sequence
          Length = 241799

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 138   ctgacatggtccatgctttca 158
             |||||||||||||||||||||
Sbjct: 92093 ctgacatggtccatgctttca 92073

---

>gb|AY365745.1| HIV-1 isolate 106239 from Argentina pol protein (pol) gene, partial
           cds
          Length = 1497

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 324 gcagggatggaaaggctcacc 344
           |||||||||||||||||||||
Sbjct: 747 gcagggatggaaaggctcacc 767

---

>dbj|D55647.1|CUCCAT3 Pumpkin mRNA for catalase (cat3), complete cds
          Length = 1804

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 606  tgaacaagaacattgacaatttcttcgcggaaaatga 642
            ||||||||||||| || |||||||| ||||| |||||
Sbjct: 964  tgaacaagaacatagataatttctttgcggagaatga 1000

---

>gb|DQ025189.1| HIV-1 isolate pE90394 from Puerto Rico reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 330 cagggatggaaaggctcacc 349

---

>gb|DQ025104.1| HIV-1 isolate pE85105 from Puerto Rico reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 330 cagggatggaaaggctcacc 349

---

>ref|NM_194840.1| Oryza sativa (japonica cultivar-group) putative transposon protein
            (OSJNBa0030B02.14), mRNA
          Length = 2526

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  atgttggcattccactcaac 277
            ||||||||||||||||||||
Sbjct: 1367 atgttggcattccactcaac 1348

---

>gb|AY603335.1| Haemonchus contortus catalase mRNA, complete cds
          Length = 1690

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 35  gatccacgtggttttgcagtgaagttctacac 66
           ||||||||||||||||| ||||| || |||||
Sbjct: 427 gatccacgtggttttgctgtgaaattttacac 458

---

>gb|AY701391.1| HIV-1 isolate RW0550 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 632

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 342 cagggatggaaaggctcacc 361

---

>gb|AY388831.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949

---

>gb|AY388830.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949

---

>gb|AY388829.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949

---

>gb|AY362104.1| HIV-1 isolate 111925 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY362101.1| HIV-1 isolate 134795 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY362100.1| HIV-1 isolate 134284 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY316083.1| HIV-1 from Spain isolate 67.00 pol protein (pol) gene, partial cds
          Length = 1971

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY471869.1| HIV-1 isolate 206140 from USA pol protein (pol) gene, partial cds
          Length = 1022

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 751 cagggatggaaaggctcacc 770

---

>gb|AY528204.1| HIV-1 isolate A0387 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY528203.1| HIV-1 isolate A0386 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY528202.1| HIV-1 isolate A0385 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY527896.1| HIV-1 isolate A0079 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY527895.1| HIV-1 isolate A0078 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     ggttttgcagtgaagttctacacc 67
              |||||||| |||||||||||||||
Sbjct: 421306 ggttttgcggtgaagttctacacc 421283

---

>gb|AY149565.1| HIV-1 isolate DK.IM.123-f.RT reverse transcriptase (pol) gene,
           partial cds
          Length = 630

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 340 cagggatggaaaggctcacc 359

---

>gb|AY275769.1| HIV-1 isolate 128PR_RT from Brazil pol protein (pol) gene, partial
           cds
          Length = 972

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY815698.1| Schistosoma japonicum SJCHGC08499 protein mRNA, complete cds
          Length = 724

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 503 attgatgctgatcacgagga 522
           ||||||||||||||||||||
Sbjct: 535 attgatgctgatcacgagga 554

---

>gb|AY334713.1| HIV-1 isolate 51581.f from Puerto Rico pol protein (pol) gene,
           partial cds
          Length = 620

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 340 cagggatggaaaggctcacc 359

---

>gb|AY580245.1| Metridium senile catalase mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 35  gatccacgtggttttgcagtgaagttctacac 66
           ||||| || ||||||||||| |||||||||||
Sbjct: 115 gatcctcgcggttttgcagtcaagttctacac 146

---

>gb|AY580238.1| Obelia sp. KJP-2004 catalase mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 35  gatccacgtggttttgcagtgaagttctacac 66
           ||||| || ||||||||||| |||||||||||
Sbjct: 115 gatcctcgcggttttgcagtcaagttctacac 146

---

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 131     aagttccctgacatggtccatgctttcaagcc 162
               |||||||| ||||||||||| || ||||||||
Sbjct: 3795113 aagttcccggacatggtccacgccttcaagcc 3795144

---

>gb|AY714472.1| HIV-1 isolate F56706_RT from USA reverse transcriptase (Pol) gene,
           partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY714470.1| HIV-1 from USA reverse transcriptase (Pol) gene, partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY714434.1| HIV-1 isolate F74928_RT from USA reverse transcriptase (Pol) gene,
           partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>ref|XM_742595.1| Aspergillus fumigatus Af293 catalase A (Afu6g03890) partial mRNA
          Length = 2253

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 87  ttgttgggaacaatatgcctgtgttttt 114
           ||||||||||||| || |||||||||||
Sbjct: 488 ttgttgggaacaacatccctgtgttttt 515

---

>gb|AY165273.1| HIV-1 isolate 01SE-22264 from Sweden gag-pol fusion polyprotein
           gene, partial cds
          Length = 1475

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 903 cagggatggaaaggctcacc 922

---

>gb|AY378080.1| Tetrahymena thermophila putative catalase (CAT) mRNA, complete cds
          Length = 1640

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 35  gatccacgtggttttgcagtgaagttctacac 66
           ||||| |||||||| ||||| |||||||||||
Sbjct: 377 gatcctcgtggtttcgcagtcaagttctacac 408

---

>gb|DQ157817.1| HIV-1 isolate PE.5895 from Peru protease (pol) gene, partial cds
          Length = 1024

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 869 cagggatggaaaggctcacc 888

---

>emb|AL606504.14| Human DNA sequence from clone RP11-358K2 on chromosome 10, complete
             sequence
          Length = 81147

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 558   cctggccagaggacatcatcccactgca 585
             |||||||||||||| ||| |||||||||
Sbjct: 67121 cctggccagaggacctcaccccactgca 67148

---

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      tttgcagtgaagttctacac 66
               ||||||||||||||||||||
Sbjct: 2031829 tttgcagtgaagttctacac 2031810

---

>gb|AF454535.1| HIV-1 isolate 66936VI from Czech Republic reverse transcriptase
           (pol) gene, partial cds
          Length = 543

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 334 cagggatggaaaggctcacc 353

---

>gb|AY213503.1| HIV-1 isolate BRP2177RT from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 571

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 346 cagggatggaaaggctcacc 365

---

>gb|AY213272.1| HIV-1 isolate BRRJ917RT from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 571

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 346 cagggatggaaaggctcacc 365

---

>gb|AY260398.1| HIV-1 isolate 213 from France reverse transcriptase (pol) gene,
           partial cds
          Length = 596

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 337 cagggatggaaaggctcacc 356

---

>gb|AY260380.1| HIV-1 isolate 195 from France reverse transcriptase (pol) gene,
           partial cds
          Length = 596

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 337 cagggatggaaaggctcacc 356

---

>gb|AY075969.1| HIV-1 isolate 91USG191814pc2 from USA pol polyprotein (pol) gene,
           partial cds
          Length = 997

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 757 cagggatggaaaggctcacc 776

---

>gb|DQ087444.1| Cerebratulus lacteus catalase mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 640 tgaacagcttgctttctgcccagc 663
           ||||||| ||||||||||||||||
Sbjct: 720 tgaacagattgctttctgcccagc 743

---

>gb|AY877247.1| HIV-1 isolate BR02SP167 from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 623

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 cagggatggaaaggctcacc 344
           ||||||||||||||||||||
Sbjct: 382 cagggatggaaaggctcacc 401


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,942,716
Number of Sequences: 3902068
Number of extensions: 5942716
Number of successful extensions: 159213
Number of sequences better than 10.0: 478
Number of HSP's better than 10.0 without gapping: 479
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 157807
Number of HSP's gapped (non-prelim): 1326
length of query: 704
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 681
effective length of database: 17,143,297,704
effective search space: 11674585736424
effective search space used: 11674585736424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---