ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal36e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY754697.1| Zea mays immunophilin mRNA, complete cds 285 5e-74
2gb|AY103897.1| Zea mays PCO108516 mRNA sequence 285 5e-74
3gb|BT016383.1| Zea mays clone Contig216 mRNA sequence 242 7e-61
4ref|XM_467909.1| Oryza sativa (japonica cultivar-group), mRNA 234 2e-58
5ref|XM_506987.1| PREDICTED Oryza sativa (japonica cultivar-group... 234 2e-58
6dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 2e-58
7dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 2e-58
8dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 1e-25
9dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 119 7e-24
10dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic D... 119 7e-24
11gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence 117 3e-23
12gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 ge... 117 3e-23
13gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 ge... 117 3e-23
14gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 ge... 117 3e-23
15gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 ge... 117 3e-23
16gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 ge... 117 3e-23
17gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 ge... 117 3e-23
18gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 ge... 117 3e-23
19gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 ge... 117 3e-23
20gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 ge... 117 3e-23
21gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 ge... 117 3e-23
22gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 ge... 117 3e-23
23gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 ge... 117 3e-23
24gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 ge... 117 3e-23
25gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 ge... 117 3e-23
26gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 ge... 117 3e-23
27gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 ge... 117 3e-23
28gb|U96925.1|VFU96925 Vicia faba immunophilin (FKBP12) mRNA, comp... 96 1e-16
29gb|AY490245.1| Lycopersicon esculentum CONSTANS interacting prot... 82 2e-12
30ref|NM_125831.2| Arabidopsis thaliana FKBP12; FK506 binding / pe... 56 9e-05
31gb|AY081564.1| Arabidopsis thaliana immunophilin (At5g64350) mRN... 56 9e-05
32gb|AY059928.1| Arabidopsis thaliana immunophilin (At5g64350; MSJ... 56 9e-05
33gb|U96924.1|ATU96924 Arabidopsis thaliana immunophilin (FKBP12) ... 56 9e-05
34gb|AY084289.1| Arabidopsis thaliana clone 10243 mRNA, complete s... 56 9e-05
35emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immun... 42 1.4
36gb|DQ271487.1| Mustela vison clone IX2M19 microsatellite sequence 42 1.4
37gb|AF165999.1|AF165999 Drosophila melanogaster sodium-dependent ... 42 1.4
38gb|M92297.2|STMBMANASE Streptomyces lividans mannanase (manA) ge... 42 1.4
39dbj|AP007284.1| Lotus japonicus genomic DNA, chromosome 6, clone... 42 1.4
40dbj|AB027469.1| Drosophila melanogaster gene for glutamate trans... 42 1.4
41ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (... 40 5.4
42gb|AC126538.1| Homo sapiens chromosome 16 clone CTD-3225F13, com... 40 5.4
43gb|AC133065.3| Homo sapiens chromosome 16 clone RP11-876N24, com... 40 5.4
44emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on ch... 40 5.4
45emb|AL954741.9| Zebrafish DNA sequence from clone CH211-255F4 in... 40 5.4
46gb|AY105607.1| Zea mays PCO107138 mRNA sequence 40 5.4
47gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, co... 40 5.4
48dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.4

>gb|AY754697.1| Zea mays immunophilin mRNA, complete cds
          Length = 761

 Score =  285 bits (144), Expect = 5e-74
 Identities = 252/288 (87%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||||||||| |||||||||||||||||||  | |||||||||||||||||||
Sbjct: 123 agaagcagatcctgagatccggcaccggccccaagccgataaagggccagaaggtcaccg 182

                                                                       
Query: 110 tccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaagg 169
           | ||||||||||||||||| |||||  |||||||||||||||| |||||||| |||||||
Sbjct: 183 ttcactgcaccggctacgggaaggatcgtgatctgtccaagaaattttggagcaccaagg 242

                                                                       
Query: 170 atcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatggg 229
           | ||||||||||||||||||  ||||| |||||| | |||||||||||||||||||||||
Sbjct: 243 accctgggcagcagccattcagtttcagcattggtcagggttcagtgatcaaaggatggg 302

                                                                       
Query: 230 atgagggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagact 289
           | ||||||||||||  ||||||| |||||||||| || ||| |  ||||||| || || |
Sbjct: 303 acgagggagttatgaccatgcaagtgggtgaagttgctcgtatccagtgcacgcctgatt 362

                                                           
Query: 290 acgcttatggatctggtggctctccagcctggggaattcaaccaaact 337
           | ||||||||| | || || |  |||||||||||||||||||||||||
Sbjct: 363 atgcttatggagccggcgggttcccagcctggggaattcaaccaaact 410



to top

>gb|AY103897.1| Zea mays PCO108516 mRNA sequence
          Length = 797

 Score =  285 bits (144), Expect = 5e-74
 Identities = 252/288 (87%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||||||||| |||||||||||||||||||  | |||||||||||||||||||
Sbjct: 123 agaagcagatcctgagatccggcaccggccccaagccgataaagggccagaaggtcaccg 182

                                                                       
Query: 110 tccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaagg 169
           | ||||||||||||||||| |||||  |||||||||||||||| |||||||| |||||||
Sbjct: 183 ttcactgcaccggctacgggaaggatcgtgatctgtccaagaaattttggagcaccaagg 242

                                                                       
Query: 170 atcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatggg 229
           | ||||||||||||||||||  ||||| |||||| | |||||||||||||||||||||||
Sbjct: 243 accctgggcagcagccattcagtttcagcattggtcagggttcagtgatcaaaggatggg 302

                                                                       
Query: 230 atgagggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagact 289
           | ||||||||||||  ||||||| |||||||||| || ||| |  ||||||| || || |
Sbjct: 303 acgagggagttatgaccatgcaagtgggtgaagttgctcgtatccagtgcacgcctgatt 362

                                                           
Query: 290 acgcttatggatctggtggctctccagcctggggaattcaaccaaact 337
           | ||||||||| | || || |  |||||||||||||||||||||||||
Sbjct: 363 atgcttatggagccggcgggttcccagcctggggaattcaaccaaact 410



to top

>gb|BT016383.1| Zea mays clone Contig216 mRNA sequence
          Length = 995

 Score =  242 bits (122), Expect = 7e-61
 Identities = 191/214 (89%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||||||||| |||||||||||||||||||  | ||||| | |||||||||||
Sbjct: 125 agaagcagatcctgagatccggcaccggccccaagccgataaaggggcggaaggtcaccg 184

                                                                       
Query: 110 tccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaagg 169
           | ||||||||||||||||| |||||  |||||||||||||||| |||||||| |||||||
Sbjct: 185 ttcactgcaccggctacgggaaggatcgtgatctgtccaagaaattttggagcaccaagg 244

                                                                       
Query: 170 atcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatggg 229
           | ||||||||||||||||||  ||||| |||||| | |||||||||||||||||||||||
Sbjct: 245 accctgggcagcagccattcagtttcagcattggtcagggttcagtgatcaaaggatggg 304

                                             
Query: 230 atgagggagttatggacatgcaattgggtgaagt 263
           | ||||||||||||  ||||||| ||||||||||
Sbjct: 305 acgagggagttatgaccatgcaagtgggtgaagt 338



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 313 ccagcctggggaattcaaccaaact 337
           |||||||||||||||||||||||||
Sbjct: 652 ccagcctggggaattcaaccaaact 676



to top

>ref|XM_467909.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 620

 Score =  234 bits (118), Expect = 2e-58
 Identities = 266/316 (84%)
 Strand = Plus / Plus

                                                                       
Query: 57  gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
           |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 119 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 178

                                                                       
Query: 117 caccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggatcctgg 176
           |||||||| ||| || ||   ||||||  | |||||||||||||| || |||||  | ||
Sbjct: 179 caccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaaggacgcagg 238

                                                                       
Query: 177 gcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgaggg 236
            ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||||
Sbjct: 239 ccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgaggg 298

                                                                       
Query: 237 agttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgctta 296
           |||||||  ||||||| |||||||||| || ||| || |||||||||| || || || ||
Sbjct: 299 agttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcgta 358

                                                                       
Query: 297 tggatctggtggctctccagcctggggaattcaaccaaactncgagctgatattcnagat 356
           |||| || |||| | ||| ||||||||||||| ||||||||  | |||| | ||| ||||
Sbjct: 359 tggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgagat 418

                           
Query: 357 cgaagttcttagcgcc 372
            || ||||||||||||
Sbjct: 419 tgaggttcttagcgcc 434



to top

>ref|XM_506987.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1175_B01.15
           mRNA
          Length = 630

 Score =  234 bits (118), Expect = 2e-58
 Identities = 266/316 (84%)
 Strand = Plus / Plus

                                                                       
Query: 57  gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
           |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 118 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 177

                                                                       
Query: 117 caccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggatcctgg 176
           |||||||| ||| || ||   ||||||  | |||||||||||||| || |||||  | ||
Sbjct: 178 caccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaaggacgcagg 237

                                                                       
Query: 177 gcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgaggg 236
            ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||||
Sbjct: 238 ccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgaggg 297

                                                                       
Query: 237 agttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgctta 296
           |||||||  ||||||| |||||||||| || ||| || |||||||||| || || || ||
Sbjct: 298 agttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcgta 357

                                                                       
Query: 297 tggatctggtggctctccagcctggggaattcaaccaaactncgagctgatattcnagat 356
           |||| || |||| | ||| ||||||||||||| ||||||||  | |||| | ||| ||||
Sbjct: 358 tggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgagat 417

                           
Query: 357 cgaagttcttagcgcc 372
            || ||||||||||||
Sbjct: 418 tgaggttcttagcgcc 433



to top

>dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023149K16, full
           insert sequence
          Length = 620

 Score =  234 bits (118), Expect = 2e-58
 Identities = 266/316 (84%)
 Strand = Plus / Plus

                                                                       
Query: 57  gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
           |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 119 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 178

                                                                       
Query: 117 caccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggatcctgg 176
           |||||||| ||| || ||   ||||||  | |||||||||||||| || |||||  | ||
Sbjct: 179 caccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaaggacgcagg 238

                                                                       
Query: 177 gcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgaggg 236
            ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||||
Sbjct: 239 ccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgaggg 298

                                                                       
Query: 237 agttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgctta 296
           |||||||  ||||||| |||||||||| || ||| || |||||||||| || || || ||
Sbjct: 299 agttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcgta 358

                                                                       
Query: 297 tggatctggtggctctccagcctggggaattcaaccaaactncgagctgatattcnagat 356
           |||| || |||| | ||| ||||||||||||| ||||||||  | |||| | ||| ||||
Sbjct: 359 tggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgagat 418

                           
Query: 357 cgaagttcttagcgcc 372
            || ||||||||||||
Sbjct: 419 tgaggttcttagcgcc 434



to top

>dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-C11, full
           insert sequence
          Length = 630

 Score =  234 bits (118), Expect = 2e-58
 Identities = 266/316 (84%)
 Strand = Plus / Plus

                                                                       
Query: 57  gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
           |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 118 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 177

                                                                       
Query: 117 caccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggatcctgg 176
           |||||||| ||| || ||   ||||||  | |||||||||||||| || |||||  | ||
Sbjct: 178 caccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaaggacgcagg 237

                                                                       
Query: 177 gcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgaggg 236
            ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||||
Sbjct: 238 ccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgaggg 297

                                                                       
Query: 237 agttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgctta 296
           |||||||  ||||||| |||||||||| || ||| || |||||||||| || || || ||
Sbjct: 298 agttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcgta 357

                                                                       
Query: 297 tggatctggtggctctccagcctggggaattcaaccaaactncgagctgatattcnagat 356
           |||| || |||| | ||| ||||||||||||| ||||||||  | |||| | ||| ||||
Sbjct: 358 tggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgagat 417

                           
Query: 357 cgaagttcttagcgcc 372
            || ||||||||||||
Sbjct: 418 tgaggttcttagcgcc 433



to top

>dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099N19, full
           insert sequence
          Length = 1896

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Plus

                                                                       
Query: 57  gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
           |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 116 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 175

                                                                  
Query: 117 caccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggat 171
           |||||||| ||| || ||   ||||||  | |||||||||||||| || ||||||
Sbjct: 176 caccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaaggat 230



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  119 bits (60), Expect = 7e-24
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                            
Query: 57       gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
                |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 32038214 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 32038155

                        
Query: 117      caccggct 124
                ||||||||
Sbjct: 32038154 caccggct 32038147



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                            
Query: 275      agtgcaccccagactacgcttatggatctggtggctctccagcctggggaattcaaccaa 334
                |||||||||| || || || |||||| || |||| | ||| ||||||||||||| |||||
Sbjct: 32036548 agtgcaccccggattatgcgtatggagctagtgggtttccggcctggggaattcgaccaa 32036489

                                                      
Query: 335      actncgagctgatattcnagatcgaagttcttagcgcc 372
                |||  | |||| | ||| |||| || ||||||||||||
Sbjct: 32036488 actcagtgctggtgttcgagattgaggttcttagcgcc 32036451



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 222      aggatgggatgagggagttatggacatgcaattgggtgaagt 263
                ||||||||| ||||||||||||  ||||||| ||||||||||
Sbjct: 32036921 aggatgggacgagggagttatgaccatgcaagtgggtgaagt 32036880



to top

>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1175_B01
          Length = 96191

 Score =  119 bits (60), Expect = 7e-24
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                         
Query: 57    gatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccgtccactg 116
             |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 58589 gatcctgaaagccggcaccggtcccaagcccgtcaagggccagaaggtcaccgtccactg 58530

                     
Query: 117   caccggct 124
             ||||||||
Sbjct: 58529 caccggct 58522



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 275   agtgcaccccagactacgcttatggatctggtggctctccagcctggggaattcaaccaa 334
             |||||||||| || || || |||||| || |||| | ||| ||||||||||||| |||||
Sbjct: 56923 agtgcaccccggattatgcgtatggagctagtgggtttccggcctggggaattcgaccaa 56864

                                                   
Query: 335   actncgagctgatattcnagatcgaagttcttagcgcc 372
             |||  | |||| | ||| |||| || ||||||||||||
Sbjct: 56863 actcagtgctggtgttcgagattgaggttcttagcgcc 56826



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 222   aggatgggatgagggagttatggacatgcaattgggtgaagt 263
             ||||||||| ||||||||||||  ||||||| ||||||||||
Sbjct: 57296 aggatgggacgagggagttatgaccatgcaagtgggtgaagt 57255



to top

>gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence
          Length = 798

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 32  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 91

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 92  tccactgcaccggctacgg 110



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 591 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 650

             
Query: 223 gg 224
           ||
Sbjct: 651 gg 652



to top

>gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                       
Query: 50  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagaaggtcaccg 109
           ||||| ||||| |||||||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccagaaggtcaccg 94

                              
Query: 110 tccactgcaccggctacgg 128
           |||||||||||||||||||
Sbjct: 95  tccactgcaccggctacgg 113



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 accaaggatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaa 222
           |||||||| ||||||||||||||||||  |||||||||||| ||||||||||||||||||
Sbjct: 594 accaaggaccctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaa 653

             
Query: 223 gg 224
           ||
Sbjct: 654 gg 655



to top

>gb|U96925.1|VFU96925 Vicia faba immunophilin (FKBP12) mRNA, complete cds
          Length = 574

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 117/140 (83%)
 Strand = Plus / Plus

                                                                       
Query: 94  ggccagaaggtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaag 153
           |||||||| |||||||| ||||||||||| ||||| ||  ||||||| || ||  |||||
Sbjct: 82  ggccagaacgtcaccgttcactgcaccggttacggtaaaaacggtgacctttctcagaag 141

                                                                       
Query: 154 ttttggagtaccaaggatcctgggcagcagccattcgctttcaacattggcctgggttca 213
           || ||||| || ||||||||||| ||| | |||||| ||||||| || ||||  ||||| 
Sbjct: 142 ttctggagcacgaaggatcctggccagaatccattcactttcaaaatcggccaaggttct 201

                               
Query: 214 gtgatcaaaggatgggatga 233
           || |||||||||||||||||
Sbjct: 202 gtcatcaaaggatgggatga 221



to top

>gb|AY490245.1| Lycopersicon esculentum CONSTANS interacting protein 3 (CIP3) mRNA,
           complete cds
          Length = 617

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 146/181 (80%)
 Strand = Plus / Plus

                                                                       
Query: 149 agaagttttggagtaccaaggatcctgggcagcagccattcgctttcaacattggcctgg 208
           ||||||| ||||| || |||||||| || |||||||| ||| ||||||| || ||||  |
Sbjct: 125 agaagttctggagcactaaggatccaggccagcagcctttctctttcaagatcggccaag 184

                                                                       
Query: 209 gttcagtgatcaaaggatgggatgagggagttatggacatgcaattgggtgaagtcgccc 268
           |   ||| ||||||||||||||||| |||||  ||| |||||||||||| ||||| || |
Sbjct: 185 gcaaagttatcaaaggatgggatgaaggagtactgggcatgcaattgggagaagttgctc 244

                                                                       
Query: 269 gtcttaagtgcaccccagactacgcttatggatctggtggctctccagcctggggaattc 328
           |  | | ||||||||| || || ||||||||  ||||||| | |||||| ||||| ||||
Sbjct: 245 gattaacgtgcacccctgattatgcttatggtgctggtggatttccagcatggggtattc 304

            
Query: 329 a 329
           |
Sbjct: 305 a 305



to top

>ref|NM_125831.2| Arabidopsis thaliana FKBP12; FK506 binding / peptidyl-prolyl
           cis-trans isomerase AT5G64350 (FKBP12) mRNA, complete
           cds
          Length = 632

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 162
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 145 gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 204

                   
Query: 163 accaagga 170
           || |||||
Sbjct: 205 acaaagga 212



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 214 gtgatcaaaggatgggatgagggagttat 242
           |||||||||||||||||||| || |||||
Sbjct: 256 gtgatcaaaggatgggatgaaggcgttat 284



to top

>gb|AY081564.1| Arabidopsis thaliana immunophilin (At5g64350) mRNA, complete cds
          Length = 510

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 162
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 64  gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 123

                   
Query: 163 accaagga 170
           || |||||
Sbjct: 124 acaaagga 131



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 214 gtgatcaaaggatgggatgagggagttat 242
           |||||||||||||||||||| || |||||
Sbjct: 175 gtgatcaaaggatgggatgaaggcgttat 203



to top

>gb|AY059928.1| Arabidopsis thaliana immunophilin (At5g64350; MSJ1.19) mRNA,
           complete cds
          Length = 590

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 162
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 122 gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 181

                   
Query: 163 accaagga 170
           || |||||
Sbjct: 182 acaaagga 189



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 214 gtgatcaaaggatgggatgagggagttat 242
           |||||||||||||||||||| || |||||
Sbjct: 233 gtgatcaaaggatgggatgaaggcgttat 261



to top

>gb|U96924.1|ATU96924 Arabidopsis thaliana immunophilin (FKBP12) mRNA, complete cds
          Length = 617

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 162
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 99  gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 158

                   
Query: 163 accaagga 170
           || |||||
Sbjct: 159 acaaagga 166



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 214 gtgatcaaaggatgggatgagggagttat 242
           |||||||||||||||||||| || |||||
Sbjct: 210 gtgatcaaaggatgggatgaaggcgttat 238



to top

>gb|AY084289.1| Arabidopsis thaliana clone 10243 mRNA, complete sequence
          Length = 582

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 162
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 145 gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 204

                   
Query: 163 accaagga 170
           || |||||
Sbjct: 205 acaaagga 212



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 214 gtgatcaaaggatgggatgagggagttat 242
           |||||||||||||||||||| || |||||
Sbjct: 256 gtgatcaaaggatgggatgaaggcgttat 284



to top

>emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immunophilin
          Length = 835

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 213 agtgatcaaaggatgggatgaggga 237
           ||||||||||||||||||| |||||
Sbjct: 343 agtgatcaaaggatgggatcaggga 367



to top

>gb|DQ271487.1| Mustela vison clone IX2M19 microsatellite sequence
          Length = 852

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 232 gagggagttatggacatgcaa 252
           |||||||||||||||||||||
Sbjct: 319 gagggagttatggacatgcaa 299



to top

>gb|AF165999.1|AF165999 Drosophila melanogaster sodium-dependent excitatory amino acid
           transporter 1 mRNA, complete cds
          Length = 2704

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                        
Query: 279 caccccagactacgcttatggatctggtg 307
           |||||||||| ||||||||||||||||||
Sbjct: 537 caccccagac-acgcttatggatctggtg 564



to top

>gb|M92297.2|STMBMANASE Streptomyces lividans mannanase (manA) gene, complete cds
          Length = 1881

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 caccggctacggcaaggacgg 137
           |||||||||||||||||||||
Sbjct: 597 caccggctacggcaaggacgg 617



to top

>dbj|AP007284.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT23F02, TM0183,
             complete sequence
          Length = 70173

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                         
Query: 152   agttttggagtaccaaggatcctgggcagcagccattcgctttcaacattggcctgggtt 211
             |||||||||| || ||||||||||| ||| | || ||| ||||||| || ||||  ||||
Sbjct: 47655 agttttggagcacaaaggatcctggccagaaacctttcactttcaaaatcggccaaggtt 47714

                          
Query: 212   cagtgatcaaagg 224
             | || ||||||||
Sbjct: 47715 ctgttatcaaagg 47727



to top

>dbj|AB027469.1| Drosophila melanogaster gene for glutamate transporter DGLT-1,
            complete cds
          Length = 8035

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                         
Query: 279  caccccagactacgcttatggatctggtg 307
            |||||||||| ||||||||||||||||||
Sbjct: 5137 caccccagac-acgcttatggatctggtg 5164



to top

>ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (DDB0204309), partial
           mRNA
          Length = 483

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 217 atcaaaggatgggatgaggg 236
           ||||||||||||||||||||
Sbjct: 322 atcaaaggatgggatgaggg 341



to top

>gb|AC126538.1| Homo sapiens chromosome 16 clone CTD-3225F13, complete sequence
          Length = 188015

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     tccagaaggagatcctgaga 66
              ||||||||||||||||||||
Sbjct: 106397 tccagaaggagatcctgaga 106378



to top

>gb|AC133065.3| Homo sapiens chromosome 16 clone RP11-876N24, complete sequence
          Length = 142215

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     tccagaaggagatcctgaga 66
              ||||||||||||||||||||
Sbjct: 126079 tccagaaggagatcctgaga 126098



to top

>emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on chromosome X, complete
              sequence
          Length = 186284

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 205    ctgggttcagtgatcaaaggatgggatg 232
              ||||||||||||||| ||||| ||||||
Sbjct: 100620 ctgggttcagtgatccaaggaggggatg 100593



to top

>emb|AL954741.9| Zebrafish DNA sequence from clone CH211-255F4 in linkage group 22,
            complete sequence
          Length = 166560

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  agggagttatggacatgcaa 252
            ||||||||||||||||||||
Sbjct: 5592 agggagttatggacatgcaa 5573



to top

>gb|AY105607.1| Zea mays PCO107138 mRNA sequence
          Length = 808

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 213 agtgatcaaaggatgggatgaggg 236
           ||||||||||||||||||| ||||
Sbjct: 347 agtgatcaaaggatgggatcaggg 370



to top

>gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, complete sequence
          Length = 167080

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     tccagaaggagatcctgaga 66
              ||||||||||||||||||||
Sbjct: 163579 tccagaaggagatcctgaga 163560



to top

>dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-872D17, complete
              sequence
          Length = 190251

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     ccagaaggagatcctgagag 67
              ||||||||||||||||||||
Sbjct: 142070 ccagaaggagatcctgagag 142089


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,439,908
Number of Sequences: 3902068
Number of extensions: 3439908
Number of successful extensions: 60032
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 59926
Number of HSP's gapped (non-prelim): 101
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top