ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal40n11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF521177.1| Hordeum vulgare contig 211252, complete sequence 56 9e-05
2gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 42 1.4
3gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 5.5
4gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 5.5
5gb|AF289163.1| Uncultured bacterium clone PRD01b003B 16S ribosom... 40 5.5
6gb|AY373224.1| Human coxsackievirus B3 strain 10181 RNA-dependen... 40 5.5
7gb|AY429470.1| Swine vesicular disease virus strain HK'70, compl... 40 5.5
8gb|CP000001.1| Bacillus cereus E33L, complete genome 40 5.5
9gb|AF158101.6| Enterobacteria phage T4, complete genome 40 5.5
10emb|AL357118.10| Human DNA sequence from clone RP11-292K6 on chr... 40 5.5
11gb|AC162917.3| Mus musculus BAC clone RP23-379N7 from chromosome... 40 5.5
12emb|X15818.2|MYT43459 Bacteriphage T4C genes 34, 33 and 59 40 5.5
13gb|AC092612.3| Homo sapiens BAC clone RP11-174F8 from 4, complet... 40 5.5
14gb|AC010269.6| Homo sapiens chromosome 5 clone CTC-485I21, compl... 40 5.5
15dbj|D00435.1|SVDG Swine vesicular disease virus (STRAIN H/3 '76)... 40 5.5
16gb|AC091978.3| Homo sapiens chromosome 5 clone RP11-531A21, comp... 40 5.5
17gb|AC005878.3|AC005878 citb_255_f_20, complete sequence 40 5.5
18gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 5.5
19gb|AC135358.3| Mus musculus BAC clone RP24-107J13 from 9, comple... 40 5.5
20gb|AC166350.4| Mus musculus BAC clone RP24-220P10 from chromosom... 40 5.5

>gb|AF521177.1| Hordeum vulgare contig 211252, complete sequence
          Length = 211664

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                             
Query: 220   aactccagtatcgacctagatcgagtcttgtc 251
             ||||||||||||||| ||||||||||||||||
Sbjct: 72015 aactccagtatcgacatagatcgagtcttgtc 71984



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 147   cctagtcacgcggaacatgataggttatggcttgatcatg 186
             |||| |||||||| || ||||||||||||||||| |||||
Sbjct: 72087 cctaatcacgcgggacgtgataggttatggcttggtcatg 72048



to top

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 382    atccagtcatccggtcaggggcatgcgtgtttc 414
              |||| |||||| ||||||||||||| |||||||
Sbjct: 398225 atcctgtcatcgggtcaggggcatgggtgtttc 398257



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 382    atccagtcatccggtcaggggcatgcgtgtttc 414
              |||| |||||| ||||||||||||| |||||||
Sbjct: 283996 atcctgtcatcgggtcaggggcatgggtgtttc 284028



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 323     ttatcagtcacaaacaaatt 342
               ||||||||||||||||||||
Sbjct: 2725045 ttatcagtcacaaacaaatt 2725026



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 323     ttatcagtcacaaacaaatt 342
               ||||||||||||||||||||
Sbjct: 2725380 ttatcagtcacaaacaaatt 2725361



to top

>gb|AF289163.1| Uncultured bacterium clone PRD01b003B 16S ribosomal RNA gene, partial
            sequence
          Length = 1579

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 210  aaacttggttaactccagta 229
            ||||||||||||||||||||
Sbjct: 1138 aaacttggttaactccagta 1157



to top

>gb|AY373224.1| Human coxsackievirus B3 strain 10181 RNA-dependent RNA polymerase
           (3D) gene, partial cds
          Length = 491

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 169 ggttatggcttgatcatgac 188
           ||||||||||||||||||||
Sbjct: 332 ggttatggcttgatcatgac 351



to top

>gb|AY429470.1| Swine vesicular disease virus strain HK'70, complete genome
          Length = 7401

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 169  ggttatggcttgatcatgac 188
            ||||||||||||||||||||
Sbjct: 6960 ggttatggcttgatcatgac 6979



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 323     ttatcagtcacaaacaaatt 342
               ||||||||||||||||||||
Sbjct: 2788966 ttatcagtcacaaacaaatt 2788947



to top

>gb|AF158101.6| Enterobacteria phage T4, complete genome
          Length = 168903

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    taaaacttggttaactccag 227
              ||||||||||||||||||||
Sbjct: 151261 taaaacttggttaactccag 151242



to top

>emb|AL357118.10| Human DNA sequence from clone RP11-292K6 on chromosome 10, complete
             sequence
          Length = 91654

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    tcatgcatgctactcagatt 89
             ||||||||||||||||||||
Sbjct: 68551 tcatgcatgctactcagatt 68570



to top

>gb|AC162917.3| Mus musculus BAC clone RP23-379N7 from chromosome 9, complete sequence
          Length = 189606

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 59     actttgcatgttcatgcatgctac 82
              ||||||||||| ||||||||||||
Sbjct: 123271 actttgcatgtgcatgcatgctac 123248



to top

>emb|X15818.2|MYT43459 Bacteriphage T4C genes 34, 33 and 59
          Length = 4911

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 208  taaaacttggttaactccag 227
            ||||||||||||||||||||
Sbjct: 1632 taaaacttggttaactccag 1651



to top

>gb|AC092612.3| Homo sapiens BAC clone RP11-174F8 from 4, complete sequence
          Length = 145706

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 96     atggtgaaatatgatggtgg 115
              ||||||||||||||||||||
Sbjct: 143422 atggtgaaatatgatggtgg 143403



to top

>gb|AC010269.6| Homo sapiens chromosome 5 clone CTC-485I21, complete sequence
          Length = 187084

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 71     catgcatgctactcagattataacaatg 98
              ||||||||||||| | ||||||||||||
Sbjct: 163270 catgcatgctactgaaattataacaatg 163297



to top

>dbj|D00435.1|SVDG Swine vesicular disease virus (STRAIN H/3 '76) genomic RNA, complete
            genome
          Length = 7401

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 169  ggttatggcttgatcatgac 188
            ||||||||||||||||||||
Sbjct: 6960 ggttatggcttgatcatgac 6979



to top

>gb|AC091978.3| Homo sapiens chromosome 5 clone RP11-531A21, complete sequence
          Length = 192708

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 71    catgcatgctactcagattataacaatg 98
             ||||||||||||| | ||||||||||||
Sbjct: 33146 catgcatgctactgaaattataacaatg 33173



to top

>gb|AC005878.3|AC005878 citb_255_f_20, complete sequence
          Length = 148852

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tcatgcatgctactcagatt 89
             ||||||||||||||||||||
Sbjct: 72848 tcatgcatgctactcagatt 72829



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 323     ttatcagtcacaaacaaatt 342
               ||||||||||||||||||||
Sbjct: 2724917 ttatcagtcacaaacaaatt 2724898



to top

>gb|AC135358.3| Mus musculus BAC clone RP24-107J13 from 9, complete sequence
          Length = 182075

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 59     actttgcatgttcatgcatgctac 82
              ||||||||||| ||||||||||||
Sbjct: 165808 actttgcatgtgcatgcatgctac 165831



to top

>gb|AC166350.4| Mus musculus BAC clone RP24-220P10 from chromosome 17, complete
             sequence
          Length = 156954

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    tactttgcatgttcatgcat 77
             ||||||||||||||||||||
Sbjct: 68689 tactttgcatgttcatgcat 68670


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,677,267
Number of Sequences: 3902068
Number of extensions: 2677267
Number of successful extensions: 54198
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54096
Number of HSP's gapped (non-prelim): 102
length of query: 414
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 392
effective length of database: 17,147,199,772
effective search space: 6721702310624
effective search space used: 6721702310624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top