| Clone Name | baal40c14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY136627.1| Hordeum vulgare subsp. vulgare plasma membrane P-type proton pump ATPase (Ha1) mRNA, complete cds Length = 3446 Score = 250 bits (126), Expect = 1e-63 Identities = 156/161 (96%), Gaps = 4/161 (2%) Strand = Plus / Plus Query: 1 ggtgcactctgtgcattgagcaagtacgctganncgtgggcttcgttcgcttgctgttgc 60 ||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 1522 ggtgcactctgtg-attgag-aagtacgctgag-cgtgggcttcgttcgcttgctgttgc 1578 Query: 61 aagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattg 120 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1579 aagacaggaagtacctgagaaatccaagg-attctgctggtggaccatggcaattcattg 1637 Query: 121 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1638 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 1678
>gb|AF308817.1|AF308817 Hordeum vulgare plasmalemma H+-ATPase 2 mRNA, partial cds Length = 719 Score = 250 bits (126), Expect = 1e-63 Identities = 156/161 (96%), Gaps = 4/161 (2%) Strand = Plus / Plus Query: 1 ggtgcactctgtgcattgagcaagtacgctganncgtgggcttcgttcgcttgctgttgc 60 ||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 90 ggtgcactctgtg-attgag-aagtacgctgag-cgtgggcttcgttcgcttgctgttgc 146 Query: 61 aagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattg 120 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 147 aagacaggaagtacctgagaaatccaagg-attctgctggtggaccatggcaattcattg 205 Query: 121 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 206 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 246
>gb|AF308816.1|AF308816 Hordeum vulgare plasmalemma H+-ATPase 1 mRNA, partial cds Length = 988 Score = 250 bits (126), Expect = 1e-63 Identities = 156/161 (96%), Gaps = 4/161 (2%) Strand = Plus / Plus Query: 1 ggtgcactctgtgcattgagcaagtacgctganncgtgggcttcgttcgcttgctgttgc 60 ||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 365 ggtgcactctgtg-attgag-aagtacgctgag-cgtgggcttcgttcgcttgctgttgc 421 Query: 61 aagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattg 120 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 422 aagacaggaagtacctgagaaatccaagg-attctgctggtggaccatggcaattcattg 480 Query: 121 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 481 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 521
>emb|AJ344078.1|HVU344078 Hordeum vulgare partial mRNA for plasma membrane H+-ATPase (ha1 gene) Length = 2280 Score = 242 bits (122), Expect = 3e-61 Identities = 155/161 (96%), Gaps = 4/161 (2%) Strand = Plus / Plus Query: 1 ggtgcactctgtgcattgagcaagtacgctganncgtgggcttcgttcgcttgctgttgc 60 ||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 379 ggtgcactctgtg-attgag-aagtacgctgag-cgtgggcttcgttcgcttgctgttgc 435 Query: 61 aagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattg 120 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 436 gagacaggaagtacctgagaaatccaagg-attctgctggtggaccatggcaattcattg 494 Query: 121 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 495 gtctgttgcccctgtttgatcccccaaggcatgacagtgcc 535
>gb|AY543630.1| Triticum aestivum plasma membrane H+-ATPase (ha1) mRNA, complete cds Length = 2856 Score = 208 bits (105), Expect = 4e-51 Identities = 150/160 (93%), Gaps = 4/160 (2%) Strand = Plus / Plus Query: 1 ggtgcactctgtgcattgagcaagtacgctganncgtgggcttcgttcgcttgctgttgc 60 ||||||||||||| |||||| ||||| ||||| |||||||||||||||||||||||||| Sbjct: 1326 ggtgcactctgtg-attgag-aagtatgctgag-cgtgggcttcgttcgcttgctgttgc 1382 Query: 61 aagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattg 120 |||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||| Sbjct: 1383 gagacaggaagtacccgagaaatccaagg-attctcctggtggaccatggcaattcattg 1441 Query: 121 gtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||||||||||| |||||||||||||||||||| Sbjct: 1442 gtctgttgcccctgtttgaccccccaaggcatgacagtgc 1481
>ref|XM_474175.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2856 Score = 170 bits (86), Expect = 8e-40 Identities = 117/126 (92%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 |||||||||||||| |||||||||||||||||||||||||||||||| || |||| | || Sbjct: 1357 cgtgggcttcgttctcttgctgttgcaagacaggaagtacctgagaagtcgaagg-agtc 1415 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||| || Sbjct: 1416 tgctggtggaccatggcaattcgttggtctgctgcccctgtttgatcccccgaggcacga 1475 Query: 155 cagtgc 160 |||||| Sbjct: 1476 cagtgc 1481
>gb|AY224445.1| Oryza sativa (japonica cultivar-group) isolate 23022 plasma membrane H+-ATPase-like protein mRNA, partial cds Length = 1512 Score = 170 bits (86), Expect = 8e-40 Identities = 117/126 (92%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 |||||||||||||| |||||||||||||||||||||||||||||||| || |||| | || Sbjct: 13 cgtgggcttcgttctcttgctgttgcaagacaggaagtacctgagaagtcgaagg-agtc 71 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||| || Sbjct: 72 tgctggtggaccatggcaattcgttggtctgctgcccctgtttgatcccccgaggcacga 131 Query: 155 cagtgc 160 |||||| Sbjct: 132 cagtgc 137
>dbj|AK105082.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C08, full insert sequence Length = 2062 Score = 170 bits (86), Expect = 8e-40 Identities = 117/126 (92%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 |||||||||||||| |||||||||||||||||||||||||||||||| || |||| | || Sbjct: 218 cgtgggcttcgttctcttgctgttgcaagacaggaagtacctgagaagtcgaagg-agtc 276 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||| || Sbjct: 277 tgctggtggaccatggcaattcgttggtctgctgcccctgtttgatcccccgaggcacga 336 Query: 155 cagtgc 160 |||||| Sbjct: 337 cagtgc 342
>dbj|AK100435.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088J16, full insert sequence Length = 3560 Score = 170 bits (86), Expect = 8e-40 Identities = 117/126 (92%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 |||||||||||||| |||||||||||||||||||||||||||||||| || |||| | || Sbjct: 1663 cgtgggcttcgttctcttgctgttgcaagacaggaagtacctgagaagtcgaagg-agtc 1721 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||| || Sbjct: 1722 tgctggtggaccatggcaattcgttggtctgctgcccctgtttgatcccccgaggcacga 1781 Query: 155 cagtgc 160 |||||| Sbjct: 1782 cagtgc 1787
>dbj|AK073066.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033023L01, full insert sequence Length = 2444 Score = 170 bits (86), Expect = 8e-40 Identities = 117/126 (92%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 |||||||||||||| |||||||||||||||||||||||||||||||| || |||| | || Sbjct: 592 cgtgggcttcgttctcttgctgttgcaagacaggaagtacctgagaagtcgaagg-agtc 650 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||| || Sbjct: 651 tgctggtggaccatggcaattcgttggtctgctgcccctgtttgatcccccgaggcacga 710 Query: 155 cagtgc 160 |||||| Sbjct: 711 cagtgc 716
>gb|AY829002.2| Triticum aestivum plasma membrane H+-ATPase gene, promoter region and complete cds Length = 6132 Score = 153 bits (77), Expect = 2e-34 Identities = 93/97 (95%), Gaps = 1/97 (1%) Strand = Plus / Plus Query: 64 acaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattggtc 123 |||||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 3864 acaggaagtacccgagaaatccaagg-attctcctggtggaccatggcaattcattggtc 3922 Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 |||||||||||||||| |||||||||||||||||||| Sbjct: 3923 tgttgcccctgtttgaccccccaaggcatgacagtgc 3959 Score = 65.9 bits (33), Expect = 3e-08 Identities = 62/68 (91%), Gaps = 3/68 (4%) Strand = Plus / Plus Query: 1 ggtgcactctgtgcattgagcaagtacgctganncgtgggcttcgttcgcttgctgttgc 60 ||||||||||||| |||||| ||||| ||||| |||||||||||||||||||||||||| Sbjct: 3722 ggtgcactctgtg-attgag-aagtatgctgag-cgtgggcttcgttcgcttgctgttgc 3778 Query: 61 aagacagg 68 ||||||| Sbjct: 3779 gagacagg 3786
>emb|AJ440218.1|OSA440218 Oryza sativa a7 gene for plasma membrane H+-ATPase Length = 5004 Score = 119 bits (60), Expect = 3e-24 Identities = 88/96 (91%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 65 caggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattggtct 124 ||||||||||||||||| || |||| | |||||||||||||||||||||||| ||||||| Sbjct: 2670 caggaagtacctgagaagtcgaagg-agtctgctggtggaccatggcaattcgttggtct 2728 Query: 125 gttgcccctgtttgatcccccaaggcatgacagtgc 160 | ||||||||||||||||||| ||||| |||||||| Sbjct: 2729 gctgcccctgtttgatcccccgaggcacgacagtgc 2764 Score = 60.0 bits (30), Expect = 2e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacagg 68 |||||||||||||| ||||||||||||||||||| Sbjct: 2558 cgtgggcttcgttctcttgctgttgcaagacagg 2591
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 119 bits (60), Expect = 3e-24 Identities = 88/96 (91%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 65 caggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattggtct 124 ||||||||||||||||| || |||| | |||||||||||||||||||||||| ||||||| Sbjct: 33495917 caggaagtacctgagaagtcgaagg-agtctgctggtggaccatggcaattcgttggtct 33495975 Query: 125 gttgcccctgtttgatcccccaaggcatgacagtgc 160 | ||||||||||||||||||| ||||| |||||||| Sbjct: 33495976 gctgcccctgtttgatcccccgaggcacgacagtgc 33496011 Score = 60.0 bits (30), Expect = 2e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacagg 68 |||||||||||||| ||||||||||||||||||| Sbjct: 33495805 cgtgggcttcgttctcttgctgttgcaagacagg 33495838
>emb|AL442117.1|H0421H08 Oryza sativa genomic DNA, chromosome X, BAC clone: H0421H08, complete sequence Length = 55574 Score = 119 bits (60), Expect = 3e-24 Identities = 88/96 (91%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 65 caggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattggtct 124 ||||||||||||||||| || |||| | |||||||||||||||||||||||| ||||||| Sbjct: 9474 caggaagtacctgagaagtcgaagg-agtctgctggtggaccatggcaattcgttggtct 9532 Query: 125 gttgcccctgtttgatcccccaaggcatgacagtgc 160 | ||||||||||||||||||| ||||| |||||||| Sbjct: 9533 gctgcccctgtttgatcccccgaggcacgacagtgc 9568 Score = 60.0 bits (30), Expect = 2e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacagg 68 |||||||||||||| ||||||||||||||||||| Sbjct: 9362 cgtgggcttcgttctcttgctgttgcaagacagg 9395
>emb|AL606685.3|OSJN00090 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0071I13, complete sequence Length = 152264 Score = 119 bits (60), Expect = 3e-24 Identities = 88/96 (91%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 65 caggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattggtct 124 ||||||||||||||||| || |||| | |||||||||||||||||||||||| ||||||| Sbjct: 72206 caggaagtacctgagaagtcgaagg-agtctgctggtggaccatggcaattcgttggtct 72264 Query: 125 gttgcccctgtttgatcccccaaggcatgacagtgc 160 | ||||||||||||||||||| ||||| |||||||| Sbjct: 72265 gctgcccctgtttgatcccccgaggcacgacagtgc 72300 Score = 60.0 bits (30), Expect = 2e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacagg 68 |||||||||||||| ||||||||||||||||||| Sbjct: 72094 cgtgggcttcgttctcttgctgttgcaagacagg 72127
>gb|AF480431.1| Zea mays plasma membrane H+ ATPase-like gene, partial sequence Length = 6539 Score = 99.6 bits (50), Expect = 2e-18 Identities = 84/94 (89%), Gaps = 1/94 (1%) Strand = Plus / Minus Query: 64 acaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaattcattggtc 123 ||||||||||||||||||| ||||| | || |||||||||||||||| ||| |||||| Sbjct: 4669 acaggaagtacctgagaaaaacaagg-agtcccctggtggaccatggcagttcgttggtc 4611 Query: 124 tgttgcccctgtttgatcccccaaggcatgacag 157 ||||||||||||||||||| || ||||||||||| Sbjct: 4610 tgttgcccctgtttgatccgcctaggcatgacag 4577 Score = 52.0 bits (26), Expect = 5e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacagg 68 ||||| |||||||||||||||||||| ||||||| Sbjct: 4785 cgtggtcttcgttcgcttgctgttgccagacagg 4752
>emb|AJ286748.1|SRO286748 Sesbania rostrata partial mRNA for p-type H+-ATPase (ha4 gene) Length = 736 Score = 87.7 bits (44), Expect = 9e-15 Identities = 102/120 (85%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 41 cttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgctgg 100 |||||||| ||||||||||| ||||||||||| ||||||||||| || | | |||||| Sbjct: 347 cttcgttcacttgctgttgctagacaggaagttcctgagaaatcaaaag-acagtgctgg 405 Query: 101 tggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||| |||||||| || ||||| || || | |||||||||||||| |||||||||||||| Sbjct: 406 tggtccatggcagtttgttggtttgctgtcactgtttgatccccctaggcatgacagtgc 465
>emb|AJ286747.1|SRO286747 Sesbania rostrata partial mRNA for p-type H+-ATPase (ha3 gene) Length = 736 Score = 87.7 bits (44), Expect = 9e-15 Identities = 102/120 (85%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 41 cttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgctgg 100 |||||||| ||||||||||| ||||||||||| ||||||||||| || | | | ||||| Sbjct: 347 cttcgttcacttgctgttgctagacaggaagttcctgagaaatcaaaagaaagc-gctgg 405 Query: 101 tggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||| |||||||| || ||||| ||||| | |||||||| |||||||| ||||||||||| Sbjct: 406 tggtccatggcagtttgttggtttgttgtcactgtttgaccccccaagacatgacagtgc 465
>dbj|AB086373.1| Sesbania rostrata srha4 mRNA for plasma membrane H+-ATPase, complete cds Length = 3527 Score = 87.7 bits (44), Expect = 9e-15 Identities = 102/120 (85%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 41 cttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgctgg 100 |||||||| ||||||||||| ||||||||||| ||||||||||| || | | |||||| Sbjct: 1585 cttcgttcacttgctgttgctagacaggaagttcctgagaaatcaaaag-acagtgctgg 1643 Query: 101 tggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||| |||||||| || ||||| || || | |||||||||||||| |||||||||||||| Sbjct: 1644 tggtccatggcagtttgttggtttgctgtcactgtttgatccccctaggcatgacagtgc 1703
>emb|X85805.1|ZMPMHATP Z.mays mRNA for plasma membrane H+ ATPase Length = 3369 Score = 85.7 bits (43), Expect = 4e-14 Identities = 104/123 (84%), Gaps = 1/123 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 ||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| | Sbjct: 1562 cgtggtcttcgttcgcttgctgttgccagacaggaagtacctgagaaaaacaagg-agag 1620 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 | | || || |||||||| ||| |||||||||||| |||||||||| || |||||||| Sbjct: 1621 tccgggggggccatggcagttcgttggtctgttgcgggtgtttgatccgcctaggcatga 1680 Query: 155 cag 157 ||| Sbjct: 1681 cag 1683
>gb|AY338228.1| Phaseolus acutifolius clone pTLH3-R P-type H+-ATPase mRNA, partial cds Length = 734 Score = 83.8 bits (42), Expect = 1e-13 Identities = 91/106 (85%), Gaps = 1/106 (0%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaat 114 |||||||||||||||||||||||| ||||| || | || |||||||||||||||||||| Sbjct: 399 tgttgcaagacaggaagtacctgaaaaatcaaaag-atggtgctggtggaccatggcaat 457 Query: 115 tcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 | |||||||| | || |||||||||| || |||||||| ||||| Sbjct: 458 ttgttggtctgctaccattgtttgatcctcccaggcatgatagtgc 503
>dbj|AB177647.1| Daucus carota DcPA 1 mRNA for plasma membrane H+-ATPase, complete cds Length = 3201 Score = 81.8 bits (41), Expect = 6e-13 Identities = 90/105 (85%), Gaps = 1/105 (0%) Strand = Plus / Plus Query: 56 gttgcaagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaatt 115 |||||||| |||| ||| ||||||||||| || | || ||||||||| ||||||||||| Sbjct: 1453 gttgcaagccaggtagtgcctgagaaatcaaaag-atagtgctggtggcccatggcaatt 1511 Query: 116 cattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 | ||||| || || |||| |||||||| ||||||||||||||||| Sbjct: 1512 cgttggtttgctgtccctatttgatcctccaaggcatgacagtgc 1556
>gb|AY989893.1| Lupinus albus plasma membrane H+ ATPase (LHA1) mRNA, complete cds Length = 3382 Score = 77.8 bits (39), Expect = 9e-12 Identities = 103/123 (83%), Gaps = 1/123 (0%) Strand = Plus / Plus Query: 38 gggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgc 97 ||||||||||| |||||||| || ||||||||||| ||||||||| | || | | ||| Sbjct: 1542 gggcttcgttctcttgctgtagctagacaggaagttcctgagaaagcaaaagaaag-tgc 1600 Query: 98 tggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacag 157 |||||| |||||| | || ||||| ||||| | ||||||||||||||||||||||| || Sbjct: 1601 tggtggtccatgggagtttgttggtttgttgtcactgtttgatcccccaaggcatgatag 1660 Query: 158 tgc 160 ||| Sbjct: 1661 tgc 1663
>emb|X85804.1|PVBHA1 P.vulgaris mRNA for plasma membrane H+ ATPase Length = 3409 Score = 75.8 bits (38), Expect = 4e-11 Identities = 90/106 (84%), Gaps = 1/106 (0%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaat 114 |||||||||||||||||||||||| ||||| || | || |||||||||||||||||||| Sbjct: 1696 tgttgcaagacaggaagtacctgaaaaatcaaaag-atggtgctggtggaccatggcaat 1754 Query: 115 tcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 | |||||||| | || |||||||||| || || ||||| ||||| Sbjct: 1755 ttgttggtctgctaccattgtttgatcctcccagacatgatagtgc 1800
>gb|AY109425.1| Zea mays CL1965_1 mRNA sequence Length = 3431 Score = 73.8 bits (37), Expect = 1e-10 Identities = 43/45 (95%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgag 79 ||||| |||||||||||||||||||| |||||||||||||||||| Sbjct: 1562 cgtggtcttcgttcgcttgctgttgccagacaggaagtacctgag 1606
>gb|AY989895.1| Lupinus albus plasma membrane H+ ATPase (LHA2) mRNA, complete cds Length = 3365 Score = 69.9 bits (35), Expect = 2e-09 Identities = 102/123 (82%), Gaps = 1/123 (0%) Strand = Plus / Plus Query: 38 gggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgc 97 ||||||||||| |||||||| || ||||||||||| ||||||||| | || | | ||| Sbjct: 1498 gggcttcgttctcttgctgtagctagacaggaagttcctgagaaagcaaaag-aaagtgc 1556 Query: 98 tggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacag 157 |||||| ||| |||| || ||||| ||||| | ||||||||||| ||||||||||| || Sbjct: 1557 tggtggtccacggcagtttgttggtttgttgtcactgtttgatcctccaaggcatgatag 1616 Query: 158 tgc 160 ||| Sbjct: 1617 tgc 1619
>dbj|AB057350.1| Vallisneria gigantea vga1 mRNA for plasma membrane H+-ATPase, partial cds Length = 521 Score = 69.9 bits (35), Expect = 2e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 102 ggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||||||| |||||||| |||| |||||||| || |||||||| |||||||| Sbjct: 166 ggaccatggcaattcgttggtctgctgcctctgtttgaccctccaaggcacgacagtgc 224
>dbj|AB177649.1| Daucus carota DcPA 3 mRNA for plasma membrane H+-ATPase, complete cds Length = 3162 Score = 67.9 bits (34), Expect = 9e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||||||||| || || ||||| |||| || |||||||| ||||||||||| Sbjct: 1508 tgctggtggaccatggcagtttataggtctcatgcctctctttgatccgccaaggcatga 1567 Query: 155 cagtgc 160 |||||| Sbjct: 1568 cagtgc 1573
>gb|AF029258.1|AF029258 Kosteletzkya virginica clone KVATP3 plasma membrane H+-ATPase mRNA, partial cds Length = 723 Score = 67.9 bits (34), Expect = 9e-09 Identities = 104/126 (82%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattc 94 ||||||||||| || | ||||||||||||||| |||||||||| ||||| |||| | | Sbjct: 373 cgtgggcttcgatctttagctgttgcaagacagcaagtacctgaaaaatcaaagg-acgc 431 Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 | |||| | |||||||||| | |||||| |||| || || |||||||| || |||||||| Sbjct: 432 tcctggggcaccatggcaacttattggtttgttcccactttttgatcctccgaggcatga 491 Query: 155 cagtgc 160 ||||| Sbjct: 492 tagtgc 497
>ref|NM_101587.2| Arabidopsis thaliana AHA10; ATPase AT1G17260 (AHA10) mRNA, complete cds Length = 2844 Score = 63.9 bits (32), Expect = 1e-07 Identities = 35/36 (97%) Strand = Plus / Plus Query: 119 tggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||| ||||||||||||||||||||||| Sbjct: 1464 tggtctgttgccactgtttgatcccccaaggcatga 1499
>gb|AC007651.2| Arabidopsis thaliana chromosome I BAC F20D23 genomic sequence, complete sequence Length = 114935 Score = 63.9 bits (32), Expect = 1e-07 Identities = 35/36 (97%) Strand = Plus / Minus Query: 119 tggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||| ||||||||||||||||||||||| Sbjct: 16821 tggtctgttgccactgtttgatcccccaaggcatga 16786
>emb|AJ310524.1|VFA310524 Vicia faba L. mRNA for P-type H+-ATPase (ha5 gene) Length = 3270 Score = 63.9 bits (32), Expect = 1e-07 Identities = 56/64 (87%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 |||||| |||||||||||| |||||||||| || |||||||||| || |||||||||| Sbjct: 1506 ctggtgcaccatggcaatttgttggtctgttaccgttgtttgatcctcctaggcatgaca 1565 Query: 157 gtgc 160 |||| Sbjct: 1566 gtgc 1569 Score = 48.1 bits (24), Expect = 0.008 Identities = 27/28 (96%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaa 82 |||||| ||||||||||||||||||||| Sbjct: 1465 tgttgctagacaggaagtacctgagaaa 1492
>gb|S74033.1| plasma membrane H(+)-ATPase isoform AHA10=P-type ATPase [Arabidopsis thaliana, cv. Columbia, Genomic, 6508 nt] Length = 6508 Score = 63.9 bits (32), Expect = 1e-07 Identities = 35/36 (97%) Strand = Plus / Plus Query: 119 tggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||||||| ||||||||||||||||||||||| Sbjct: 3792 tggtctgttgccactgtttgatcccccaaggcatga 3827
>dbj|AB057351.1| Vallisneria gigantea vga2 mRNA for plasma membrane H+-ATPase, partial cds Length = 520 Score = 63.9 bits (32), Expect = 1e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 102 ggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 |||||| |||||||| |||||||| |||| ||||| || || |||||||||||||||||| Sbjct: 165 ggaccacggcaattcgttggtctgctgcctctgttcgaccctccaaggcatgacagtgcc 224
>emb|X76536.1|STLDPHA1 S.tuberosum L. (Desiree) PHA1 mRNA Length = 3162 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 102 ggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||||||||||||||| |||| |||||||||| || || ||||||||||| Sbjct: 1461 ggaccatggcaattcattggtctcctgcctttgtttgatcctcctagacatgacagtgc 1519
>gb|S79323.1| plasma membrane H(+)-ATPase [Vicia faba, Otafuku, abaxial epidermis, guard cells protoplasts, mRNA, 3319 nt] Length = 3319 Score = 61.9 bits (31), Expect = 5e-07 Identities = 101/123 (82%), Gaps = 1/123 (0%) Strand = Plus / Plus Query: 38 gggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgc 97 ||||| ||||| |||| |||||| ||||||||||| ||||||||| | |||| | ||| Sbjct: 1520 gggctacgttcacttggtgttgctagacaggaagttcctgagaaaacaaagg-aaagtgc 1578 Query: 98 tggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacag 157 ||||| |||||||| || ||||| ||||| | |||||||||| || ||||||||||| Sbjct: 1579 tggtgctccatggcagtttgttggtttgttgtcggtgtttgatcctcctaggcatgacag 1638 Query: 158 tgc 160 ||| Sbjct: 1639 tgc 1641
>gb|AF275745.1|AF275745 Lycopersicon esculentum plasma membrane H+-ATPase (LHA2) mRNA, complete cds Length = 3244 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 102 ggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||||||||||||||| |||| |||||||||| ||||| || |||||||| Sbjct: 1528 ggaccatggcaattcattggtctcctgcctttgtttgatcctccaagacacgacagtgc 1586
>gb|AF179442.1|AF179442 Lycopersicon esculentum plasma membrane H+-ATPase isoform LHA2 (LHA2) gene, complete cds; and 18S ribosomal RNA gene, partial sequence Length = 10302 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 102 ggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||||||||||||||| |||| |||||||||| ||||| || |||||||| Sbjct: 5262 ggaccatggcaattcattggtctcctgcctttgtttgatcctccaagacacgacagtgc 5320
>gb|U38966.1|VFU38966 Vicia faba p-type H+-ATPase (VHA1) mRNA, partial cds Length = 928 Score = 61.9 bits (31), Expect = 5e-07 Identities = 101/123 (82%), Gaps = 1/123 (0%) Strand = Plus / Plus Query: 38 gggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgc 97 ||||| ||||| |||| |||||| ||||||||||| ||||||||| | |||| | ||| Sbjct: 364 gggctacgttcacttggtgttgctagacaggaagttcctgagaaaacaaagg-aaagtgc 422 Query: 98 tggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacag 157 ||||| |||||||| || ||||| ||||| | |||||||||| || ||||||||||| Sbjct: 423 tggtgctccatggcagtttgttggtttgttgtcggtgtttgatcctcctaggcatgacag 482 Query: 158 tgc 160 ||| Sbjct: 483 tgc 485
>gb|AY165041.1| Populus alba plasma membrane H+ ATPase (ATP1) mRNA, partial cds Length = 702 Score = 60.0 bits (30), Expect = 2e-06 Identities = 88/106 (83%), Gaps = 1/106 (0%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggcaat 114 |||||||| ||||||||||||||||||||| || | || |||| |||| ||||||||| Sbjct: 507 tgttgcaaaacaggaagtacctgagaaatcaaaag-atgctgcaggtgcaccatggcagc 565 Query: 115 tcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 | ||||| |||||||| |||| ||||| | | |||||||||||| Sbjct: 566 tagttggtttgttgcccttgttcgatccttccaagcatgacagtgc 611
>dbj|AB177650.1| Daucus carota DcPA 4 mRNA for plasma membrane H+-ATPase, complete cds Length = 3283 Score = 60.0 bits (30), Expect = 2e-06 Identities = 88/106 (83%), Gaps = 1/106 (0%) Strand = Plus / Plus Query: 53 gctgttgcaagacaggaagtacctgagaaatccaaggcattctgctggtggaccatggca 112 |||||||||||||||||||| ||| ||||||| || | || || |||||||||||||| Sbjct: 1512 gctgttgcaagacaggaagtgcctcagaaatcgaaag-atagtgaaggtggaccatggca 1570 Query: 113 attcattggtctgttgcccctgtttgatcccccaaggcatgacagt 158 || |||| ||||| | ||||||||||| || |||||||||||| Sbjct: 1571 gtttgttggattgttgtctctgtttgatcctcccaggcatgacagt 1616
>gb|M80489.1|TOBPMA1A Nicotiana plumbaginifolia plasma-membrane H+ ATPase (pma1) gene, complete cds Length = 7249 Score = 60.0 bits (30), Expect = 2e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||| || |||||||| ||||||||||| ||||| |||||||||| ||||| ||||| Sbjct: 3435 tgctggggggccatggcagttcattggtctcttgcctttgtttgatccaccaagacatga 3494 Query: 155 cagtgc 160 ||||| Sbjct: 3495 tagtgc 3500
>emb|X94936.1|PVBHA2 P.vulgaris mRNA for plasma membrane H+-ATPase Length = 683 Score = 58.0 bits (29), Expect = 8e-06 Identities = 56/65 (86%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 ||||||| |||||||| || ||||| || ||||| |||||||| || || |||||||||| Sbjct: 328 ctggtggcccatggcagtttattggccttttgcctctgtttgacccacctaggcatgaca 387 Query: 157 gtgcc 161 ||||| Sbjct: 388 gtgcc 392
>ref|NM_114131.2| Arabidopsis thaliana ATPase AT3G42640 mRNA, complete cds Length = 2995 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 |||||| | ||| ||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 1435 ccatgggagttcgttggtctgttgccactctttgaccccccaagacatgacagtgc 1490
>gb|AC140026.11| Medicago truncatula clone mth2-36j24, complete sequence Length = 162172 Score = 56.0 bits (28), Expect = 3e-05 Identities = 55/64 (85%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 |||||| |||||||||||| |||||||||| || || |||||||| || |||||||| | Sbjct: 141646 ctggtgcaccatggcaatttgttggtctgttacctctatttgatcctcctaggcatgata 141705 Query: 157 gtgc 160 |||| Sbjct: 141706 gtgc 141709
>gb|AY338226.1| Vicia faba clone pVLHI-R P-type H+-ATPase mRNA, partial cds Length = 734 Score = 56.0 bits (28), Expect = 3e-05 Identities = 55/64 (85%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 |||||| |||||||||||| |||||||||| || |||||||||| || |||||||| | Sbjct: 440 ctggtgcaccatggcaatttgttggtctgttaccgttgtttgatcctcctaggcatgata 499 Query: 157 gtgc 160 |||| Sbjct: 500 gtgc 503 Score = 48.1 bits (24), Expect = 0.008 Identities = 27/28 (96%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaa 82 |||||| ||||||||||||||||||||| Sbjct: 399 tgttgctagacaggaagtacctgagaaa 426
>emb|AL138640.1|ATT12K4 Arabidopsis thaliana DNA chromosome 3, BAC clone T12K4 Length = 108879 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 |||||| | ||| ||||||||||||| || ||||| |||||||| ||||||||||| Sbjct: 56189 ccatgggagttcgttggtctgttgccactctttgaccccccaagacatgacagtgc 56244
>emb|AJ132894.1|MTR132894 Medicago truncatula mRNA for H+-ATPase, partial Length = 803 Score = 56.0 bits (28), Expect = 3e-05 Identities = 55/64 (85%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 |||||| |||||||||||| |||||||||| || || |||||||| || |||||||| | Sbjct: 440 ctggtgcaccatggcaatttgttggtctgttacctctatttgatcctcctaggcatgata 499 Query: 157 gtgc 160 |||| Sbjct: 500 gtgc 503 Score = 40.1 bits (20), Expect = 2.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaa 82 |||||| ||||||||| ||||||||||| Sbjct: 399 tgttgctagacaggaaatacctgagaaa 426
>gb|AF029257.1|AF029257 Kosteletzkya virginica clone KVATP2 plasma membrane H+-ATPase mRNA, partial cds Length = 723 Score = 56.0 bits (28), Expect = 3e-05 Identities = 55/64 (85%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 ||||||| |||||||| ||||||||||| |||| || ||||||||||| |||| |||| Sbjct: 434 ctggtggtccatggcagttcattggtctcatgcctctctttgatccccctcggcacgaca 493 Query: 157 gtgc 160 |||| Sbjct: 494 gtgc 497
>dbj|AB033375.1| Nepenthes alata NaPHA5 mRNA for plasma membrane H+-ATPase, partial cds Length = 573 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 |||||||||||||||||||| |||| || ||||| || || |||||||||||||| Sbjct: 439 ccatggcaattcattggtctcatgcctctttttgacccacccaggcatgacagtgc 494
>dbj|AB033374.1| Nepenthes alata NaPHA4 mRNA for plasma membrane H+-ATPase, partial cds Length = 603 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||| |||||||| |||| || ||||| || ||||||||||||||||| Sbjct: 436 ccatggcaatttattggtctcatgcctctttttgaccctccaaggcatgacagtgc 491
>dbj|AB033372.1| Nepenthes alata NaPHA2 mRNA for plasma membrane H+-ATPase, partial cds Length = 571 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||| |||||||| |||| || ||||| || ||||||||||||||||| Sbjct: 463 ccatggcaatttattggtctcatgcctctttttgaccctccaaggcatgacagtgc 518
>dbj|AB033371.1| Nepenthes alata NaPHA1 mRNA for plasma membrane H+-ATPase, partial cds Length = 594 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 |||||||||||||||||||| |||| || ||||| || || |||||||||||||| Sbjct: 463 ccatggcaattcattggtctcatgcctctttttgacccacccaggcatgacagtgc 518
>gb|BT012790.1| Lycopersicon esculentum clone 113785F, mRNA sequence Length = 3358 Score = 54.0 bits (27), Expect = 1e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 126 ttgcccctgtttgatcccccaaggcatgacagtgc 160 |||||||| ||||||||||||||||| |||||||| Sbjct: 1689 ttgcccctttttgatcccccaaggcacgacagtgc 1723
>gb|AC155282.1| Medicago truncatula chromosome 2 BAC clone mth2-63e12, complete sequence Length = 251117 Score = 52.0 bits (26), Expect = 5e-04 Identities = 56/66 (84%) Strand = Plus / Minus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||| ||||||||||| ||||| ||||| | |||||||||| || |||||||| Sbjct: 231041 tgctggtgctccatggcaatttgttggtttgttgtcagtgtttgatcctcctaggcatga 230982 Query: 155 cagtgc 160 |||||| Sbjct: 230981 cagtgc 230976
>gb|AY383599.2| Nicotiana tabacum proton P-ATPase (nha1) mRNA, complete cds Length = 3347 Score = 52.0 bits (26), Expect = 5e-04 Identities = 32/34 (94%) Strand = Plus / Plus Query: 127 tgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| |||||||| ||||||||||||||||| Sbjct: 1658 tgcccctttttgatcctccaaggcatgacagtgc 1691
>gb|AF289025.1|AF289025 Cucumis sativus plasma membrane H+-ATPase mRNA, partial cds Length = 1359 Score = 52.0 bits (26), Expect = 5e-04 Identities = 32/34 (94%) Strand = Plus / Plus Query: 126 ttgcccctgtttgatcccccaaggcatgacagtg 159 ||||| ||||||||||| |||||||||||||||| Sbjct: 1270 ttgcctctgtttgatcctccaaggcatgacagtg 1303 Score = 44.1 bits (22), Expect = 0.13 Identities = 37/42 (88%) Strand = Plus / Plus Query: 41 cttcgttcgcttgctgttgcaagacaggaagtacctgagaaa 82 ||||| ||||| ||||||| ||||||||||| ||||||||| Sbjct: 1186 cttcgctcgctggctgttgggagacaggaagtgcctgagaaa 1227
>gb|AF029256.2|AF029256 Kosteletzkya virginica KVATP1 plasma membrane proton ATPase (ATP1) mRNA, complete cds Length = 3175 Score = 52.0 bits (26), Expect = 5e-04 Identities = 56/66 (84%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||||| || |||||||| ||||| ||||| | ||||| ||||| ||||||||||| Sbjct: 1453 tgctggtgctccctggcaatttgttggtttgttgtctctgttcgatcctccaaggcatga 1512 Query: 155 cagtgc 160 |||||| Sbjct: 1513 cagtgc 1518
>gb|U84891.1|MCU84891 Mesembryanthemum cryatallinum H+-transporting ATPase (PMA) mRNA, complete cds Length = 3426 Score = 52.0 bits (26), Expect = 5e-04 Identities = 29/30 (96%) Strand = Plus / Plus Query: 53 gctgttgcaagacaggaagtacctgagaaa 82 ||||||||||||||||||||||| |||||| Sbjct: 1619 gctgttgcaagacaggaagtaccagagaaa 1648
>ref|NM_119165.2| Arabidopsis thaliana AHA2; ATPase AT4G30190 (AHA2) mRNA, complete cds Length = 3301 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Plus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 1578 tgttgccactttttgatcccccaagacatgacagtgc 1614
>ref|NM_125118.2| Arabidopsis thaliana AHA3; ATPase AT5G57350 (AHA3) mRNA, complete cds Length = 3226 Score = 50.1 bits (25), Expect = 0.002 Identities = 49/57 (85%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 |||||| |||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| Sbjct: 1476 ccatgggaatttgttggtgtgttgcctctgtttgatcctccaagacatgatagtgcc 1532
>gb|J04737.1|ATHATP Arabidopsis thaliana ATPase gene, complete cds Length = 5646 Score = 50.1 bits (25), Expect = 0.002 Identities = 49/57 (85%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 |||||| |||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| Sbjct: 3238 ccatgggaatttgttggtgtgttgcctctgtttgatcctccaagacatgatagtgcc 3294
>gb|BT000781.1| Arabidopsis thaliana clone RAFL07-09-N06 (R10696) putative H+-transporting ATPase type 2 (At4g30190) mRNA, complete cds Length = 3309 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Plus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 1573 tgttgccactttttgatcccccaagacatgacagtgc 1609
>gb|AY072153.1| Arabidopsis thaliana putative plasma membrane proton pump ATPase 3 (At5g57350) mRNA, complete cds Length = 3185 Score = 50.1 bits (25), Expect = 0.002 Identities = 49/57 (85%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 |||||| |||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| Sbjct: 1466 ccatgggaatttgttggtgtgttgcctctgtttgatcctccaagacatgatagtgcc 1522
>gb|AY035075.1| Arabidopsis thaliana putative H+-transporting ATPase (AT4g30190) mRNA, complete cds Length = 3168 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Plus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 1573 tgttgccactttttgatcccccaagacatgacagtgc 1609
>emb|AL109796.1|ATF9N11 Arabidopsis thaliana DNA chromosome 4, BAC clone F9N11 Length = 87635 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 39617 tgttgccactttttgatcccccaagacatgacagtgc 39581
>emb|AL161576.2|ATCHRIV72 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 72 Length = 198924 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 112638 tgttgccactttttgatcccccaagacatgacagtgc 112602
>emb|AJ132892.1|MTR132892 Medicago truncatula mRNA for H+-ATPase Length = 3222 Score = 50.1 bits (25), Expect = 0.002 Identities = 40/45 (88%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgag 79 ||||| |||||||| |||| ||||| |||||||||||||||||| Sbjct: 1513 cgtggacttcgttctcttggggttgctagacaggaagtacctgag 1557
>gb|AY056780.1| Arabidopsis thaliana AT5g57350/MJB24_16 mRNA, complete cds Length = 3159 Score = 50.1 bits (25), Expect = 0.002 Identities = 49/57 (85%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 |||||| |||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| Sbjct: 1476 ccatgggaatttgttggtgtgttgcctctgtttgatcctccaagacatgatagtgcc 1532
>dbj|AB019233.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB24 Length = 58589 Score = 50.1 bits (25), Expect = 0.002 Identities = 49/57 (85%) Strand = Plus / Minus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgcc 161 |||||| |||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| Sbjct: 57395 ccatgggaatttgttggtgtgttgcctctgtttgatcctccaagacatgatagtgcc 57339
>gb|BT001969.1| Arabidopsis thaliana clone U09110 putative H+-transporting ATPase (At4g30190) mRNA, complete cds Length = 2878 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Plus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 1445 tgttgccactttttgatcccccaagacatgacagtgc 1481
>gb|M80490.1|TOBPMA3A Nicotiana plumbaginifolia plasma-membrane H+ ATPase (pma3) mRNA, complete cds Length = 3224 Score = 50.1 bits (25), Expect = 0.002 Identities = 55/65 (84%) Strand = Plus / Plus Query: 96 gctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgac 155 ||||| ||||||||||| ||||||| ||| || || |||||||||| || ||||| ||| Sbjct: 1494 gctgggggaccatggcagttcattgctctcttacctttgtttgatccacctaggcacgac 1553 Query: 156 agtgc 160 ||||| Sbjct: 1554 agtgc 1558
>gb|J05570.1|ATHATPASEP A.thaliana plasma membrane H+-ATPase gene, complete cds Length = 6807 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Plus Query: 124 tgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || |||||||||||||| ||||||||||| Sbjct: 4110 tgttgccactttttgatcccccaagacatgacagtgc 4146
>emb|AJ286745.1|SRO286745 Sesbania rostrata partial mRNA for p-type H+-ATPase (ha1 gene) Length = 736 Score = 48.1 bits (24), Expect = 0.008 Identities = 27/28 (96%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaa 82 |||||| ||||||||||||||||||||| Sbjct: 361 tgttgctagacaggaagtacctgagaaa 388
>emb|AJ271438.1|PPE271438 Prunus persica mRNA for plasma membrane H+ ATPase (PPA2 gene) Length = 3371 Score = 48.1 bits (24), Expect = 0.008 Identities = 42/48 (87%) Strand = Plus / Plus Query: 35 cgtgggcttcgttcgcttgctgttgcaagacaggaagtacctgagaaa 82 ||||| |||||||| || || |||||||||||| ||||||| |||||| Sbjct: 1499 cgtggacttcgttctctagccgttgcaagacagcaagtaccagagaaa 1546 Score = 42.1 bits (21), Expect = 0.50 Identities = 48/57 (84%) Strand = Plus / Plus Query: 104 accatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||| || ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 1567 accatggcagtttgttggtttgttgcctttatttgatcctcccaggcatgacagtgc 1623
>dbj|AB086372.1| Sesbania rostrata srha1 mRNA for plasma membrane H+-ATPase, complete cds Length = 3371 Score = 48.1 bits (24), Expect = 0.008 Identities = 27/28 (96%) Strand = Plus / Plus Query: 55 tgttgcaagacaggaagtacctgagaaa 82 |||||| ||||||||||||||||||||| Sbjct: 1536 tgttgctagacaggaagtacctgagaaa 1563
>gb|U38965.1|VFU38965 Vicia faba p-type H+-ATPase (VHA2) mRNA, partial cds Length = 1119 Score = 48.1 bits (24), Expect = 0.008 Identities = 97/120 (80%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 41 cttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgctgg 100 |||||||| ||||||||| | |||||||| || ||||||||| | || | | |||||| Sbjct: 364 cttcgttctcttgctgtttctagacaggaggttcctgagaaaactaaagaaag-tgctgg 422 Query: 101 tggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||| || ||||| || ||||| ||||| | |||||||| || || |||||||||||||| Sbjct: 423 tggtccttggcagtttgttggtttgttgtcactgtttgacccacctaggcatgacagtgc 482
>gb|M27888.1|TOBATPASA N.plumbaginifolia H+-translocating ATPase mRNA Length = 3178 Score = 48.1 bits (24), Expect = 0.008 Identities = 54/64 (84%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 |||| ||||| ||||| |||||||||||| | || |||||||||| ||||| || |||| Sbjct: 1476 ctggaggaccgtggcagttcattggtctgcttcctttgtttgatccaccaagacacgaca 1535 Query: 157 gtgc 160 |||| Sbjct: 1536 gtgc 1539
>dbj|AB022442.1| Vicia faba VHA2 mRNA for p-type H+-ATPase, complete cds Length = 3398 Score = 48.1 bits (24), Expect = 0.008 Identities = 97/120 (80%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 41 cttcgttcgcttgctgttgcaagacaggaagtacctgagaaatccaaggcattctgctgg 100 |||||||| ||||||||| | |||||||| || ||||||||| | || | | |||||| Sbjct: 1489 cttcgttctcttgctgtttctagacaggaggttcctgagaaaactaaagaaag-tgctgg 1547 Query: 101 tggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||| || ||||| || ||||| ||||| | |||||||| || || |||||||||||||| Sbjct: 1548 tggtccttggcagtttgttggtttgttgtcactgtttgacccacctaggcatgacagtgc 1607
>gb|AC125477.13| Medicago truncatula clone mth2-12j8, complete sequence Length = 127843 Score = 46.1 bits (23), Expect = 0.032 Identities = 29/31 (93%) Strand = Plus / Plus Query: 38 gggcttcgttcgcttgctgttgcaagacagg 68 ||||||||||| ||||||||||| ||||||| Sbjct: 40580 gggcttcgttctcttgctgttgctagacagg 40610 Score = 38.2 bits (19), Expect = 7.8 Identities = 37/43 (86%) Strand = Plus / Plus Query: 118 ttggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||| ||||| | |||||||| || || |||||||||||||| Sbjct: 40762 ttggtttgttgtcactgtttgacccacctaggcatgacagtgc 40804
>gb|AC125475.11| Medicago truncatula clone mth2-5j2, complete sequence Length = 165679 Score = 46.1 bits (23), Expect = 0.032 Identities = 29/31 (93%) Strand = Plus / Minus Query: 38 gggcttcgttcgcttgctgttgcaagacagg 68 ||||||||||| ||||||||||| ||||||| Sbjct: 47368 gggcttcgttctcttgctgttgctagacagg 47338 Score = 38.2 bits (19), Expect = 7.8 Identities = 37/43 (86%) Strand = Plus / Minus Query: 118 ttggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||| ||||| | |||||||| || || |||||||||||||| Sbjct: 47190 ttggtttgttgtcactgtttgacccacctaggcatgacagtgc 47148
>gb|DQ103595.1| Arabidopsis arenosa clone BAC 28N14, complete sequence Length = 132056 Score = 46.1 bits (23), Expect = 0.032 Identities = 38/43 (88%) Strand = Plus / Plus Query: 118 ttggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||||| || ||||| || ||||| ||||||||||| Sbjct: 72148 ttggtctgttgccactctttgacccgccaagacatgacagtgc 72190
>gb|AY989894.1| Lupinus albus plasma membrane H+ ATPase (LHA3) mRNA, complete cds Length = 3332 Score = 46.1 bits (23), Expect = 0.032 Identities = 53/63 (84%) Strand = Plus / Plus Query: 98 tggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacag 157 ||||| |||||||||||| |||||||| | || ||||||||||| || || ||||| || Sbjct: 1616 tggtgcaccatggcaatttgttggtctgctaccactgtttgatcctcctagacatgatag 1675 Query: 158 tgc 160 ||| Sbjct: 1676 tgc 1678
>gb|AY029190.1| Lilium longiflorum plasma membrane H+ ATPase mRNA, complete cds Length = 3167 Score = 46.1 bits (23), Expect = 0.032 Identities = 26/27 (96%) Strand = Plus / Plus Query: 135 tttgatcccccaaggcatgacagtgcc 161 ||||||||||||||||| ||||||||| Sbjct: 1552 tttgatcccccaaggcacgacagtgcc 1578
>gb|AF263917.1|AF263917 Lycopersicon esculentum plasma membrane proton ATPase (LHA8) mRNA, partial cds Length = 963 Score = 46.1 bits (23), Expect = 0.032 Identities = 38/43 (88%) Strand = Plus / Plus Query: 118 ttggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| || ||||| |||||||| ||||||||||| ||||| Sbjct: 461 ttggtctcttacccctctttgatcctccaaggcatgatagtgc 503
>gb|AY772467.1|AY772463S5 Nicotiana plumbaginifolia plasma membrane proton ATPase 5 (PMA5) gene, exons 10 through 13 Length = 1988 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 135 tttgatcccccaaggcatgacagtgc 160 |||||||| ||||||||||||||||| Sbjct: 371 tttgatccaccaaggcatgacagtgc 396
>gb|AY772462.1| Nicotiana plumbaginifolia plasma membrane proton ATPase 5 (PMA5) mRNA, complete cds Length = 2778 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 135 tttgatcccccaaggcatgacagtgc 160 |||||||| ||||||||||||||||| Sbjct: 1465 tttgatccaccaaggcatgacagtgc 1490
>dbj|AB177652.1| Daucus carota DcPA 6 mRNA for plasma membrane H+-ATPase, complete cds Length = 3384 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 135 tttgatcccccaaggcatgacagtgc 160 |||||||| ||||||||||||||||| Sbjct: 1744 tttgatccgccaaggcatgacagtgc 1769
>dbj|AB177651.1| Daucus carota DcPA 5 mRNA for plasma membrane H+-ATPase, complete cds Length = 3195 Score = 44.1 bits (22), Expect = 0.13 Identities = 55/66 (83%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 ||||||||| ||||||||||| |||| || | |||| |||||||| |||||||| || Sbjct: 1580 tgctggtggtccatggcaatttgttggattgctatccctctttgatcctccaaggcacga 1639 Query: 155 cagtgc 160 |||||| Sbjct: 1640 cagtgc 1645
>ref|NM_128013.1| Arabidopsis thaliana ATPase AT2G24520 mRNA, complete cds Length = 2939 Score = 42.1 bits (21), Expect = 0.50 Identities = 54/65 (83%) Strand = Plus / Plus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 ||||||| ||||||||| | | ||||| || || || |||||||| || |||||||||| Sbjct: 1454 ctggtggcccatggcaacttgtaggtcttttacctctttttgatcctccgaggcatgaca 1513 Query: 157 gtgcc 161 ||||| Sbjct: 1514 gtgcc 1518 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 gctgttgcaagacaggaagt 72 |||||||||||||||||||| Sbjct: 1411 gctgttgcaagacaggaagt 1430
>ref|NM_106714.1| Arabidopsis thaliana AHA9; hydrogen-exporting ATPase, phosphorylative mechanism AT1G80660 (AHA9) mRNA, complete cds Length = 2865 Score = 42.1 bits (21), Expect = 0.50 Identities = 48/57 (84%) Strand = Plus / Plus Query: 104 accatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||| || |||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 1440 accatggcagtttcttggtctgttacctctctttgaccctccaagacatgacagtgc 1496
>emb|AJ286746.1|SRO286746 Sesbania rostrata partial mRNA for p-type H+-ATPase (ha2 gene) Length = 736 Score = 42.1 bits (21), Expect = 0.50 Identities = 54/65 (83%) Strand = Plus / Plus Query: 96 gctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgac 155 ||||| || |||||||| || ||||| || |||| |||||||| || || ||||||||| Sbjct: 401 gctggaggcccatggcagtttattggccttatgcctctgtttgacccacctaggcatgac 460 Query: 156 agtgc 160 ||||| Sbjct: 461 agtgc 465
>gb|AC006954.8| Arabidopsis thaliana chromosome 2 clone F25P17 map mi238, complete sequence Length = 93701 Score = 42.1 bits (21), Expect = 0.50 Identities = 54/65 (83%) Strand = Plus / Minus Query: 97 ctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgaca 156 ||||||| ||||||||| | | ||||| || || || |||||||| || |||||||||| Sbjct: 88272 ctggtggcccatggcaacttgtaggtcttttacctctttttgatcctccgaggcatgaca 88213 Query: 157 gtgcc 161 ||||| Sbjct: 88212 gtgcc 88208
>gb|AC018849.2|AC018849 Arabidopsis thaliana chromosome 1 BAC T21F11 genomic sequence, complete sequence Length = 89811 Score = 42.1 bits (21), Expect = 0.50 Identities = 48/57 (84%) Strand = Plus / Plus Query: 104 accatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||| || |||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 584 accatggcagtttcttggtctgttacctctctttgaccctccaagacatgacagtgc 640
>dbj|AB177648.1| Daucus carota DcPA 2 mRNA for plasma membrane H+-ATPase, complete cds Length = 3382 Score = 42.1 bits (21), Expect = 0.50 Identities = 27/29 (93%) Strand = Plus / Plus Query: 132 ctgtttgatcccccaaggcatgacagtgc 160 ||||||||||| || |||||||||||||| Sbjct: 1606 ctgtttgatcctcccaggcatgacagtgc 1634
>emb|X73676.1|ATAHA9 A.thaliana aha9 gene Length = 6110 Score = 42.1 bits (21), Expect = 0.50 Identities = 48/57 (84%) Strand = Plus / Plus Query: 104 accatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||| || |||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 4081 accatggcagtttcttggtctgttacctctctttgaccctccaagacatgacagtgc 4137
>gb|AC011713.2|F23A5 Arabidopsis thaliana chromosome 1 BAC F23A5 sequence, complete sequence Length = 109694 Score = 42.1 bits (21), Expect = 0.50 Identities = 48/57 (84%) Strand = Plus / Minus Query: 104 accatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||| || |||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 2029 accatggcagtttcttggtctgttacctctctttgaccctccaagacatgacagtgc 1973
>gb|U53501.1|ATU53501 Arabidopsis thaliana chromosome I cosmid g8261 DNA (cytosine-5-) methyltransferase, zinc finger protein 1, nucleoporin 98, poly A+ RNA export protein, plasma membrane ATPase 2, and serine/threonine protein kinase genes, complete cds Length = 37570 Score = 42.1 bits (21), Expect = 0.50 Identities = 48/57 (84%) Strand = Plus / Plus Query: 104 accatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||| || |||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 29230 accatggcagtttcttggtctgttacctctctttgaccctccaagacatgacagtgc 29286
>gb|AC147480.13| Mus musculus chromosome 14, clone RP23-429N24, complete sequence Length = 210000 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 gtttgatcccccaaggcatg 153 |||||||||||||||||||| Sbjct: 70358 gtttgatcccccaaggcatg 70339
>gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosome 14, complete sequence Length = 215802 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 gtttgatcccccaaggcatg 153 |||||||||||||||||||| Sbjct: 15197 gtttgatcccccaaggcatg 15216
>gb|AC079871.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-128P4, complete sequence Length = 125209 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 gtttgatcccccaaggcatg 153 |||||||||||||||||||| Sbjct: 22894 gtttgatcccccaaggcatg 22913
>gb|CP000119.1| Anabaena variabilis ATCC 29413 plasmid A, complete sequence Length = 366354 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 tgttgcaagacaggaagtac 74 |||||||||||||||||||| Sbjct: 335362 tgttgcaagacaggaagtac 335343
>gb|AC165092.3| Mus musculus BAC clone RP23-10M2 from chromosome 14, complete sequence Length = 215949 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 gtttgatcccccaaggcatg 153 |||||||||||||||||||| Sbjct: 83788 gtttgatcccccaaggcatg 83769
>emb|AJ132893.1|MTR132983 Medicago truncatula mRNA for H+-ATPase, partial Length = 798 Score = 40.1 bits (20), Expect = 2.0 Identities = 47/56 (83%) Strand = Plus / Plus Query: 105 ccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||||||| ||||| || |||| || |||||||| ||||| ||||| ||||| Sbjct: 448 ccatggcaatttattggacttatgcctctctttgatccaccaagacatgatagtgc 503
>ref|NM_126721.2| Arabidopsis thaliana ATPase AT2G07560 mRNA, complete cds Length = 3332 Score = 38.2 bits (19), Expect = 7.8 Identities = 37/43 (86%) Strand = Plus / Plus Query: 118 ttggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| ||||| || ||||| || ||||| ||||||||||| Sbjct: 1508 ttggtcttttgccactctttgaccctccaagacatgacagtgc 1550
>ref|NM_125662.2| Arabidopsis thaliana ATPase AT5G62670 mRNA, complete cds Length = 4410 Score = 38.2 bits (19), Expect = 7.8 Identities = 55/67 (82%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||| || || |||||||| || ||||| |||| || ||||| || || |||||||| Sbjct: 1576 tgctggaggcccttggcaatttatgggtctcatgcctctttttgacccacctaggcatga 1635 Query: 155 cagtgcc 161 ||||||| Sbjct: 1636 cagtgcc 1642
>ref|NM_127453.2| Arabidopsis thaliana AHA1 (PLASMA MEMBRANE PROTON ATPASE); ATPase AT2G18960 (AHA1) mRNA, complete cds Length = 3428 Score = 38.2 bits (19), Expect = 7.8 Identities = 52/63 (82%) Strand = Plus / Plus Query: 99 ggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagt 158 |||||||||||| |||| |||| ||||||| || ||||| || ||||| || |||||| Sbjct: 1647 ggtggaccatgggaatttgttggcttgttgcctctttttgaccctccaagacacgacagt 1706 Query: 159 gcc 161 ||| Sbjct: 1707 gcc 1709
>gb|CP000097.1| Synechococcus sp. CC9902, complete genome Length = 2234828 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 gcttgctgttgcaagacag 67 ||||||||||||||||||| Sbjct: 2003219 gcttgctgttgcaagacag 2003201
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 75 ctgagaaatccaaggcatt 93 ||||||||||||||||||| Sbjct: 5837256 ctgagaaatccaaggcatt 5837274
>gb|BT010748.1| Arabidopsis thaliana At5g62670/MRG21_9 gene, complete cds Length = 2871 Score = 38.2 bits (19), Expect = 7.8 Identities = 55/67 (82%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||| || || |||||||| || ||||| |||| || ||||| || || |||||||| Sbjct: 1428 tgctggaggcccttggcaatttatgggtctcatgcctctttttgacccacctaggcatga 1487 Query: 155 cagtgcc 161 ||||||| Sbjct: 1488 cagtgcc 1494
>gb|AC004885.2| Homo sapiens PAC clone RP4-781A18 from 7, complete sequence Length = 190842 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgctgttgcaagacaggaa 70 ||||||||||||||||||| Sbjct: 150103 tgctgttgcaagacaggaa 150085
>gb|AC146619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAa0021B21, from chromosome 3, complete sequence Length = 139208 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 75 ctgagaaatccaaggcatt 93 ||||||||||||||||||| Sbjct: 66086 ctgagaaatccaaggcatt 66104
>emb|Z95114.19|HS212A2 Human DNA sequence from clone CTA-212A2 on chromosome 22q12, complete sequence Length = 212753 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 65 caggaagtacctgagaaatccaa 87 ||||||| ||||||||||||||| Sbjct: 207893 caggaaggacctgagaaatccaa 207871
>emb|AL078584.17|HSJ245M18 Human DNA sequence from clone RP1-245M18 on chromosome 6p21.32-22.3 Contains the 5' end of the gene for chromosome 6 open reading frame 32 (PL48, DIFF40, DIFF48, KIAA0386), a cytochrome c oxidase polypeptide II pseudogene and a CpG island, complete sequence Length = 104770 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 gtacctgagaaatccaagg 89 ||||||||||||||||||| Sbjct: 5538 gtacctgagaaatccaagg 5520
>gb|BT008692.1| Arabidopsis thaliana clone RAFL09-75-I01 (R19670) putative plasma membrane proton ATPase (PMA) (At2g18960) mRNA, complete cds Length = 3186 Score = 38.2 bits (19), Expect = 7.8 Identities = 52/63 (82%) Strand = Plus / Plus Query: 99 ggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagt 158 |||||||||||| |||| |||| ||||||| || ||||| || ||||| || |||||| Sbjct: 1519 ggtggaccatgggaatttgttggcttgttgcctctttttgaccctccaagacacgacagt 1578 Query: 159 gcc 161 ||| Sbjct: 1579 gcc 1581
>emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 in linkage group 19, complete sequence Length = 195006 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 104 accatggcaattcattggt 122 ||||||||||||||||||| Sbjct: 123281 accatggcaattcattggt 123299
>gb|AY125493.1| Arabidopsis thaliana AT5g62670/MRG21_9 mRNA, complete cds Length = 3264 Score = 38.2 bits (19), Expect = 7.8 Identities = 55/67 (82%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||| || || |||||||| || ||||| |||| || ||||| || || |||||||| Sbjct: 1574 tgctggaggcccttggcaatttatgggtctcatgcctctttttgacccacctaggcatga 1633 Query: 155 cagtgcc 161 ||||||| Sbjct: 1634 cagtgcc 1640
>emb|CR394543.4| Zebrafish DNA sequence from clone DKEY-26A2 in linkage group 4, complete sequence Length = 42405 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 104 accatggcaattcattggt 122 ||||||||||||||||||| Sbjct: 41051 accatggcaattcattggt 41069
>ref|NM_165441.1| Drosophila melanogaster scarface CG11066-RA, transcript variant A (scarface), mRNA Length = 3391 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 cgtgggcttcgttcgcttg 53 ||||||||||||||||||| Sbjct: 1721 cgtgggcttcgttcgcttg 1703
>gb|AC007662.3| Arabidopsis thaliana chromosome 2 BAC F9A16 genomic sequence, complete sequence Length = 102249 Score = 38.2 bits (19), Expect = 7.8 Identities = 37/43 (86%) Strand = Plus / Plus Query: 118 ttggtctgttgcccctgtttgatcccccaaggcatgacagtgc 160 ||||||| ||||| || ||||| || ||||| ||||||||||| Sbjct: 42089 ttggtcttttgccactctttgaccctccaagacatgacagtgc 42131
>ref|NM_136336.2| Drosophila melanogaster scarface CG11066-RB, transcript variant B (scarface), mRNA Length = 3016 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 cgtgggcttcgttcgcttg 53 ||||||||||||||||||| Sbjct: 1346 cgtgggcttcgttcgcttg 1328
>gb|AC003673.3| Arabidopsis thaliana chromosome 2 clone F19F24 map CIC06E08, complete sequence Length = 99359 Score = 38.2 bits (19), Expect = 7.8 Identities = 52/63 (82%) Strand = Plus / Plus Query: 99 ggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagt 158 |||||||||||| |||| |||| ||||||| || ||||| || ||||| || |||||| Sbjct: 76726 ggtggaccatgggaatttgttggcttgttgcctctttttgaccctccaagacacgacagt 76785 Query: 159 gcc 161 ||| Sbjct: 76786 gcc 76788
>gb|AY047548.1| Drosophila melanogaster GH05918 full length cDNA Length = 3034 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 cgtgggcttcgttcgcttg 53 ||||||||||||||||||| Sbjct: 1346 cgtgggcttcgttcgcttg 1328
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 75 ctgagaaatccaaggcatt 93 ||||||||||||||||||| Sbjct: 5836469 ctgagaaatccaaggcatt 5836487
>emb|BX820549.1|CNS0A7YO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZE08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 3173 Score = 38.2 bits (19), Expect = 7.8 Identities = 52/63 (82%) Strand = Plus / Plus Query: 99 ggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagt 158 |||||||||||| |||| |||| ||||||| || ||||| || ||||| || |||||| Sbjct: 1515 ggtggaccatgggaatttgttggcttgttgcctctttttgaccctccaagacacgacagt 1574 Query: 159 gcc 161 ||| Sbjct: 1575 gcc 1577
>dbj|AB020751.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRG21 Length = 55151 Score = 38.2 bits (19), Expect = 7.8 Identities = 55/67 (82%) Strand = Plus / Plus Query: 95 tgctggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatga 154 |||||| || || |||||||| || ||||| |||| || ||||| || || |||||||| Sbjct: 32014 tgctggaggcccttggcaatttatgggtctcatgcctctttttgacccacctaggcatga 32073 Query: 155 cagtgcc 161 ||||||| Sbjct: 32074 cagtgcc 32080
>dbj|AK064500.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-111-D04, full insert sequence Length = 1339 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 75 ctgagaaatccaaggcatt 93 ||||||||||||||||||| Sbjct: 1123 ctgagaaatccaaggcatt 1141
>emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in linkage group 18, complete sequence Length = 105612 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 104 accatggcaattcattggt 122 ||||||||||||||||||| Sbjct: 646 accatggcaattcattggt 664
>gb|M24107.1|ATHHATPA A.thaliana plasma membrane proton ATPase (PMA) mRNA, complete cds Length = 3226 Score = 38.2 bits (19), Expect = 7.8 Identities = 52/63 (82%) Strand = Plus / Plus Query: 99 ggtggaccatggcaattcattggtctgttgcccctgtttgatcccccaaggcatgacagt 158 |||||||||||| |||| |||| ||||||| || ||||| || ||||| || |||||| Sbjct: 1512 ggtggaccatgggaatttgttggcttgttgcctctttttgaccctccaagacacgacagt 1571 Query: 159 gcc 161 ||| Sbjct: 1572 gcc 1574 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,053,273 Number of Sequences: 3902068 Number of extensions: 1053273 Number of successful extensions: 74367 Number of sequences better than 10.0: 129 Number of HSP's better than 10.0 without gapping: 128 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 74068 Number of HSP's gapped (non-prelim): 276 length of query: 161 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 139 effective length of database: 17,147,199,772 effective search space: 2383460768308 effective search space used: 2383460768308 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)