ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal36d21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY105969.1| Zea mays PCO131995 mRNA sequence 196 1e-47
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 163 2e-37
3dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic D... 163 2e-37
4ref|NM_112804.3| Arabidopsis thaliana ATPREP1/ATZNMP; metalloend... 58 9e-06
5gb|AY091051.1| Arabidopsis thaliana putative metalloprotease (At... 58 9e-06
6gb|AY090240.1| Arabidopsis thaliana AT3g19170/MVI11_8 mRNA, comp... 58 9e-06
7gb|BT006362.1| Arabidopsis thaliana At3g19170/MVI11_8 gene, comp... 58 9e-06
8gb|BT002372.1| Arabidopsis thaliana clone U19043 putative metall... 58 9e-06
9dbj|AP000419.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 58 9e-06
10ref|NM_180631.1| Arabidopsis thaliana ATPREP2; metalloendopeptid... 52 5e-04
11ref|NM_180630.1| Arabidopsis thaliana ATPREP2; metalloendopeptid... 52 5e-04
12ref|NM_103851.3| Arabidopsis thaliana ATPREP2; metalloendopeptid... 52 5e-04
13gb|AY074305.1| Arabidopsis thaliana putative hydrogenase protein... 52 5e-04
14gb|BT004376.1| Arabidopsis thaliana clone U19879 putative hydrog... 52 5e-04
15gb|AC011807.4|AC011807 Arabidopsis thaliana chromosome I BAC F14... 52 5e-04
16gb|AC005486.2| Homo sapiens PAC clone RP5-1070G24 from 7, comple... 40 2.0
17gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, com... 38 8.1
18gb|AE017127.1| Yersinia pestis biovar Medievalis str. 91001 sect... 38 8.1
19gb|AE009952.1| Yersinia pestis KIM, complete genome 38 8.1
20gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, comple... 38 8.1
21gb|AC116323.6| Mus musculus BAC clone RP23-281F3 from 8, complet... 38 8.1
22gb|AC121838.2| Mus musculus BAC clone RP24-74O18 from 1, complet... 38 8.1
23gb|AY269342.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
24gb|AY269341.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
25gb|AY269340.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
26gb|AY269339.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
27gb|AY269336.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
28gb|AY269335.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
29gb|AY269334.1| Eleutherodactylus stejnegerianus specimen-voucher... 38 8.1
30gb|AY269333.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
31gb|AY269332.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
32gb|AY269330.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
33gb|AY269328.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
34gb|AY269327.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
35gb|AY269326.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
36gb|AY269325.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
37gb|AY269324.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
38gb|AY269323.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
39gb|AY269322.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
40gb|AY269321.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
41gb|AY269319.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
42gb|AY269318.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
43gb|AY269317.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
44gb|AY269316.1| Eleutherodactylus stejnegerianus specimen-voucher... 38 8.1
45gb|AY269315.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
46gb|AY269314.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
47gb|AY269313.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
48gb|AY269312.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
49gb|AY269310.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
50gb|AY269309.1| Eleutherodactylus stejnegerianus haplotype b spec... 38 8.1
51gb|AY269308.1| Eleutherodactylus stejnegerianus haplotype a spec... 38 8.1
52gb|AY269307.1| Eleutherodactylus stejnegerianus specimen-voucher... 38 8.1
53gb|AC060231.8| Homo sapiens chromosome 10 clone RP11-435G3, comp... 38 8.1
54emb|AL022726.1|HS625H18 Human DNA sequence from clone RP4-625H18... 38 8.1
55emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 38 8.1
56emb|AJ414141.1| Yersinia pestis strain CO92 complete genome; seg... 38 8.1
57gb|AC069427.10| Homo sapiens 3 BAC RP11-371I22 (Roswell Park Can... 38 8.1
58gb|AC021576.12| Homo sapiens chromosome 8, clone RP11-700M17, co... 38 8.1
59gb|AF155130.1|AF155130 Yersinia pestis DsbA (dsbA) gene, complet... 38 8.1
60gb|AC002981.1|AC002981 Homo sapiens Xp22 BAC GS279A12 (Genome Sy... 38 8.1
61emb|AL929424.7| Mouse DNA sequence from clone RP23-24F19 on chro... 38 8.1
62gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, comp... 38 8.1
63dbj|AP003478.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 8.1 
>gb|AY105969.1| Zea mays PCO131995 mRNA sequence
          Length = 1779

 Score =  196 bits (99), Expect = 1e-47
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                        
Query: 5    aatgaagccattgttatccctacacaggttaattatgttggaaaagnnggaaacccanac 64
            ||||||||||||||| |||| || ||||||||||||||||||||||  |||||||   ||
Sbjct: 1152 aatgaagccattgttgtcccaactcaggttaattatgttggaaaagctggaaacctttac 1211

                                                                        
Query: 65   caaagtggataccagctcaatggaagtgcctatgtcatatccaagcacataagcaacaca 124
            |||||||||||||||||||||||||| ||||||||||| || |||||||||||||| |||
Sbjct: 1212 caaagtggataccagctcaatggaagcgcctatgtcatctcaaagcacataagcaataca 1271

                                                      
Query: 125  tggttatgggaccgcgttcgagttagnggnggagcatatgga 166
            ||||||||||| || ||||||||||| || || |||||||||
Sbjct: 1272 tggttatgggatcgtgttcgagttagcggtggtgcatatgga 1313
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  163 bits (82), Expect = 2e-37
 Identities = 122/137 (89%)
 Strand = Plus / Plus

                                                                            
Query: 30       aggttaattatgttggaaaagnnggaaacccanaccaaagtggataccagctcaatggaa 89
                |||||||||||||||||||||  |||||||   ||||||||||||| |||||||||||||
Sbjct: 32086509 aggttaattatgttggaaaagctggaaacctgtaccaaagtggatatcagctcaatggaa 32086568

                                                                            
Query: 90       gtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagtta 149
                ||||||||||||| |||||||| |||||||| || ||||| |||||||| ||||||||||
Sbjct: 32086569 gtgcctatgtcatctccaagcatataagcaatacgtggttgtgggaccgtgttcgagtta 32086628

                                 
Query: 150      gnggnggagcatatgga 166
                | || || |||||||||
Sbjct: 32086629 gtggtggtgcatatgga 32086645
to top
>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0486G03
          Length = 146713

 Score =  163 bits (82), Expect = 2e-37
 Identities = 122/137 (89%)
 Strand = Plus / Plus

                                                                         
Query: 30    aggttaattatgttggaaaagnnggaaacccanaccaaagtggataccagctcaatggaa 89
             |||||||||||||||||||||  |||||||   ||||||||||||| |||||||||||||
Sbjct: 23165 aggttaattatgttggaaaagctggaaacctgtaccaaagtggatatcagctcaatggaa 23224

                                                                         
Query: 90    gtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagtta 149
             ||||||||||||| |||||||| |||||||| || ||||| |||||||| ||||||||||
Sbjct: 23225 gtgcctatgtcatctccaagcatataagcaatacgtggttgtgggaccgtgttcgagtta 23284

                              
Query: 150   gnggnggagcatatgga 166
             | || || |||||||||
Sbjct: 23285 gtggtggtgcatatgga 23301
to top
>ref|NM_112804.3| Arabidopsis thaliana ATPREP1/ATZNMP; metalloendopeptidase AT3G19170
            (ATPREP1/ATZNMP) mRNA, complete cds
          Length = 3466

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 84   atggaagtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttc 143
            |||| ||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2804 atggcagtgcgtatgttatatcaaagcatattagcaatacatggttatgggatcgtgttc 2863

                                   
Query: 144  gagttagnggnggagcatatgga 166
            | || || || || |||||||||
Sbjct: 2864 gtgtaagtggtggtgcatatgga 2886



 Score = 44.1 bits (22), Expect = 0.13
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 5    aatgaagccattgttatccctacacaggttaattatgttggaaaag 50
            |||||||||||||| || || || ||||| || |||||||||||||
Sbjct: 2725 aatgaagccattgtaataccaacccaggtaaactatgttggaaaag 2770
to top
>gb|AY091051.1| Arabidopsis thaliana putative metalloprotease (At3g19170) mRNA,
            complete cds
          Length = 3475

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 84   atggaagtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttc 143
            |||| ||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2802 atggcagtgcgtatgttatatcaaagcatattagcaatacatggttatgggatcgtgttc 2861

                                   
Query: 144  gagttagnggnggagcatatgga 166
            | || || || || |||||||||
Sbjct: 2862 gtgtaagtggtggtgcatatgga 2884



 Score = 44.1 bits (22), Expect = 0.13
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 5    aatgaagccattgttatccctacacaggttaattatgttggaaaag 50
            |||||||||||||| || || || ||||| || |||||||||||||
Sbjct: 2723 aatgaagccattgtaataccaacccaggtaaactatgttggaaaag 2768
to top
>gb|AY090240.1| Arabidopsis thaliana AT3g19170/MVI11_8 mRNA, complete cds
          Length = 3463

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 84   atggaagtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttc 143
            |||| ||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2804 atggcagtgcgtatgttatatcaaagcatattagcaatacatggttatgggatcgtgttc 2863

                                   
Query: 144  gagttagnggnggagcatatgga 166
            | || || || || |||||||||
Sbjct: 2864 gtgtaagtggtggtgcatatgga 2886



 Score = 44.1 bits (22), Expect = 0.13
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 5    aatgaagccattgttatccctacacaggttaattatgttggaaaag 50
            |||||||||||||| || || || ||||| || |||||||||||||
Sbjct: 2725 aatgaagccattgtaataccaacccaggtaaactatgttggaaaag 2770
to top
>gb|BT006362.1| Arabidopsis thaliana At3g19170/MVI11_8 gene, complete cds
          Length = 3243

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 84   atggaagtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttc 143
            |||| ||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2738 atggcagtgcgtatgttatatcaaagcatattagcaatacatggttatgggatcgtgttc 2797

                                   
Query: 144  gagttagnggnggagcatatgga 166
            | || || || || |||||||||
Sbjct: 2798 gtgtaagtggtggtgcatatgga 2820



 Score = 44.1 bits (22), Expect = 0.13
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 5    aatgaagccattgttatccctacacaggttaattatgttggaaaag 50
            |||||||||||||| || || || ||||| || |||||||||||||
Sbjct: 2659 aatgaagccattgtaataccaacccaggtaaactatgttggaaaag 2704
to top
>gb|BT002372.1| Arabidopsis thaliana clone U19043 putative metalloprotease
            (At3g19170) mRNA, complete cds
          Length = 3274

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 84   atggaagtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttc 143
            |||| ||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2738 atggcagtgcgtatgttatatcaaagcatattagcaatacatggttatgggatcgtgttc 2797

                                   
Query: 144  gagttagnggnggagcatatgga 166
            | || || || || |||||||||
Sbjct: 2798 gtgtaagtggtggtgcatatgga 2820



 Score = 44.1 bits (22), Expect = 0.13
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 5    aatgaagccattgttatccctacacaggttaattatgttggaaaag 50
            |||||||||||||| || || || ||||| || |||||||||||||
Sbjct: 2659 aatgaagccattgtaataccaacccaggtaaactatgttggaaaag 2704
to top
>dbj|AP000419.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MVI11
          Length = 81875

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                         
Query: 84    atggaagtgcctatgtcatatccaagcacataagcaacacatggttatgggaccgcgttc 143
             |||| ||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 21444 atggcagtgcgtatgttatatcaaagcatattagcaatacatggttatgggatcgtgttc 21385

                                    
Query: 144   gagttagnggnggagcatatgga 166
             | || || || || |||||||||
Sbjct: 21384 gtgtaagtggtggtgcatatgga 21362
to top
>ref|NM_180631.1| Arabidopsis thaliana ATPREP2; metalloendopeptidase AT1G49630
            (ATPREP2) transcript variant AT1G49630.2 mRNA, complete
            cds
          Length = 3432

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 95   tatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagttagnggn 154
            ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || 
Sbjct: 2791 tatgttatatcaaagcatattagtaacacatggttatgggatcgtgttcgtgtaagtggt 2850

                        
Query: 155  ggagcatatgga 166
            || |||||||||
Sbjct: 2851 ggtgcatatgga 2862
to top
>ref|NM_180630.1| Arabidopsis thaliana ATPREP2; metalloendopeptidase AT1G49630
            (ATPREP2) transcript variant AT1G49630.1 mRNA, complete
            cds
          Length = 3582

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 95   tatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagttagnggn 154
            ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || 
Sbjct: 2791 tatgttatatcaaagcatattagtaacacatggttatgggatcgtgttcgtgtaagtggt 2850

                        
Query: 155  ggagcatatgga 166
            || |||||||||
Sbjct: 2851 ggtgcatatgga 2862
to top
>ref|NM_103851.3| Arabidopsis thaliana ATPREP2; metalloendopeptidase AT1G49630
            (ATPREP2) transcript variant AT1G49630.3 mRNA, complete
            cds
          Length = 3576

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 95   tatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagttagnggn 154
            ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || 
Sbjct: 2791 tatgttatatcaaagcatattagtaacacatggttatgggatcgtgttcgtgtaagtggt 2850

                        
Query: 155  ggagcatatgga 166
            || |||||||||
Sbjct: 2851 ggtgcatatgga 2862
to top
>gb|AY074305.1| Arabidopsis thaliana putative hydrogenase protein (At1g49630) mRNA,
            complete cds
          Length = 3598

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 95   tatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagttagnggn 154
            ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || 
Sbjct: 2791 tatgttatatcaaagcatattagtaacacatggttatgggatcgtgttcgtgtaagtggt 2850

                        
Query: 155  ggagcatatgga 166
            || |||||||||
Sbjct: 2851 ggtgcatatgga 2862
to top
>gb|BT004376.1| Arabidopsis thaliana clone U19879 putative hydrogenase (At1g49630)
            mRNA, complete cds
          Length = 3274

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 95   tatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagttagnggn 154
            ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || 
Sbjct: 2746 tatgttatatcaaagcatattagtaacacatggttatgggatcgtgttcgtgtaagtggt 2805

                        
Query: 155  ggagcatatgga 166
            || |||||||||
Sbjct: 2806 ggtgcatatgga 2817
to top
>gb|AC011807.4|AC011807 Arabidopsis thaliana chromosome I BAC F14J22 genomic sequence, complete
             sequence
          Length = 104679

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                         
Query: 95    tatgtcatatccaagcacataagcaacacatggttatgggaccgcgttcgagttagnggn 154
             ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || 
Sbjct: 67499 tatgttatatcaaagcatattagtaacacatggttatgggatcgtgttcgtgtaagtggt 67558

                         
Query: 155   ggagcatatgga 166
             || |||||||||
Sbjct: 67559 ggtgcatatgga 67570
to top
>gb|AC005486.2| Homo sapiens PAC clone RP5-1070G24 from 7, complete sequence
          Length = 157075

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 8      gaagccattgttatccctacacag 31
              ||||| ||||||||||||||||||
Sbjct: 155215 gaagcaattgttatccctacacag 155238
to top
>gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, complete sequence
          Length = 187046

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     agtggataccagctcaatg 86
              |||||||||||||||||||
Sbjct: 181961 agtggataccagctcaatg 181979
to top
>gb|AE017127.1| Yersinia pestis biovar Medievalis str. 91001 section 1 of 16 of the
             complete genome
          Length = 290029

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    tggataccagctcaatgga 88
             |||||||||||||||||||
Sbjct: 22151 tggataccagctcaatgga 22169
to top
>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 70      tggataccagctcaatgga 88
               |||||||||||||||||||
Sbjct: 4236456 tggataccagctcaatgga 4236438
to top
>gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, complete sequence
          Length = 257003

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 99     tcatatccaagcacataag 117
              |||||||||||||||||||
Sbjct: 158215 tcatatccaagcacataag 158233
to top
>gb|AC116323.6| Mus musculus BAC clone RP23-281F3 from 8, complete sequence
          Length = 182204

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 99     tcatatccaagcacataag 117
              |||||||||||||||||||
Sbjct: 179433 tcatatccaagcacataag 179415
to top
>gb|AC121838.2| Mus musculus BAC clone RP24-74O18 from 1, complete sequence
          Length = 180961

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     tgttaatgaagccattgtt 19
             |||||||||||||||||||
Sbjct: 51543 tgttaatgaagccattgtt 51561
to top
>gb|AY269342.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257808 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269341.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257808 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269340.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257807 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 350

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 200 atatccaagcacataagca 182
to top
>gb|AY269339.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257807 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269336.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257806 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269335.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257806 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269334.1| Eleutherodactylus stejnegerianus specimen-voucher FMNH 257805
           cellular myelocytomatosis (c-myc) gene, exon 2 and
           partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269333.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257804 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269332.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257804 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269330.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257803 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269328.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257800 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269327.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257800 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269326.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257797 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 350

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 200 atatccaagcacataagca 182
to top
>gb|AY269325.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257797 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269324.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257799 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269323.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257799 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269322.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257798 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269321.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257798 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269319.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257796 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269318.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257795 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 350

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 200 atatccaagcacataagca 182
to top
>gb|AY269317.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257795 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269316.1| Eleutherodactylus stejnegerianus specimen-voucher FMNH 257794
           cellular myelocytomatosis (c-myc) gene, exon 2 and
           partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269315.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257793 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269314.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257793 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269313.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257790 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269312.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257790 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269310.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257787 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269309.1| Eleutherodactylus stejnegerianus haplotype b specimen-voucher FMNH
           257785 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269308.1| Eleutherodactylus stejnegerianus haplotype a specimen-voucher FMNH
           257785 cellular myelocytomatosis (c-myc) gene, exon 2
           and partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AY269307.1| Eleutherodactylus stejnegerianus specimen-voucher FMNH 257783
           cellular myelocytomatosis (c-myc) gene, exon 2 and
           partial cds
          Length = 351

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 atatccaagcacataagca 119
           |||||||||||||||||||
Sbjct: 201 atatccaagcacataagca 183
to top
>gb|AC060231.8| Homo sapiens chromosome 10 clone RP11-435G3, complete sequence
          Length = 193519

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 91    tgcctatgtcatatccaag 109
             |||||||||||||||||||
Sbjct: 72290 tgcctatgtcatatccaag 72308
to top
>emb|AL022726.1|HS625H18 Human DNA sequence from clone RP4-625H18 on chromosome 6p22.2-23 Contains
              the ID4 gene for dominant negative helix-loop-helix
              inhibitor of DNA binding 4 protein, a novel gene, the 5'
              end of two novel genes and four CpG islands, complete
              sequence
          Length = 185371

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 8      gaagccattgttatccctacacaggtt 34
              ||||| |||| ||||||||||||||||
Sbjct: 137230 gaagcaattgatatccctacacaggtt 137256
to top
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    tggataccagctcaatgga 88
             |||||||||||||||||||
Sbjct: 22419 tggataccagctcaatgga 22437
to top
>emb|AJ414141.1| Yersinia pestis strain CO92 complete genome; segment 1/20
          Length = 288050

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    tggataccagctcaatgga 88
             |||||||||||||||||||
Sbjct: 22356 tggataccagctcaatgga 22374
to top
>gb|AC069427.10| Homo sapiens 3 BAC RP11-371I22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 133858

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 65     caaagtggataccagctca 83
              |||||||||||||||||||
Sbjct: 105974 caaagtggataccagctca 105956
to top
>gb|AC021576.12| Homo sapiens chromosome 8, clone RP11-700M17, complete sequence
          Length = 166450

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    ctatgtcatatccaagcac 112
             |||||||||||||||||||
Sbjct: 65017 ctatgtcatatccaagcac 64999
to top
>gb|AF155130.1|AF155130 Yersinia pestis DsbA (dsbA) gene, complete cds
          Length = 2063

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 70   tggataccagctcaatgga 88
            |||||||||||||||||||
Sbjct: 1697 tggataccagctcaatgga 1715
to top
>gb|AC002981.1|AC002981 Homo sapiens Xp22 BAC GS279A12 (Genome Systems) complete sequence
          Length = 153568

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 28    acaggttaattatgttgga 46
             |||||||||||||||||||
Sbjct: 89864 acaggttaattatgttgga 89846
to top
>emb|AL929424.7| Mouse DNA sequence from clone RP23-24F19 on chromosome 2, complete
             sequence
          Length = 204020

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     ttaatgaagccattgttat 21
             |||||||||||||||||||
Sbjct: 90745 ttaatgaagccattgttat 90763
to top
>gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, complete sequence
          Length = 211079

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     agtggataccagctcaatg 86
              |||||||||||||||||||
Sbjct: 142075 agtggataccagctcaatg 142093
to top
>dbj|AP003478.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1247B1
          Length = 153894

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    ctatgtcatatccaagcac 112
             |||||||||||||||||||
Sbjct: 65528 ctatgtcatatccaagcac 65546


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 898,860
Number of Sequences: 3902068
Number of extensions: 898860
Number of successful extensions: 56844
Number of sequences better than 10.0: 63
Number of HSP's better than 10.0 without gapping: 63
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56715
Number of HSP's gapped (non-prelim): 129
length of query: 166
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 144
effective length of database: 17,147,199,772
effective search space: 2469196767168
effective search space used: 2469196767168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top