>gb|AF068708.1| Caenorhabditis elegans cosmid C18G1, complete sequence
          Length = 37342

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 225   aaagtaggttctttttgcatgttgaa 250
             |||||||||||||||||||| |||||
Sbjct: 21801 aaagtaggttctttttgcattttgaa 21776

>gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplast, complete genome
          Length = 164921

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 230   aggttctttttgcatgttgaa 250
             |||||||||||||||||||||
Sbjct: 18970 aggttctttttgcatgttgaa 18950

>gb|BT016153.1| Drosophila melanogaster AT16405 full insert cDNA
          Length = 5573

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 53   accgtggacaacatgcagga 72
            ||||||||||||||||||||
Sbjct: 5141 accgtggacaacatgcagga 5160

>gb|AC007578.6| Drosophila melanogaster clone BACR09A11, complete sequence
          Length = 170684

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   tgaagctgtcattgtttgtc 266
             ||||||||||||||||||||
Sbjct: 24357 tgaagctgtcattgtttgtc 24376

>gb|AC155248.2| Mus musculus BAC clone RP24-243O10 from chromosome 13, complete sequence
          Length = 181818

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 240    tgcatgttgaagctgtcatt 259
              ||||||||||||||||||||
Sbjct: 146325 tgcatgttgaagctgtcatt 146306

>ref|NM_135156.2| Drosophila melanogaster CG13991-RA (CG13991), mRNA
          Length = 5551

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 53   accgtggacaacatgcagga 72
            ||||||||||||||||||||
Sbjct: 5141 accgtggacaacatgcagga 5160

>gb|AC009351.7| Drosophila melanogaster, chromosome 2L, region 26A-26A, BAC clone
             BACR23K01, complete sequence
          Length = 173723

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 53    accgtggacaacatgcagga 72
             ||||||||||||||||||||
Sbjct: 15166 accgtggacaacatgcagga 15185

>gb|AC092216.1|AC092216 Drosophila melanogaster, chromosome 2L, region 25F-26A, BAC clone
            BACR10M11, complete sequence
          Length = 174832

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 53   accgtggacaacatgcagga 72
            ||||||||||||||||||||
Sbjct: 5816 accgtggacaacatgcagga 5797

>gb|AC155234.1| Mus musculus BAC clone RP24-394J17 from 13, complete sequence
          Length = 155603

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 240    tgcatgttgaagctgtcatt 259
              ||||||||||||||||||||
Sbjct: 147023 tgcatgttgaagctgtcatt 147042

>gb|AY108918.1| Zea mays PCO113850 mRNA sequence
          Length = 857

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 8   ctcagcaagctncctagcagccagccttgat 38
           |||| |||||| || ||||||||||||||||
Sbjct: 557 ctcaacaagcttcccagcagccagccttgat 587

>gb|AE003612.2| Drosophila melanogaster chromosome 2L, section 21 of 83 of the complete
              sequence
          Length = 260673

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     accgtggacaacatgcagga 72
              ||||||||||||||||||||
Sbjct: 188263 accgtggacaacatgcagga 188282

>gb|AE003825.3| Drosophila melanogaster chromosome 2R, section 25 of 73 of the complete
             sequence
          Length = 261690

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   tgaagctgtcattgtttgtc 266
             ||||||||||||||||||||
Sbjct: 71765 tgaagctgtcattgtttgtc 71746

>gb|AC101752.14| Mus musculus chromosome 1, clone RP24-344C18, complete sequence
          Length = 164759

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   gtatagacttattttgcaga 191
             ||||||||||||||||||||
Sbjct: 58804 gtatagacttattttgcaga 58785

>gb|AC004639.1|AC004639 Drosophila melanogaster DNA sequence (P1 DS06863 (D124)), complete
             sequence
          Length = 78419

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    accgtggacaacatgcagga 72
             ||||||||||||||||||||
Sbjct: 23674 accgtggacaacatgcagga 23655


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,038,769
Number of Sequences: 3902068
Number of extensions: 2038769
Number of successful extensions: 34818
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34802
Number of HSP's gapped (non-prelim): 16
length of query: 311
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 289
effective length of database: 17,147,199,772
effective search space: 4955540734108
effective search space used: 4955540734108
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)