ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal38d03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC006963.4|AC006963 Homo sapiens PAC clone RP1-278D1 from X, ... 44 0.17
2gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome... 42 0.67
3emb|AL356377.12| Human DNA sequence from clone RP11-147M1 on chr... 42 0.67
4emb|AL049861.18|HSBK21C21 Human DNA sequence from clone CTA-21C2... 42 0.67
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 2.6
6gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosom... 40 2.6
7gb|AC146195.3| Pan troglodytes BAC clone RP43-25F5 from 7, compl... 40 2.6
8emb|Z69380.1|SPAC4H3 S.pombe chromosome I cosmid c4H3 40 2.6
9gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosom... 40 2.6
10gb|AC008925.4| Homo sapiens chromosome 5 clone CTD-2284O10, comp... 40 2.6
11ref|NM_001019759.1| Schizosaccharomyces pombe 972h- hypothetical... 40 2.6
12gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, r... 40 2.6
13gb|AC084404.8|AC084404 Oryza sativa chromosome 3 BAC OSJNBa0026A... 40 2.6
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.6
15gb|AE003827.3| Drosophila melanogaster chromosome 2R, section 23... 40 2.6
16gb|AC150035.3| Mus musculus BAC clone RP23-348A6 from 16, comple... 40 2.6
17gb|AY856073.1| Oncopeltus fasciatus Deformed (Dfd) mRNA, partial... 40 2.6

>gb|AC006963.4|AC006963 Homo sapiens PAC clone RP1-278D1 from X, complete sequence
          Length = 88215

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 79    aggatttgatttttcttgggaa 100
             ||||||||||||||||||||||
Sbjct: 64690 aggatttgatttttcttgggaa 64711



to top

>gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome 5, complete sequence
          Length = 233082

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 138    atgtttaaaaggttgtcttctttga 162
              ||||||||| |||||||||||||||
Sbjct: 122230 atgtttaaatggttgtcttctttga 122254



to top

>emb|AL356377.12| Human DNA sequence from clone RP11-147M1 on chromosome 1, complete
             sequence
          Length = 80552

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 26    ttgaggattcacatatgattt 46
             |||||||||||||||||||||
Sbjct: 33179 ttgaggattcacatatgattt 33159



to top

>emb|AL049861.18|HSBK21C21 Human DNA sequence from clone CTA-21C21 on chromosome 1p22.2-31.1
              Contains STSs and GSSs, complete sequence
          Length = 143163

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 170    tgattgagtttcagttcatta 190
              |||||||||||||||||||||
Sbjct: 122554 tgattgagtttcagttcatta 122574



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 168      gttgattgagtttcagttca 187
                ||||||||||||||||||||
Sbjct: 20331708 gttgattgagtttcagttca 20331727



to top

>gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosome 16, complete
             sequence
          Length = 147166

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   gttcattatatcaaacagca 202
             ||||||||||||||||||||
Sbjct: 75817 gttcattatatcaaacagca 75836



to top

>gb|AC146195.3| Pan troglodytes BAC clone RP43-25F5 from 7, complete sequence
          Length = 170968

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    aggattcacatatgatttat 48
             ||||||||||||||||||||
Sbjct: 37884 aggattcacatatgatttat 37903



to top

>emb|Z69380.1|SPAC4H3 S.pombe chromosome I cosmid c4H3
          Length = 34635

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 26   ttgaggattcacatatgatttatt 49
            ||||||||||||||||||| ||||
Sbjct: 3319 ttgaggattcacatatgatatatt 3342



to top

>gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosome 16, complete
             sequence
          Length = 218059

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   gttcattatatcaaacagca 202
             ||||||||||||||||||||
Sbjct: 49974 gttcattatatcaaacagca 49993



to top

>gb|AC008925.4| Homo sapiens chromosome 5 clone CTD-2284O10, complete sequence
          Length = 131990

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   tgtcttctttgagaggagtt 170
             ||||||||||||||||||||
Sbjct: 39523 tgtcttctttgagaggagtt 39542



to top

>ref|NM_001019759.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC4H3.02c),
           partial mRNA
          Length = 1176

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 26  ttgaggattcacatatgatttatt 49
           ||||||||||||||||||| ||||
Sbjct: 417 ttgaggattcacatatgatatatt 394



to top

>gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, region 47D-47D, BAC clone
             BACR24G16, complete sequence
          Length = 165974

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   gtcgaagttaaattttgttt 128
             ||||||||||||||||||||
Sbjct: 63386 gtcgaagttaaattttgttt 63405



to top

>gb|AC084404.8|AC084404 Oryza sativa chromosome 3 BAC OSJNBa0026A15 genomic sequence, complete
              sequence
          Length = 156929

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    gttgattgagtttcagttca 187
              ||||||||||||||||||||
Sbjct: 127015 gttgattgagtttcagttca 127034



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 168      gttgattgagtttcagttca 187
                ||||||||||||||||||||
Sbjct: 20324737 gttgattgagtttcagttca 20324756



to top

>gb|AE003827.3| Drosophila melanogaster chromosome 2R, section 23 of 73 of the complete
             sequence
          Length = 256227

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   gtcgaagttaaattttgttt 128
             ||||||||||||||||||||
Sbjct: 83107 gtcgaagttaaattttgttt 83126



to top

>gb|AC150035.3| Mus musculus BAC clone RP23-348A6 from 16, complete sequence
          Length = 188444

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    gttcattatatcaaacagca 202
              ||||||||||||||||||||
Sbjct: 129389 gttcattatatcaaacagca 129408



to top

>gb|AY856073.1| Oncopeltus fasciatus Deformed (Dfd) mRNA, partial cds
          Length = 246

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 69  ttccaactcgaggatttgat 88
           ||||||||||||||||||||
Sbjct: 120 ttccaactcgaggatttgat 101


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,555,539
Number of Sequences: 3902068
Number of extensions: 2555539
Number of successful extensions: 195363
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 195214
Number of HSP's gapped (non-prelim): 149
length of query: 208
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 186
effective length of database: 17,147,199,772
effective search space: 3189379157592
effective search space used: 3189379157592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top