ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal41h17
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|DQ285630.1| Oryza sativa (indica cultivar-group) putative nit... 220 2e-54
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 208 8e-51
3dbj|AP005659.2| Oryza sativa (japonica cultivar-group) genomic D... 208 8e-51
4gb|AY104853.1| Zea mays PCO142365 mRNA sequence 167 3e-38
5gb|AF045033.1|AF045033 Zea mays nitrate-induced NOI protein mRNA... 147 3e-32
6gb|AF030385.1|AF030385 Zea mays nitrate-induced NOI protein gene... 137 3e-29
7emb|CR962136.2| Medicago truncatula chromosome 5 clone mth2-52n2... 88 2e-14
8emb|CR931742.1| Medicago truncatula chromosome 5 clone mth2-28i2... 88 2e-14
9gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete ... 80 5e-12
10ref|XM_467563.1| Oryza sativa (japonica cultivar-group), mRNA 66 8e-08
11dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 66 8e-08
12dbj|AP004179.3| Oryza sativa (japonica cultivar-group) genomic D... 66 8e-08
13ref|NM_124967.2| Arabidopsis thaliana NOI AT5G55850 (NOI) mRNA, ... 62 1e-06
14gb|AY096671.1| Arabidopsis thaliana putative nitrate-induced NOI... 62 1e-06
15gb|AY065260.1| Arabidopsis thaliana putative NOI protein, nitrat... 62 1e-06
16emb|BX833781.1|CNS09Z02 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
17dbj|AB018120.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 62 1e-06
18gb|AY105745.1| Zea mays PCO136119 mRNA sequence 62 1e-06
19gb|AF030386.1|AF030386 Arabidopsis thaliana NOI protein mRNA, co... 62 1e-06
20gb|DQ160112.1| Taraxacum officinale TO72-1rc (To72-1rc) mRNA, pa... 60 5e-06
21gb|AY140529.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-11 unkno... 58 2e-05
22gb|AY140528.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-4 unknow... 58 2e-05
23gb|AY140527.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-3 unknow... 58 2e-05
24emb|BX833526.1|CNS09ZA1 Arabidopsis thaliana Full-length cDNA Co... 56 8e-05
25gb|AY140526.1| Arabidopsis thaliana clone P3WB2-A11-6094 unknown... 56 8e-05
26gb|AY140525.1| Arabidopsis thaliana clone P3WB2-A11-6092 unknown... 56 8e-05
27gb|AY140524.1| Arabidopsis thaliana clone P3WB2-A11-6054 unknown... 56 8e-05
28gb|AY140522.1| Arabidopsis thaliana clone P3WB2-A11-1220 unknown... 56 8e-05
29gb|AY140521.1| Arabidopsis thaliana clone P3WB2-A11-1202 unknown... 56 8e-05
30gb|AY140520.1| Arabidopsis thaliana clone P3WB2-A11-1084 unknown... 56 8e-05
31gb|AY140519.1| Arabidopsis thaliana clone P3WB2-A11-1074 unknown... 56 8e-05
32gb|AY140518.1| Arabidopsis thaliana clone P3WB2-A11-1006 unknown... 56 8e-05
33gb|AY140517.1| Arabidopsis thaliana clone P3WB2-A11-996 unknown ... 56 8e-05
34gb|AY140516.1| Arabidopsis thaliana clone P3WB2-A11-970 unknown ... 56 8e-05
35gb|AY140515.1| Arabidopsis thaliana clone P3WB2-A11-903 unknown ... 56 8e-05
36gb|AY140531.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-15 unkno... 50 0.005
37gb|AY140530.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-14 unkno... 50 0.005
38ref|NM_126474.1| Arabidopsis thaliana unknown protein AT2G04410 ... 48 0.018
39gb|AC006951.6| Arabidopsis thaliana chromosome 2 clone T1O3 map ... 48 0.018
40gb|AY058877.1| Arabidopsis thaliana At2g04410/T1O3.18 mRNA, comp... 48 0.018
41gb|AY140523.1| Arabidopsis thaliana clone P3WB2-A11-1248 unknown... 48 0.018
42dbj|AK059360.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.29
43ref|NM_123429.2| Arabidopsis thaliana unknown protein AT5G40645 ... 42 1.1
44gb|DQ447022.1| Arabidopsis thaliana clone pENTR221-At5g40645 nit... 42 1.1
45emb|AL138899.23| Human DNA sequence from clone RP11-404O13 on ch... 42 1.1
46dbj|AB009052.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.1
47gb|AC102566.9| Mus musculus chromosome 9, clone RP23-223D10, com... 40 4.5
48gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosom... 40 4.5
49gb|AC099930.11| Mus musculus chromosome 7, clone RP23-17C12, com... 40 4.5
50emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J... 40 4.5
51emb|AL844182.10| Mouse DNA sequence from clone RP23-399H17 on ch... 40 4.5
52gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 40 4.5
53gb|AC022267.8|AC022267 Homo sapiens BAC clone RP11-407H18 from 4... 40 4.5
54emb|BX324002.8| Zebrafish DNA sequence from clone CH211-129H21 i... 40 4.5
55dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 4.5
56emb|CT025664.5| Mouse DNA sequence from clone RP24-174I18 on chr... 40 4.5
57dbj|AP006701.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 4.5 
>gb|DQ285630.1| Oryza sativa (indica cultivar-group) putative nitrate-induced NOI
             protein (75-1-127BAC12.1), putative NBS-LRR disease
             resistance protein (Nbs1-Pi9), putative NBS-LRR disease
             resistance protein (Nbs3-Pi9), and NBS-LRR disease
             resistance protein (Pi9) genes, complete cds; putative
             NBS-LRR disease resistance protein (Nbs4-Pi9) pseudogene,
             complete sequence; putative NBS-LRR disease resistance
             protein (Nbs5-Pi9) gene, complete cds; putative NBS-LRR
             disease resistance protein (Nbs6-Pi9) gene, partial cds;
             and solo-long terminal repeat retrotransposon, complete
             sequence
          Length = 76272

 Score =  220 bits (111), Expect = 2e-54
 Identities = 165/183 (90%)
 Strand = Plus / Plus

                                                                         
Query: 57    ggaggaatctggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttc 116
             ||||||| | ||||| || |||||||||||||| |||||||| |||||||||||||||||
Sbjct: 12379 ggaggaagcaggtcgacccttgcccaagtttggtgaatgggatgtcaacgacccagcttc 12438

                                                                         
Query: 117   tgctgatggattcacagttatattcaacaaagccagggatgagaaaaaggctgggaatgg 176
             |||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 12439 tgctgatggattcacagtgatattcaacaaagccagagatgagaaaaagggtgggaatgg 12498

                                                                         
Query: 177   acaagatactgaatccccttgcaaagacgccaggactgagagggtggaatcttatgccac 236
              ||||||||||| || || ||||||||  | |||||||||||||||||||| |||||| |
Sbjct: 12499 gcaagatactgattcaccctgcaaagagactaggactgagagggtggaatcatatgcccc 12558

                
Query: 237   caa 239
             |||
Sbjct: 12559 caa 12561



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                          
Query: 250   aagaagtggttttgctgcgtgacgccaagtcctacacaatcttga 294
             ||||| ||||||||||| |||||  | ||||||||||||||||||
Sbjct: 12707 aagaaatggttttgctgtgtgacatccagtcctacacaatcttga 12751
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  208 bits (105), Expect = 8e-51
 Identities = 168/189 (88%)
 Strand = Plus / Plus

                                                                            
Query: 57       ggaggaatctggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttc 116
                ||||||| | ||||| || |||||||||||||| |||||||| |||||||||||||| ||
Sbjct: 10217909 ggaggaagcaggtcgtcccttgcccaagtttggtgaatgggatgtcaacgacccagcgtc 10217968

                                                                            
Query: 117      tgctgatggattcacagttatattcaacaaagccagggatgagaaaaaggctgggaatgg 176
                 ||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 10217969 cgctgatggattcacagtgatattcaacaaagccagagatgagaaaaagggtgggaatgg 10218028

                                                                            
Query: 177      acaagatactgaatccccttgcaaagacgccaggactgagagggtggaatcttatgccac 236
                 ||||||||||| || || ||||||||  | |||||||||||||||||||| |||||| |
Sbjct: 10218029 gcaagatactgattcaccctgcaaagaaactaggactgagagggtggaatcatatgcccc 10218088

                         
Query: 237      caaggcaaa 245
                |||| ||||
Sbjct: 10218089 caagacaaa 10218097



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 250      aagaagtggttttgctgcgtgacgccaagtcctacacaatcttga 294
                ||||| |||||||||||||||||  | ||||||||||||||||||
Sbjct: 10218237 aagaaatggttttgctgcgtgacatccagtcctacacaatcttga 10218281
to top
>dbj|AP005659.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0649C11
          Length = 138870

 Score =  208 bits (105), Expect = 8e-51
 Identities = 168/189 (88%)
 Strand = Plus / Plus

                                                                         
Query: 57    ggaggaatctggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttc 116
             ||||||| | ||||| || |||||||||||||| |||||||| |||||||||||||| ||
Sbjct: 22136 ggaggaagcaggtcgtcccttgcccaagtttggtgaatgggatgtcaacgacccagcgtc 22195

                                                                         
Query: 117   tgctgatggattcacagttatattcaacaaagccagggatgagaaaaaggctgggaatgg 176
              ||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 22196 cgctgatggattcacagtgatattcaacaaagccagagatgagaaaaagggtgggaatgg 22255

                                                                         
Query: 177   acaagatactgaatccccttgcaaagacgccaggactgagagggtggaatcttatgccac 236
              ||||||||||| || || ||||||||  | |||||||||||||||||||| |||||| |
Sbjct: 22256 gcaagatactgattcaccctgcaaagaaactaggactgagagggtggaatcatatgcccc 22315

                      
Query: 237   caaggcaaa 245
             |||| ||||
Sbjct: 22316 caagacaaa 22324



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 250   aagaagtggttttgctgcgtgacgccaagtcctacacaatcttga 294
             ||||| |||||||||||||||||  | ||||||||||||||||||
Sbjct: 22464 aagaaatggttttgctgcgtgacatccagtcctacacaatcttga 22508
to top
>gb|AY104853.1| Zea mays PCO142365 mRNA sequence
          Length = 1031

 Score =  167 bits (84), Expect = 3e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                       
Query: 50  ccatgtcggaggaatctggtcgccctttgcccaagtttggcgaatgggacgtcaacgacc 109
           ||||| |||||||||| || ||||| ||||| ||||||||||| ||||| || || || |
Sbjct: 355 ccatggcggaggaatcaggccgccccttgccaaagtttggcgattgggatgttaatgatc 414

                                                                       
Query: 110 cagcttctgctgatggattcacagttatattcaacaaagccagggatgagaaaaaggctg 169
           |||||||||| || |||||||| || ||||||||||||||||| || ||||| |||| ||
Sbjct: 415 cagcttctgcagacggattcactgtcatattcaacaaagccagagacgagaagaagggtg 474

                                                                       
Query: 170 ggaatggacaagatactgaatccccttgcaaagacgccaggactgagagggtggaatctt 229
           |||| |||||||| ||||| || |||| ||| ||| ||||||||||||||||||||||||
Sbjct: 475 ggaacggacaagacactgagtcaccttccaaggacaccaggactgagagggtggaatctt 534

               
Query: 230 atgc 233
           ||||
Sbjct: 535 atgc 538



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 214 gagagggtggaatcttatgccaccaaggcaaattcaaagaagtggttttgctgcgtgacg 273
           ||||||||||||||||||||  | ||| |||   ||||||| |||||||| || ||||| 
Sbjct: 292 gagagggtggaatcttatgctgcaaagccaagcacaaagaaatggttttgttgtgtgaca 233

                                         
Query: 274 ccaagtcctacacaatcttgaggaggacaa 303
            | || ||||| ||||| |||||| |||||
Sbjct: 232 gccagccctacgcaatcctgaggaagacaa 203
to top
>gb|AF045033.1|AF045033 Zea mays nitrate-induced NOI protein mRNA, complete cds
          Length = 612

 Score =  147 bits (74), Expect = 3e-32
 Identities = 158/186 (84%)
 Strand = Plus / Plus

                                                                       
Query: 48  atccatgtcggaggaatctggtcgccctttgcccaagtttggcgaatgggacgtcaacga 107
           ||||||| |||||||||| || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 150 atccatggcggaggaatcaggccgtcccttgccaaagtttggtgaatgggatgtcaacga 209

                                                                       
Query: 108 cccagcttctgctgatggattcacagttatattcaacaaagccagggatgagaaaaaggc 167
            || ||||| || || ||||| || || ||||||||||||||||| |||||||| |||| 
Sbjct: 210 tccggcttccgcagacggatttactgtcatattcaacaaagccagagatgagaagaaggg 269

                                                                       
Query: 168 tgggaatggacaagatactgaatccccttgcaaagacgccaggactgagagggtggaatc 227
           ||||||||| ||||| || || || |||| ||| ||| ||||||||||||||||||| ||
Sbjct: 270 tgggaatggtcaagacacagactcaccttccaaggaccccaggactgagagggtggagtc 329

                 
Query: 228 ttatgc 233
           ||||||
Sbjct: 330 ttatgc 335
to top
>gb|AF030385.1|AF030385 Zea mays nitrate-induced NOI protein gene, complete cds
          Length = 5278

 Score =  137 bits (69), Expect = 3e-29
 Identities = 150/177 (84%)
 Strand = Plus / Plus

                                                                        
Query: 57   ggaggaatctggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttc 116
            ||||||||| || || || ||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 4176 ggaggaatcaggccgtcccttgccaaagtttggtgaatgggatgtcaacgatccggcttc 4235

                                                                        
Query: 117  tgctgatggattcacagttatattcaacaaagccagggatgagaaaaaggctgggaatgg 176
             || || ||||| || || ||||||||||||||||| |||||||| |||| |||||||||
Sbjct: 4236 cgcagacggatttactgtcatattcaacaaagccagagatgagaagaagggtgggaatgg 4295

                                                                     
Query: 177  acaagatactgaatccccttgcaaagacgccaggactgagagggtggaatcttatgc 233
             ||||| || || || |||| ||| ||| ||||||||||||||||||| ||||||||
Sbjct: 4296 tcaagacacagactcaccttccaaggaccccaggactgagagggtggagtcttatgc 4352
to top
>emb|CR962136.2| Medicago truncatula chromosome 5 clone mth2-52n22, COMPLETE SEQUENCE
          Length = 87738

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                         
Query: 82    aagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
             ||||||||||||||||| |||||||| |||||||| ||||| || | |||||| || || 
Sbjct: 58197 aagtttggcgaatgggatgtcaacgatccagcttcagctgaaggttacacagtgattttt 58138

                                     
Query: 142   aacaaagccagggatgagaaaaag 165
             |||||||| |||||||||||||||
Sbjct: 58137 aacaaagctagggatgagaaaaag 58114
to top
>emb|CR931742.1| Medicago truncatula chromosome 5 clone mth2-28i20, COMPLETE SEQUENCE
          Length = 115743

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                         
Query: 82    aagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
             ||||||||||||||||| |||||||| |||||||| ||||| || | |||||| || || 
Sbjct: 22726 aagtttggcgaatgggatgtcaacgatccagcttcagctgaaggttacacagtgattttt 22667

                                     
Query: 142   aacaaagccagggatgagaaaaag 165
             |||||||| |||||||||||||||
Sbjct: 22666 aacaaagctagggatgagaaaaag 22643
to top
>gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete sequence
          Length = 94766

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                         
Query: 73    cctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcaca 132
             ||||| ||||||||||| |||||||| || || || || || || ||||| |||||||| 
Sbjct: 82132 cctttacccaagtttggggaatgggatgtgaatgatcctgcatcagctgaaggattcact 82191

                                             
Query: 133   gttatattcaacaaagccagggatgagaaaaa 164
             |||||||||||||| ||||| |||||||||||
Sbjct: 82192 gttatattcaacaaggccagagatgagaaaaa 82223
to top
>ref|XM_467563.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 213

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 72/85 (84%)
 Strand = Plus / Plus

                                                                       
Query: 82  aagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
           ||||| |||| ||||||||||||| |||| || ||||| || || ||||| || || |||
Sbjct: 31  aagttcggcgcatgggacgtcaacaacccggcctctgccgacggtttcacggtgatcttc 90

                                    
Query: 142 aacaaagccagggatgagaaaaagg 166
           | |||||||||||||||||| ||||
Sbjct: 91  agcaaagccagggatgagaagaagg 115



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 250 aagaagtggttttgctgcgtgacgccaagtcctacacaatcttgagga 297
           ||||||||||||||||| ||| |||| || || || ||| ||||||||
Sbjct: 144 aagaagtggttttgctgtgtgtcgcccagccccacccaaccttgagga 191
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                            
Query: 82       aagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
                ||||| |||| ||||||||||||| |||| || ||||| || || ||||| || || |||
Sbjct: 30174118 aagttcggcgcatgggacgtcaacaacccggcctctgccgacggtttcacggtgatcttc 30174059

                                         
Query: 142      aacaaagccagggatgagaaaaagg 166
                | |||||||||||||||||| ||||
Sbjct: 30174058 agcaaagccagggatgagaagaagg 30174034



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 250      aagaagtggttttgctgcgtgacgccaagtcctacacaatcttgagga 297
                ||||||||||||||||| ||| |||| || || || ||| ||||||||
Sbjct: 30173777 aagaagtggttttgctgtgtgtcgcccagccccacccaaccttgagga 30173730
to top
>dbj|AP004179.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1124_G07
          Length = 93240

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                         
Query: 82    aagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
             ||||| |||| ||||||||||||| |||| || ||||| || || ||||| || || |||
Sbjct: 46822 aagttcggcgcatgggacgtcaacaacccggcctctgccgacggtttcacggtgatcttc 46763

                                      
Query: 142   aacaaagccagggatgagaaaaagg 166
             | |||||||||||||||||| ||||
Sbjct: 46762 agcaaagccagggatgagaagaagg 46738



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                             
Query: 250   aagaagtggttttgctgcgtgacgccaagtcctacacaatcttgagga 297
             ||||||||||||||||| ||| |||| || || || ||| ||||||||
Sbjct: 46481 aagaagtggttttgctgtgtgtcgcccagccccacccaaccttgagga 46434
to top
>ref|NM_124967.2| Arabidopsis thaliana NOI AT5G55850 (NOI) mRNA, complete cds
          Length = 866

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  ggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatgga 126
           ||||| || ||||| || ||||| |||||||| || || || ||||| || || || || 
Sbjct: 253 ggtcgtcccttgccaaaatttggtgaatgggatgtgaatgatccagcatcagcagaaggt 312

                                                  
Query: 127 ttcacagttatattcaacaaagccagggatgagaaaaag 165
           || ||||| |||||||||||||| |||||||||||||||
Sbjct: 313 tttacagtgatattcaacaaagctagggatgagaaaaag 351
to top
>gb|AY096671.1| Arabidopsis thaliana putative nitrate-induced NOI protein
           (At5g55850) mRNA, complete cds
          Length = 271

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  ggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatgga 126
           ||||| || ||||| || ||||| |||||||| || || || ||||| || || || || 
Sbjct: 13  ggtcgtcccttgccaaaatttggtgaatgggatgtgaatgatccagcatcagcagaaggt 72

                                                  
Query: 127 ttcacagttatattcaacaaagccagggatgagaaaaag 165
           || ||||| |||||||||||||| |||||||||||||||
Sbjct: 73  tttacagtgatattcaacaaagctagggatgagaaaaag 111
to top
>gb|AY065260.1| Arabidopsis thaliana putative NOI protein, nitrate-induced
           (At5g55850) mRNA, complete cds
          Length = 797

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  ggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatgga 126
           ||||| || ||||| || ||||| |||||||| || || || ||||| || || || || 
Sbjct: 259 ggtcgtcccttgccaaaatttggtgaatgggatgtgaatgatccagcatcagcagaaggt 318

                                                  
Query: 127 ttcacagttatattcaacaaagccagggatgagaaaaag 165
           || ||||| |||||||||||||| |||||||||||||||
Sbjct: 319 tttacagtgatattcaacaaagctagggatgagaaaaag 357
to top
>emb|BX833781.1|CNS09Z02 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL76ZG05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 624

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  ggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatgga 126
           ||||| || ||||| || ||||| |||||||| || || || ||||| || || || || 
Sbjct: 204 ggtcgtcccttgccaaaatttggtgaatgggatgtgaatgatccagcatcagcagaaggt 263

                                                  
Query: 127 ttcacagttatattcaacaaagccagggatgagaaaaag 165
           || ||||| |||||||||||||| |||||||||||||||
Sbjct: 264 tttacagtgatattcaacaaagctagggatgagaaaaag 302
to top
>dbj|AB018120.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3
          Length = 42356

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                        
Query: 67   ggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatgga 126
            ||||| || ||||| || ||||| |||||||| || || || ||||| || || || || 
Sbjct: 9432 ggtcgtcccttgccaaaatttggtgaatgggatgtgaatgatccagcatcagcagaaggt 9491

                                                   
Query: 127  ttcacagttatattcaacaaagccagggatgagaaaaag 165
            || ||||| |||||||||||||| |||||||||||||||
Sbjct: 9492 tttacagtgatattcaacaaagctagggatgagaaaaag 9530
to top
>gb|AY105745.1| Zea mays PCO136119 mRNA sequence
          Length = 677

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 79  cccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttata 138
           |||||||| |||||||||||||| ||| |||| || ||||| || || ||||| || || 
Sbjct: 168 cccaagttcggcgaatgggacgtgaacaacccggcctctgccgacgggttcacggtgatc 227

                                  
Query: 139 ttcaacaaagccagggatgagaa 161
           |||| ||| ||||||||||||||
Sbjct: 228 ttcagcaaggccagggatgagaa 250
to top
>gb|AF030386.1|AF030386 Arabidopsis thaliana NOI protein mRNA, complete cds
          Length = 632

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  ggtcgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatgga 126
           ||||| || ||||| || ||||| |||||||| || || || ||||| || || || || 
Sbjct: 213 ggtcgtcccttgccaaaatttggtgaatgggatgtgaatgatccagcatcagcagaaggt 272

                                                  
Query: 127 ttcacagttatattcaacaaagccagggatgagaaaaag 165
           || ||||| |||||||||||||| |||||||||||||||
Sbjct: 273 tttacagtgatattcaacaaagctagggatgagaaaaag 311
to top
>gb|DQ160112.1| Taraxacum officinale TO72-1rc (To72-1rc) mRNA, partial cds
          Length = 350

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 76  ttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagtt 135
           ||||| |||||||| || ||||| || || ||||| || || ||||| || ||||| |||
Sbjct: 64  ttgccaaagtttggtgactgggatgtgaatgaccctgcatcagctgaggggttcacggtt 123

                                         
Query: 136 atattcaacaaagccagggatgagaaaaag 165
           ||||||||||| || ||| |||||||||||
Sbjct: 124 atattcaacaaggcgaggaatgagaaaaag 153
to top
>gb|AY140529.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-11 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1105

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 70   cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
            ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 908  cgcccgttgccaaagtttggcgaatgggatgtgaatgacccttcatcagctgagggattt 967

                                                 
Query: 130  acagttatattcaacaaagccagggatgagaaaaagg 166
            || ||||| ||||||||||| ||  | ||||||||||
Sbjct: 968  actgttatcttcaacaaagctagaaacgagaaaaagg 1004
to top
>gb|AY140528.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-4 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1105

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 70   cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
            ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 908  cgcccgttgccaaagtttggcgaatgggatgtgaatgacccttcatcagctgagggattt 967

                                                 
Query: 130  acagttatattcaacaaagccagggatgagaaaaagg 166
            || ||||| ||||||||||| ||  | ||||||||||
Sbjct: 968  actgttatcttcaacaaagctagaaacgagaaaaagg 1004
to top
>gb|AY140527.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-3 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1105

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 70   cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
            ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 908  cgcccgttgccaaagtttggcgaatgggatgtgaatgacccttcatcagctgagggattt 967

                                                 
Query: 130  acagttatattcaacaaagccagggatgagaaaaagg 166
            || ||||| ||||||||||| ||  | ||||||||||
Sbjct: 968  actgttatcttcaacaaagctagaaacgagaaaaagg 1004
to top
>emb|BX833526.1|CNS09ZA1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZB12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 673

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 130 acagttatattcaacaaagccagggatgagaaaaag 165
           ||||| |||||||||||||| |||||||||||||||
Sbjct: 196 acagtaatattcaacaaagctagggatgagaaaaag 231
to top
>gb|AY140526.1| Arabidopsis thaliana clone P3WB2-A11-6094 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1011

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgtaaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140525.1| Arabidopsis thaliana clone P3WB2-A11-6092 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1011

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgtaaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140524.1| Arabidopsis thaliana clone P3WB2-A11-6054 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140522.1| Arabidopsis thaliana clone P3WB2-A11-1220 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1012

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 804 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 863

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 864 actgttatcttcaacaaagc 883
to top
>gb|AY140521.1| Arabidopsis thaliana clone P3WB2-A11-1202 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1012

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 804 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 863

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 864 actgttatcttcaacaaagc 883
to top
>gb|AY140520.1| Arabidopsis thaliana clone P3WB2-A11-1084 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1011

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140519.1| Arabidopsis thaliana clone P3WB2-A11-1074 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140518.1| Arabidopsis thaliana clone P3WB2-A11-1006 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140517.1| Arabidopsis thaliana clone P3WB2-A11-996 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140516.1| Arabidopsis thaliana clone P3WB2-A11-970 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140515.1| Arabidopsis thaliana clone P3WB2-A11-903 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1017

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 803 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgagggattt 862

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 863 actgttatcttcaacaaagc 882
to top
>gb|AY140531.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-15 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1136

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 79/97 (81%)
 Strand = Plus / Plus

                                                                        
Query: 70   cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
            ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 939  cgcccgttgccgaagtttggcgaatgggatgtgaatgacccttcatcagctgagggattt 998

                                                 
Query: 130  acagttatattcaacaaagccagggatgagaaaaagg 166
            || ||||| ||||| ||||| ||  | ||||||||||
Sbjct: 999  actgttatcttcaataaagctagaaacgagaaaaagg 1035
to top
>gb|AY140530.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-14 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1137

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 79/97 (81%)
 Strand = Plus / Plus

                                                                        
Query: 70   cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
            ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| ||||| 
Sbjct: 940  cgcccgttgccgaagtttggcgaatgggatgtgaatgacccttcatcagctgagggattt 999

                                                 
Query: 130  acagttatattcaacaaagccagggatgagaaaaagg 166
            || ||||| ||||| ||||| ||  | ||||||||||
Sbjct: 1000 actgttatcttcaataaagctagaaacgagaaaaagg 1036
to top
>ref|NM_126474.1| Arabidopsis thaliana unknown protein AT2G04410 mRNA, complete cds
          Length = 521

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| || || 
Sbjct: 144 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgaggggttt 203

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 204 actgttatcttcaacaaagc 223
to top
>gb|AC006951.6| Arabidopsis thaliana chromosome 2 clone T1O3 map RNS1, complete
             sequence
          Length = 99804

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                         
Query: 70    cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
             ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| || || 
Sbjct: 67937 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgaggggttt 67996

                                 
Query: 130   acagttatattcaacaaagc 149
             || ||||| |||||||||||
Sbjct: 67997 actgttatcttcaacaaagc 68016
to top
>gb|AY058877.1| Arabidopsis thaliana At2g04410/T1O3.18 mRNA, complete cds
          Length = 563

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| || || 
Sbjct: 93  cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgaggggttt 152

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 153 actgttatcttcaacaaagc 172
to top
>gb|AY140523.1| Arabidopsis thaliana clone P3WB2-A11-1248 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1012

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgccctttgcccaagtttggcgaatgggacgtcaacgacccagcttctgctgatggattc 129
           ||||| ||||| ||||||||||||||||| || || |||||  | || ||||| || || 
Sbjct: 804 cgcccgttgccgaagtttggcgaatgggatgttaatgacccttcatcagctgaggggttt 863

                               
Query: 130 acagttatattcaacaaagc 149
           || ||||| |||||||||||
Sbjct: 864 actgttatcttcaacaaagc 883
to top
>dbj|AK059360.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-D12, full
           insert sequence
          Length = 303

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 261 ttgctgcgtgacgccaagtcctacacaatcttga 294
           ||||||||||||  | ||||||||||||||||||
Sbjct: 1   ttgctgcgtgacatccagtcctacacaatcttga 34
to top
>ref|NM_123429.2| Arabidopsis thaliana unknown protein AT5G40645 mRNA, complete cds
          Length = 438

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 85  tttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
           ||||| ||||||||||| ||||| ||||| || || || ||||| || |||||||||
Sbjct: 141 tttggagaatgggacgtgaacgatccagcatcagccgaaggatttacggttatattc 197
to top
>gb|DQ447022.1| Arabidopsis thaliana clone pENTR221-At5g40645 nitrate-responsive
           NOI protein (At5g40645) mRNA, complete cds
          Length = 222

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 85  tttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
           ||||| ||||||||||| ||||| ||||| || || || ||||| || |||||||||
Sbjct: 52  tttggagaatgggacgtgaacgatccagcatcagccgaaggatttacggttatattc 108
to top
>emb|AL138899.23| Human DNA sequence from clone RP11-404O13 on chromosome 1 Contains two
             novel genes, a elongation factor RNA polymerase II 2
             (ELL2) pseudogene, the CD1D gene for CD1D antigen, d
             polypeptide and a ribosomal protein S10 (RPS10)
             pseudogene, complete sequence
          Length = 134137

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 314   cagaagaagaatggttgggaa 334
             |||||||||||||||||||||
Sbjct: 22069 cagaagaagaatggttgggaa 22089
to top
>dbj|AB009052.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNF13
          Length = 85992

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 85    tttggcgaatgggacgtcaacgacccagcttctgctgatggattcacagttatattc 141
             ||||| ||||||||||| ||||| ||||| || || || ||||| || |||||||||
Sbjct: 55470 tttggagaatgggacgtgaacgatccagcatcagccgaaggatttacggttatattc 55414
to top
>gb|AC102566.9| Mus musculus chromosome 9, clone RP23-223D10, complete sequence
          Length = 253343

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      cccctctaccctaccccctc 21
              ||||||||||||||||||||
Sbjct: 160464 cccctctaccctaccccctc 160445
to top
>gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosome 7, complete
            sequence
          Length = 176054

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 273  gccaagtcctacacaatctt 292
            ||||||||||||||||||||
Sbjct: 7145 gccaagtcctacacaatctt 7126
to top
>gb|AC099930.11| Mus musculus chromosome 7, clone RP23-17C12, complete sequence
          Length = 224617

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 273    gccaagtcctacacaatctt 292
              ||||||||||||||||||||
Sbjct: 181014 gccaagtcctacacaatctt 180995
to top
>emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J21 on chromosome 1q23.3-24.3
              Contains part of the TNR gene for tenascin R (restrictin,
              janusin), a novel gene and one CpG island, complete
              sequence
          Length = 138636

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 154    gatgagaaaaaggctgggaa 173
              ||||||||||||||||||||
Sbjct: 101027 gatgagaaaaaggctgggaa 101046
to top
>emb|AL844182.10| Mouse DNA sequence from clone RP23-399H17 on chromosome 4, complete
              sequence
          Length = 201590

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 313    ccagaagaagaatggttgggaaag 336
              ||||| ||||||||||||||||||
Sbjct: 111505 ccagaggaagaatggttgggaaag 111528
to top
>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    tcaatccatgtcggaggaat 64
             ||||||||||||||||||||
Sbjct: 15343 tcaatccatgtcggaggaat 15324
to top
>gb|AC022267.8|AC022267 Homo sapiens BAC clone RP11-407H18 from 4, complete sequence
          Length = 199472

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    ggatgagaaaaaggctggga 172
              ||||||||||||||||||||
Sbjct: 168963 ggatgagaaaaaggctggga 168944
to top
>emb|BX324002.8| Zebrafish DNA sequence from clone CH211-129H21 in linkage group 24,
              complete sequence
          Length = 178173

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 129    cacagttatattcaacaaag 148
              ||||||||||||||||||||
Sbjct: 120384 cacagttatattcaacaaag 120365
to top
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 301     caagctgccaccccagaagaagaa 324
               ||||| ||||||||||||||||||
Sbjct: 2937198 caagcagccaccccagaagaagaa 2937175
to top
>emb|CT025664.5| Mouse DNA sequence from clone RP24-174I18 on chromosome 9, complete
             sequence
          Length = 163813

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     cccctctaccctaccccctc 21
             ||||||||||||||||||||
Sbjct: 56446 cccctctaccctaccccctc 56427
to top
>dbj|AP006701.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT08P04, TM0587,
             complete sequence
          Length = 110885

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 308   ccaccccagaagaagaatggttgg 331
             |||| |||||||||||||||||||
Sbjct: 64460 ccacaccagaagaagaatggttgg 64483


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,000,762
Number of Sequences: 3902068
Number of extensions: 3000762
Number of successful extensions: 56294
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56177
Number of HSP's gapped (non-prelim): 117
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top