ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal41m15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X56803.1|TAMRNAU T.aestivum L. mRNA for ubiquitin 78 1e-11
2emb|X56601.1|TAUBIQU Wheat mRNA for ubiquitin 78 1e-11
3gb|DQ086482.1| Triticum aestivum ubiquitin (Ubiq) mRNA, partial cds 66 4e-08
4gb|AC124418.4| Mus musculus BAC clone RP24-318G17 from chromosom... 42 0.56
5gb|AC102411.12| Mus musculus chromosome 18, clone RP24-374D7, co... 42 0.56
6gb|AC154838.2| Mus musculus BAC clone RP23-64F2 from chromosome ... 42 0.56
7gb|AC161481.4| Mus musculus chromosome 18, clone RP23-336C20, co... 42 0.56
8gb|AC147073.2| Pan troglodytes BAC clone RP43-169D10 from 7, com... 40 2.2
9gb|AC002381.1| Homo sapiens BAC clone CTB-20D2 from 7, complete ... 40 2.2
10gb|AC142331.1| Pan troglodytes BAC clone RP43-28J15 from 7, comp... 40 2.2
11gb|AC145774.1| Pan troglodytes BAC clone RP43-160F1 from 7, comp... 40 2.2
12emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chr... 40 2.2
13emb|AL512506.8| Human DNA sequence from clone RP11-5G9 on chromo... 40 2.2
14emb|AL358453.8| Human DNA sequence from clone RP11-115M14 on chr... 40 2.2
15emb|AL162713.19| Human DNA sequence from clone RP11-168P13 on ch... 40 2.2
16emb|AL136450.8| Human DNA sequence from clone RP3-510O21 on chro... 40 2.2
17gb|AC147976.3| Pan troglodytes BAC clone CH251-543E22 from chrom... 40 2.2
18ref|NM_129327.3| Arabidopsis thaliana kinase AT2G37710 mRNA, com... 38 8.8
19gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete... 38 8.8
20gb|AC105330.8| Mus musculus chromosome 15, clone RP23-281C10, co... 38 8.8
21gb|AC123860.4| Mus musculus BAC clone RP23-349N13 from chromosom... 38 8.8
22gb|AC121583.3| Mus musculus BAC clone RP23-259K16 from 13, compl... 38 8.8
23gb|AC124672.9| Mus musculus chromosome 1, clone RP23-328G14, com... 38 8.8
24gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, comp... 38 8.8
25emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 o... 38 8.8
26emb|AL450345.6| Human DNA sequence from clone RP11-300M24 on chr... 38 8.8
27emb|AL138759.20| Human DNA sequence from clone RP11-119K6 on chr... 38 8.8
28gb|AC182473.3| Pan troglodytes BAC clone CH251-224P2 from chromo... 38 8.8
29emb|Z99114.2|BSUB0011 Bacillus subtilis complete genome (section... 38 8.8
30emb|X95909.1|ATLECGENE A.thaliana mRNA for receptor like protein... 38 8.8
31gb|AY091070.1| Arabidopsis thaliana putative receptor protein ki... 38 8.8
32gb|BC040569.1| Homo sapiens elongation factor Tu GTP binding dom... 38 8.8
33gb|AC117522.2| Homo sapiens chromosome 5 clone RP11-1072N2, comp... 38 8.8
34gb|AC103870.3| Homo sapiens chromosome 11, clone RP11-702L21, co... 38 8.8
35gb|AC107302.4| Homo sapiens 3 BAC RP11-564P9 (Roswell Park Cance... 38 8.8
36gb|AC114928.2| Homo sapiens chromosome 5 clone CTC-384G19, compl... 38 8.8
37gb|AC004684.3| Arabidopsis thaliana chromosome 2 clone F13M22 ma... 38 8.8
38gb|AC103873.2| Homo sapiens chromosome 11, clone RP11-768H8, com... 38 8.8
39gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, comp... 38 8.8
40gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 38 8.8
41gb|AC150730.3| Atelerix albiventris clone LB4-141D24, complete s... 38 8.8
42gb|AC026624.8| Homo sapiens chromosome 15, clone RP11-652P10, co... 38 8.8
43emb|BX004834.13| Zebrafish DNA sequence from clone CH211-42E22 i... 38 8.8
44gb|AC138272.11| Mus musculus chromosome 7, clone RP23-91H13, com... 38 8.8
45gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35... 38 8.8
46gb|AF020713.1|AF020713 Bacteriophage SPBc2 complete genome 38 8.8
47emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chro... 38 8.8
48emb|AL929473.7| Mouse DNA sequence from clone RP23-143P21 on chr... 38 8.8

>emb|X56803.1|TAMRNAU T.aestivum L. mRNA for ubiquitin
          Length = 436

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 68/77 (88%), Gaps = 3/77 (3%)
 Strand = Plus / Plus

                                                                       
Query: 70  taccgtactgtgatgcagtattatcgtttgtatctttgaactt---ctggtgcgcagcag 126
           |||| |||||||||||||| ||||||||||||||||  |||||   |||||| | |||||
Sbjct: 349 taccatactgtgatgcagtgttatcgtttgtatcttcaaacttctgctggtgtggagcag 408

                            
Query: 127 ctttggtgaactatgaa 143
           |||||||||||||||||
Sbjct: 409 ctttggtgaactatgaa 425



to top

>emb|X56601.1|TAUBIQU Wheat mRNA for ubiquitin
          Length = 436

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 68/77 (88%), Gaps = 3/77 (3%)
 Strand = Plus / Plus

                                                                       
Query: 70  taccgtactgtgatgcagtattatcgtttgtatctttgaactt---ctggtgcgcagcag 126
           |||| |||||||||||||| ||||||||||||||||  |||||   |||||| | |||||
Sbjct: 349 taccatactgtgatgcagtgttatcgtttgtatcttcaaacttctgctggtgtggagcag 408

                            
Query: 127 ctttggtgaactatgaa 143
           |||||||||||||||||
Sbjct: 409 ctttggtgaactatgaa 425



to top

>gb|DQ086482.1| Triticum aestivum ubiquitin (Ubiq) mRNA, partial cds
          Length = 400

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                       
Query: 70  taccgtactgtgatgcagtattatcgtttgtatctttgaactt---ctggtgcgcagcag 126
           |||| |||||||||||||| ||||||||||||||||  |||||   |||||| | |||||
Sbjct: 330 taccatactgtgatgcagtgttatcgtttgtatcttcaaacttctgctggtgtggagcag 389

                      
Query: 127 ctttggtgaac 137
           |||||||||||
Sbjct: 390 ctttggtgaac 400



to top

>gb|AC124418.4| Mus musculus BAC clone RP24-318G17 from chromosome 18, complete
            sequence
          Length = 167998

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 96   tttgtatctttgaacttctgg 116
            |||||||||||||||||||||
Sbjct: 9395 tttgtatctttgaacttctgg 9415



to top

>gb|AC102411.12| Mus musculus chromosome 18, clone RP24-374D7, complete sequence
          Length = 171918

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 96    tttgtatctttgaacttctgg 116
             |||||||||||||||||||||
Sbjct: 92359 tttgtatctttgaacttctgg 92379



to top

>gb|AC154838.2| Mus musculus BAC clone RP23-64F2 from chromosome 14, complete sequence
          Length = 224431

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 16     tgggttcacaagcccctgtcc 36
              |||||||||||||||||||||
Sbjct: 146525 tgggttcacaagcccctgtcc 146545



to top

>gb|AC161481.4| Mus musculus chromosome 18, clone RP23-336C20, complete sequence
          Length = 210643

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 96    tttgtatctttgaacttctgg 116
             |||||||||||||||||||||
Sbjct: 17688 tttgtatctttgaacttctgg 17668



to top

>gb|AC147073.2| Pan troglodytes BAC clone RP43-169D10 from 7, complete sequence
          Length = 159447

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 135    aactatgaaaaataagtgag 154
              ||||||||||||||||||||
Sbjct: 111175 aactatgaaaaataagtgag 111194



to top

>gb|AC002381.1| Homo sapiens BAC clone CTB-20D2 from 7, complete sequence
          Length = 172533

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   aactatgaaaaataagtgag 154
             ||||||||||||||||||||
Sbjct: 55066 aactatgaaaaataagtgag 55047



to top

>gb|AC142331.1| Pan troglodytes BAC clone RP43-28J15 from 7, complete sequence
          Length = 140363

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   aactatgaaaaataagtgag 154
             ||||||||||||||||||||
Sbjct: 52403 aactatgaaaaataagtgag 52422



to top

>gb|AC145774.1| Pan troglodytes BAC clone RP43-160F1 from 7, complete sequence
          Length = 208178

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   aactatgaaaaataagtgag 154
             ||||||||||||||||||||
Sbjct: 55251 aactatgaaaaataagtgag 55270



to top

>emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chromosome 1 Contains
            the 3' end of the NEGR1 gene for neuronal growth
            regulator 1 and a novel gene, complete sequence
          Length = 93633

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 51   aatggagtctgtctctgtct 70
            ||||||||||||||||||||
Sbjct: 1606 aatggagtctgtctctgtct 1587



to top

>emb|AL512506.8| Human DNA sequence from clone RP11-5G9 on chromosome 13 Contains the
            5' end of a novel gene, parts of 2 novel genes, a
            diacylglycerol kinase pseudogene and a CpG island,
            complete sequence
          Length = 167875

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 51   aatggagtctgtctctgtct 70
            ||||||||||||||||||||
Sbjct: 3029 aatggagtctgtctctgtct 3048



to top

>emb|AL358453.8| Human DNA sequence from clone RP11-115M14 on chromosome 1 Contains a
              cytochrome c oxidase subunit VIa polypeptide 1 (COX6A1)
              pseudogene, complete sequence
          Length = 108934

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     aatggagtctgtctctgtct 70
              ||||||||||||||||||||
Sbjct: 108540 aatggagtctgtctctgtct 108521



to top

>emb|AL162713.19| Human DNA sequence from clone RP11-168P13 on chromosome 13 Contains parts
              of 2 novel genes and a CpG island, complete sequence
          Length = 157175

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     aatggagtctgtctctgtct 70
              ||||||||||||||||||||
Sbjct: 146144 aatggagtctgtctctgtct 146163



to top

>emb|AL136450.8| Human DNA sequence from clone RP3-510O21 on chromosome Xq25-26.1
            Contains the 3' end of a novel gene (FLJ11362), the 3'
            end of the ELF4 gene for  E74-like factor 4 (ets domain
            transcription factor) (MEF, ELFR) and a CpG island,
            complete sequence
          Length = 43480

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 13   ctctgggttcacaagcccctgtcc 36
            |||||||||| |||||||||||||
Sbjct: 9372 ctctgggttcccaagcccctgtcc 9395



to top

>gb|AC147976.3| Pan troglodytes BAC clone CH251-543E22 from chromosome 7, complete
              sequence
          Length = 231294

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    aactatgaaaaataagtgag 154
              ||||||||||||||||||||
Sbjct: 137671 aactatgaaaaataagtgag 137652



to top

>ref|NM_129327.3| Arabidopsis thaliana kinase AT2G37710 mRNA, complete cds
          Length = 2287

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 89  attatcgtttgtatctttgaact 111
           ||||||||||||||| |||||||
Sbjct: 517 attatcgtttgtatcattgaact 495



to top

>gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete sequence
          Length = 179038

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 135   aactatgaaaaataagtga 153
             |||||||||||||||||||
Sbjct: 78041 aactatgaaaaataagtga 78059



to top

>gb|AC105330.8| Mus musculus chromosome 15, clone RP23-281C10, complete sequence
          Length = 206675

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    tattatcgtttgtatcttt 106
             |||||||||||||||||||
Sbjct: 14879 tattatcgtttgtatcttt 14897



to top

>gb|AC123860.4| Mus musculus BAC clone RP23-349N13 from chromosome 14, complete
             sequence
          Length = 191104

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 52    atggagtctgtctctgtct 70
             |||||||||||||||||||
Sbjct: 97131 atggagtctgtctctgtct 97113



to top

>gb|AC121583.3| Mus musculus BAC clone RP23-259K16 from 13, complete sequence
          Length = 207129

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 121   cagcagctttggtgaactatgaa 143
             |||||| ||||||||||||||||
Sbjct: 79669 cagcagttttggtgaactatgaa 79647



to top

>gb|AC124672.9| Mus musculus chromosome 1, clone RP23-328G14, complete sequence
          Length = 249008

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 142    aaaaataagtgagcccagg 160
              |||||||||||||||||||
Sbjct: 157558 aaaaataagtgagcccagg 157576



to top

>gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, complete sequence
          Length = 223833

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 42     gtgtcctccaatggagtct 60
              |||||||||||||||||||
Sbjct: 165488 gtgtcctccaatggagtct 165470



to top

>emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 on chromosome X Contains part
             of the ODZ1 gene for odz, odd Oz/ten-m homolog
             1(Drosophila), complete sequence
          Length = 110180

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 126   gctttggtgaactatgaaa 144
             |||||||||||||||||||
Sbjct: 32838 gctttggtgaactatgaaa 32856



to top

>emb|AL450345.6| Human DNA sequence from clone RP11-300M24 on chromosome 6 Contains a
             novel gene, complete sequence
          Length = 183342

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 52    atggagtctgtctctgtct 70
             |||||||||||||||||||
Sbjct: 52467 atggagtctgtctctgtct 52449



to top

>emb|AL138759.20| Human DNA sequence from clone RP11-119K6 on chromosome 10 Contains the
             the 3' end of a novel gene (KIAA0608), the HELLS gene for
             helicase, lymphoid-specific (LSH, PASG, SMARCA6,
             FLJ10339), two novel genes, a C-terminal binding protein 2
             (CTBP2) pseudogene and a CpG island, complete sequence
          Length = 193020

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    aatggagtctgtctctgtc 69
             |||||||||||||||||||
Sbjct: 96385 aatggagtctgtctctgtc 96403



to top

>gb|AC182473.3| Pan troglodytes BAC clone CH251-224P2 from chromosome 10, complete
              sequence
          Length = 192315

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 51     aatggagtctgtctctgtc 69
              |||||||||||||||||||
Sbjct: 128608 aatggagtctgtctctgtc 128626



to top

>emb|Z99114.2|BSUB0011 Bacillus subtilis complete genome (section 11 of 21): from 2014895 to
              2207855
          Length = 192961

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 93     tcgtttgtatctttgaact 111
              |||||||||||||||||||
Sbjct: 185451 tcgtttgtatctttgaact 185469



to top

>emb|X95909.1|ATLECGENE A.thaliana mRNA for receptor like protein kinase
          Length = 2242

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 89  attatcgtttgtatctttgaact 111
           ||||||||||||||| |||||||
Sbjct: 497 attatcgtttgtatcattgaact 475



to top

>gb|AY091070.1| Arabidopsis thaliana putative receptor protein kinase (At2g37710)
           mRNA, complete cds
          Length = 2277

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 89  attatcgtttgtatctttgaact 111
           ||||||||||||||| |||||||
Sbjct: 517 attatcgtttgtatcattgaact 495



to top

>gb|BC040569.1| Homo sapiens elongation factor Tu GTP binding domain containing 1,
           mRNA (cDNA clone IMAGE:5267393)
          Length = 2636

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 134 gaactatgaaaaataagtg 152
           |||||||||||||||||||
Sbjct: 131 gaactatgaaaaataagtg 149



to top

>gb|AC117522.2| Homo sapiens chromosome 5 clone RP11-1072N2, complete sequence
          Length = 170219

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    aatggagtctgtctctgtc 69
             |||||||||||||||||||
Sbjct: 23387 aatggagtctgtctctgtc 23369



to top

>gb|AC103870.3| Homo sapiens chromosome 11, clone RP11-702L21, complete sequence
          Length = 182598

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 134   gaactatgaaaaataagtg 152
             |||||||||||||||||||
Sbjct: 31435 gaactatgaaaaataagtg 31417



to top

>gb|AC107302.4| Homo sapiens 3 BAC RP11-564P9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 194234

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 52     atggagtctgtctctgtct 70
              |||||||||||||||||||
Sbjct: 164578 atggagtctgtctctgtct 164596



to top

>gb|AC114928.2| Homo sapiens chromosome 5 clone CTC-384G19, complete sequence
          Length = 45530

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 51   aatggagtctgtctctgtc 69
            |||||||||||||||||||
Sbjct: 3429 aatggagtctgtctctgtc 3447



to top

>gb|AC004684.3| Arabidopsis thaliana chromosome 2 clone F13M22 map ve018, complete
             sequence
          Length = 93845

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 89    attatcgtttgtatctttgaact 111
             ||||||||||||||| |||||||
Sbjct: 72554 attatcgtttgtatcattgaact 72576



to top

>gb|AC103873.2| Homo sapiens chromosome 11, clone RP11-768H8, complete sequence
          Length = 184860

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 134  gaactatgaaaaataagtg 152
            |||||||||||||||||||
Sbjct: 8232 gaactatgaaaaataagtg 8250



to top

>gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, complete sequence
          Length = 178351

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 52     atggagtctgtctctgtct 70
              |||||||||||||||||||
Sbjct: 146446 atggagtctgtctctgtct 146428



to top

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 55     gagtctgtctctgtctacc 73
              |||||||||||||||||||
Sbjct: 465469 gagtctgtctctgtctacc 465487



to top

>gb|AC150730.3| Atelerix albiventris clone LB4-141D24, complete sequence
          Length = 136615

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    gagtctgtctctgtctacc 73
             |||||||||||||||||||
Sbjct: 42523 gagtctgtctctgtctacc 42541



to top

>gb|AC026624.8| Homo sapiens chromosome 15, clone RP11-652P10, complete sequence
          Length = 143709

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 134    gaactatgaaaaataagtg 152
              |||||||||||||||||||
Sbjct: 127252 gaactatgaaaaataagtg 127234



to top

>emb|BX004834.13| Zebrafish DNA sequence from clone CH211-42E22 in linkage group 18,
            complete sequence
          Length = 188895

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 78   tgtgatgcagtattatcgtttgt 100
            |||||||||||||||| ||||||
Sbjct: 7507 tgtgatgcagtattatggtttgt 7529



to top

>gb|AC138272.11| Mus musculus chromosome 7, clone RP23-91H13, complete sequence
          Length = 234237

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     gtgtcctccaatggagtct 60
              |||||||||||||||||||
Sbjct: 135479 gtgtcctccaatggagtct 135497



to top

>gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35 of 83 of the complete
              sequence
          Length = 264919

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 135    aactatgaaaaataagtga 153
              |||||||||||||||||||
Sbjct: 260271 aactatgaaaaataagtga 260289



to top

>gb|AF020713.1|AF020713 Bacteriophage SPBc2 complete genome
          Length = 134416

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 93    tcgtttgtatctttgaact 111
             |||||||||||||||||||
Sbjct: 85300 tcgtttgtatctttgaact 85282



to top

>emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chromosome X, complete
            sequence
          Length = 210533

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 133  tgaactatgaaaaataagt 151
            |||||||||||||||||||
Sbjct: 9765 tgaactatgaaaaataagt 9783



to top

>emb|AL929473.7| Mouse DNA sequence from clone RP23-143P21 on chromosome 4, complete
             sequence
          Length = 59619

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 96    tttgtatctttgaacttct 114
             |||||||||||||||||||
Sbjct: 31936 tttgtatctttgaacttct 31918


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,878,335
Number of Sequences: 3902068
Number of extensions: 1878335
Number of successful extensions: 199356
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 199190
Number of HSP's gapped (non-prelim): 163
length of query: 179
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 157
effective length of database: 17,147,199,772
effective search space: 2692110364204
effective search space used: 2692110364204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top