ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal40a09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR361553.4| Mouse DNA sequence from clone RP24-456I14 on chr... 40 1.4
2emb|AL772378.8| Mouse DNA sequence from clone RP23-106C4 on chro... 40 1.4
3emb|AJ421480.1| Mus musculus X-inactivation center region; segme... 40 1.4
4gb|AC008221.5| Drosophila melanogaster clone BACR30B13, complete... 38 5.7
5gb|BT012769.1| Lycopersicon esculentum clone 113739R, mRNA sequence 38 5.7
6gb|AC145805.2| Xenopus tropicalis clone CH216-85O8, complete seq... 38 5.7
7gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, co... 38 5.7
8gb|AC073372.9| Homo sapiens chromosome 11 clone RP11-500D4, comp... 38 5.7
9gb|AC093284.3| Homo sapiens chromosome 5 clone RP11-436A5, compl... 38 5.7
10emb|BX284619.11| Zebrafish DNA sequence from clone DKEY-251E24 i... 38 5.7
11gb|AC137794.2| Homo sapiens chromosome 5 clone RP11-434D11, comp... 38 5.7
12emb|CT485790.1| Leptosphaeria maculans : genomic region surround... 38 5.7
13emb|CT485650.1| Leptosphaeria maculans : genomic region surround... 38 5.7
14gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 11... 38 5.7
15dbj|AP002759.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 5.7
16emb|BX005212.7| Zebrafish DNA sequence from clone DKEY-221H2 in ... 38 5.7
17emb|CR456628.8| Zebrafish DNA sequence from clone CH211-157H7 in... 38 5.7

>emb|CR361553.4| Mouse DNA sequence from clone RP24-456I14 on chromosome X, complete
             sequence
          Length = 52670

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    gctactattacaatctagta 55
             ||||||||||||||||||||
Sbjct: 37919 gctactattacaatctagta 37900



to top

>emb|AL772378.8| Mouse DNA sequence from clone RP23-106C4 on chromosome X, complete
             sequence
          Length = 109193

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    atggaggtgtatatttgttc 80
             ||||||||||||||||||||
Sbjct: 60134 atggaggtgtatatttgttc 60115



to top

>emb|AJ421480.1| Mus musculus X-inactivation center region; segment 3/3
          Length = 214384

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    atggaggtgtatatttgttc 80
             ||||||||||||||||||||
Sbjct: 89448 atggaggtgtatatttgttc 89467



to top

>gb|AC008221.5| Drosophila melanogaster clone BACR30B13, complete sequence
          Length = 184278

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 92    tgaattggatggtacacat 110
             |||||||||||||||||||
Sbjct: 82537 tgaattggatggtacacat 82519



to top

>gb|BT012769.1| Lycopersicon esculentum clone 113739R, mRNA sequence
          Length = 600

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 24  acatgagtagctgctacta 42
           |||||||||||||||||||
Sbjct: 103 acatgagtagctgctacta 121



to top

>gb|AC145805.2| Xenopus tropicalis clone CH216-85O8, complete sequence
          Length = 166207

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    agtattcacgatgaattgg 99
             |||||||||||||||||||
Sbjct: 38668 agtattcacgatgaattgg 38686



to top

>gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, complete sequence
          Length = 198781

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 43     ttacaatctagtaagtaaa 61
              |||||||||||||||||||
Sbjct: 128092 ttacaatctagtaagtaaa 128110



to top

>gb|AC073372.9| Homo sapiens chromosome 11 clone RP11-500D4, complete sequence
          Length = 180504

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    acaatctagtaagtaaatg 63
             |||||||||||||||||||
Sbjct: 82192 acaatctagtaagtaaatg 82210



to top

>gb|AC093284.3| Homo sapiens chromosome 5 clone RP11-436A5, complete sequence
          Length = 91874

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    aagtaaatggaggtgtata 73
             |||||||||||||||||||
Sbjct: 74870 aagtaaatggaggtgtata 74852



to top

>emb|BX284619.11| Zebrafish DNA sequence from clone DKEY-251E24 in linkage group 1,
              complete sequence
          Length = 196931

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     tgtatatttgttcagtatt 86
              |||||||||||||||||||
Sbjct: 123703 tgtatatttgttcagtatt 123721



to top

>gb|AC137794.2| Homo sapiens chromosome 5 clone RP11-434D11, complete sequence
          Length = 186972

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    aagtaaatggaggtgtata 73
             |||||||||||||||||||
Sbjct: 97463 aagtaaatggaggtgtata 97445



to top

>emb|CT485790.1| Leptosphaeria maculans : genomic region surrounding the avirulence
            gene AvrLm1 (AM084345)
          Length = 32279

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 41   tattacaatctagtaagta 59
            |||||||||||||||||||
Sbjct: 1527 tattacaatctagtaagta 1509



to top

>emb|CT485650.1| Leptosphaeria maculans : genomic region surrounding the avirulence gene
             AvrLm1 (AM084345)
          Length = 83129

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 41    tattacaatctagtaagta 59
             |||||||||||||||||||
Sbjct: 16586 tattacaatctagtaagta 16604



to top

>gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 115 of 118 of the complete
              sequence
          Length = 232290

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 92     tgaattggatggtacacat 110
              |||||||||||||||||||
Sbjct: 112762 tgaattggatggtacacat 112744



to top

>dbj|AP002759.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-686G23, complete
             sequences
          Length = 177933

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    acaatctagtaagtaaatg 63
             |||||||||||||||||||
Sbjct: 35102 acaatctagtaagtaaatg 35084



to top

>emb|BX005212.7| Zebrafish DNA sequence from clone DKEY-221H2 in linkage group 1, complete
              sequence
          Length = 272535

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     tgtatatttgttcagtatt 86
              |||||||||||||||||||
Sbjct: 141402 tgtatatttgttcagtatt 141420



to top

>emb|CR456628.8| Zebrafish DNA sequence from clone CH211-157H7 in linkage group 1,
              complete sequence
          Length = 168101

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 69     gtatatttgttcagtattc 87
              |||||||||||||||||||
Sbjct: 157784 gtatatttgttcagtattc 157766


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 689,985
Number of Sequences: 3902068
Number of extensions: 689985
Number of successful extensions: 46522
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46479
Number of HSP's gapped (non-prelim): 43
length of query: 123
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 102
effective length of database: 17,151,101,840
effective search space: 1749412387680
effective search space used: 1749412387680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top