>gb|AY105904.1| Zea mays PCO126705 mRNA sequence
          Length = 2579

 Score =  291 bits (147), Expect = 7e-76
 Identities = 279/321 (86%), Gaps = 4/321 (1%)
 Strand = Plus / Plus

                                                                       
Query: 10  gttgctctttcaacatattgccattagcgaggatggaaagtacattgcttacgggctaag 69
           ||||||||||||||||||| | || |||||||||||||| ||||||||||| ||||||||
Sbjct: 476 gttgctctttcaacatatt-ctatcagcgaggatggaaactacattgcttatgggctaag 534

                                                                       
Query: 70  tgaaagtggcagcgactggatcactattcgtgttatgcgcattgcagacaggcaggctat 129
           ||||||||| || || ||| || |||||| ||| ||| ||||| |  ||| |||| ||||
Sbjct: 535 tgaaagtggtagtgattgggtctctattcatgtgatgagcattactaacaagcagcctat 594

                                                                       
Query: 130 gcctgacaaattgtcctgggtgaagttctcatctataagttggacgcatgacgggaaagg 189
           |||||| ||||| |||||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 595 gcctgataaattatcctgggtaaagttctcatctatcagctggacgcatgacgggaaagg 654

                                                                       
Query: 190 gtttttctatggcagatatcctgcgcc---cggagtggaattggatgctggaaccgagac 246
            |||||||||||  | ||||| || ||    |||| |||| ||||||||||||| |||||
Sbjct: 655 ttttttctatggtcggtatccagcacctagaggaggggaagtggatgctggaactgagac 714

                                                                       
Query: 247 aaatatcaatcttaatcatcagatatattaccatatcttgggatctgaccagtcagagga 306
           ||| |||||||||||||||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 715 aaacatcaatcttaatcatcagatatattaccatgttttgggatctgatcagtcagagga 774

                                
Query: 307 tatactatgctggaaagatcc 327
           |||| | ||||||||||||||
Sbjct: 775 tatattgtgctggaaagatcc 795

>ref|XM_549860.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2639

 Score =  242 bits (122), Expect = 6e-61
 Identities = 275/324 (84%), Gaps = 4/324 (1%)
 Strand = Plus / Plus

                                                                       
Query: 7   acagttgctctttcaacatattgccattagcgaggatggaaagtacattgcttacgggct 66
           |||||||||||||| || |||| |  ||||| ||||||| || ||||| ||||| || ||
Sbjct: 515 acagttgctctttcgacgtatt-ctgttagcaaggatggcaaatacatagcttatggcct 573

                                                                       
Query: 67  aagtgaaagtggcagcgactggatcactattcgtgttatgcgcattgcagacaggcaggc 126
           ||||||||||||||| || ||| ||||||||||||| |||  |||||| || | |||| |
Sbjct: 574 aagtgaaagtggcagtgattgggtcactattcgtgtgatgaacattgctgataagcagac 633

                                                                       
Query: 127 tatgcctgacaaattgtcctgggtgaagttctcatctataagttggacgcatgacgggaa 186
           | || ||||||||||||| |||||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 634 tttgtctgacaaattgtcttgggtgaaattctcatctatcagttggacccatgatggaaa 693

                                                                       
Query: 187 agggtttttctatggcagatatcctgcgccc---ggagtggaattggatgctggaaccga 243
           ||| |||||||||||  |||| ||||| |||   | ||||||||||||||||||||| ||
Sbjct: 694 aggttttttctatggtcgataccctgcaccccgagaagtggaattggatgctggaactga 753

                                                                       
Query: 244 gacaaatatcaatcttaatcatcagatatattaccatatcttgggatctgaccagtcaga 303
            ||||| || |||||||||||| |||||||||||||| || |||||||||| ||||| ||
Sbjct: 754 aacaaacattaatcttaatcatgagatatattaccatgtcgtgggatctgatcagtccga 813

                                   
Query: 304 ggatatactatgctggaaagatcc 327
            |||||| ||||||||||||||||
Sbjct: 814 agatatattatgctggaaagatcc 837

>dbj|AK101672.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033058D20, full
           insert sequence
          Length = 1802

 Score =  242 bits (122), Expect = 6e-61
 Identities = 275/324 (84%), Gaps = 4/324 (1%)
 Strand = Plus / Plus

                                                                       
Query: 7   acagttgctctttcaacatattgccattagcgaggatggaaagtacattgcttacgggct 66
           |||||||||||||| || |||| |  ||||| ||||||| || ||||| ||||| || ||
Sbjct: 588 acagttgctctttcgacgtatt-ctgttagcaaggatggcaaatacatagcttatggcct 646

                                                                       
Query: 67  aagtgaaagtggcagcgactggatcactattcgtgttatgcgcattgcagacaggcaggc 126
           ||||||||||||||| || ||| ||||||||||||| |||  |||||| || | |||| |
Sbjct: 647 aagtgaaagtggcagtgattgggtcactattcgtgtgatgaacattgctgataagcagac 706

                                                                       
Query: 127 tatgcctgacaaattgtcctgggtgaagttctcatctataagttggacgcatgacgggaa 186
           | || ||||||||||||| |||||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 707 tttgtctgacaaattgtcttgggtgaaattctcatctatcagttggacccatgatggaaa 766

                                                                       
Query: 187 agggtttttctatggcagatatcctgcgccc---ggagtggaattggatgctggaaccga 243
           ||| |||||||||||  |||| ||||| |||   | ||||||||||||||||||||| ||
Sbjct: 767 aggttttttctatggtcgataccctgcaccccgagaagtggaattggatgctggaactga 826

                                                                       
Query: 244 gacaaatatcaatcttaatcatcagatatattaccatatcttgggatctgaccagtcaga 303
            ||||| || |||||||||||| |||||||||||||| || |||||||||| ||||| ||
Sbjct: 827 aacaaacattaatcttaatcatgagatatattaccatgtcgtgggatctgatcagtccga 886

                                   
Query: 304 ggatatactatgctggaaagatcc 327
            |||||| ||||||||||||||||
Sbjct: 887 agatatattatgctggaaagatcc 910

>dbj|AK071405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023090K22, full
            insert sequence
          Length = 3375

 Score =  234 bits (118), Expect = 1e-58
 Identities = 274/324 (84%), Gaps = 4/324 (1%)
 Strand = Plus / Plus

                                                                        
Query: 7    acagttgctctttcaacatattgccattagcgaggatggaaagtacattgcttacgggct 66
            |||||||||||||| || |||| |  ||||| ||||||| || ||||| ||||| || ||
Sbjct: 1251 acagttgctctttcgacgtatt-ctgttagcaaggatggcaaatacatagcttatggcct 1309

                                                                        
Query: 67   aagtgaaagtggcagcgactggatcactattcgtgttatgcgcattgcagacaggcaggc 126
            ||||||||||||||| || ||| ||||||||||||| |||  |||||| || | |||| |
Sbjct: 1310 aagtgaaagtggcagtgattgggtcactattcgtgtgatgaacattgctgataagcagac 1369

                                                                        
Query: 127  tatgcctgacaaattgtcctgggtgaagttctcatctataagttggacgcatgacgggaa 186
            | || ||||||||||||| |||||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 1370 tttgtctgacaaattgtcttgggtgaaattctcatctatcagttggacccatgatggaaa 1429

                                                                        
Query: 187  agggtttttctatggcagatatcctgcgccc---ggagtggaattggatgctggaaccga 243
            ||| |||||||||||  | || ||||| |||   | ||||||||||||||||||||| ||
Sbjct: 1430 aggttttttctatggtcggtaccctgcaccccgagaagtggaattggatgctggaactga 1489

                                                                        
Query: 244  gacaaatatcaatcttaatcatcagatatattaccatatcttgggatctgaccagtcaga 303
             ||||| || |||||||||||| |||||||||||||| || |||||||||| ||||| ||
Sbjct: 1490 aacaaacattaatcttaatcatgagatatattaccatgtcgtgggatctgatcagtccga 1549

                                    
Query: 304  ggatatactatgctggaaagatcc 327
             |||||| ||||||||||||||||
Sbjct: 1550 agatatattatgctggaaagatcc 1573

>gb|BT009248.1| Triticum aestivum clone wlk1.pk0025.e2:fis, full insert mRNA
           sequence
          Length = 1924

 Score =  222 bits (112), Expect = 5e-55
 Identities = 121/124 (97%)
 Strand = Plus / Plus

                                                                       
Query: 204 gatatcctgcgcccggagtggaattggatgctggaaccgagacaaatatcaatcttaatc 263
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8   gatatcctgcgcctggagtggaattggatgctggaaccgagacaaatatcaatcttaatc 67

                                                                       
Query: 264 atcagatatattaccatatcttgggatctgaccagtcagaggatatactatgctggaaag 323
           ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 68  atcagatatattaccatatcttggggtctgatcagtcagaggatatactatgctggaaag 127

               
Query: 324 atcc 327
           ||||
Sbjct: 128 atcc 131

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score =  127 bits (64), Expect = 2e-26
 Identities = 97/108 (89%)
 Strand = Plus / Plus

                                                                          
Query: 220    agtggaattggatgctggaaccgagacaaatatcaatcttaatcatcagatatattacca 279
              ||||||||||||||||||||| || ||||| || |||||||||||| |||||||||||||
Sbjct: 442061 agtggaattggatgctggaactgaaacaaacattaatcttaatcatgagatatattacca 442120

                                                              
Query: 280    tatcttgggatctgaccagtcagaggatatactatgctggaaagatcc 327
              | || |||||||||| ||||| || |||||| ||||||||||||||||
Sbjct: 442121 tgtcgtgggatctgatcagtccgaagatatattatgctggaaagatcc 442168



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 122/146 (83%), Gaps = 1/146 (0%)
 Strand = Plus / Plus

                                                                          
Query: 7      acagttgctctttcaacatattgccattagcgaggatggaaagtacattgcttacgggct 66
              |||||||||||||| || |||| |  ||||| ||||||| || ||||| ||||| || ||
Sbjct: 441665 acagttgctctttcgacgtatt-ctgttagcaaggatggcaaatacatagcttatggcct 441723

                                                                          
Query: 67     aagtgaaagtggcagcgactggatcactattcgtgttatgcgcattgcagacaggcaggc 126
              ||||||||||||||| || ||| ||||||||||||| |||  |||||| || | |||| |
Sbjct: 441724 aagtgaaagtggcagtgattgggtcactattcgtgtgatgaacattgctgataagcagac 441783

                                        
Query: 127    tatgcctgacaaattgtcctgggtga 152
              | || ||||||||||||| |||||||
Sbjct: 441784 tttgtctgacaaattgtcttgggtga 441809



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                    
Query: 148    ggtgaagttctcatctataagttggacgcatgacgggaaagggtttttctatgg 201
              |||||| ||||||||||| |||||||| ||||| || ||||| |||||||||||
Sbjct: 441914 ggtgaaattctcatctatcagttggacccatgatggaaaaggttttttctatgg 441967

>dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0482C06
          Length = 182779

 Score =  127 bits (64), Expect = 2e-26
 Identities = 97/108 (89%)
 Strand = Plus / Plus

                                                                         
Query: 220   agtggaattggatgctggaaccgagacaaatatcaatcttaatcatcagatatattacca 279
             ||||||||||||||||||||| || ||||| || |||||||||||| |||||||||||||
Sbjct: 82262 agtggaattggatgctggaactgaaacaaacattaatcttaatcatgagatatattacca 82321

                                                             
Query: 280   tatcttgggatctgaccagtcagaggatatactatgctggaaagatcc 327
             | || |||||||||| ||||| || |||||| ||||||||||||||||
Sbjct: 82322 tgtcgtgggatctgatcagtccgaagatatattatgctggaaagatcc 82369



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 122/146 (83%), Gaps = 1/146 (0%)
 Strand = Plus / Plus

                                                                         
Query: 7     acagttgctctttcaacatattgccattagcgaggatggaaagtacattgcttacgggct 66
             |||||||||||||| || |||| |  ||||| ||||||| || ||||| ||||| || ||
Sbjct: 81866 acagttgctctttcgacgtatt-ctgttagcaaggatggcaaatacatagcttatggcct 81924

                                                                         
Query: 67    aagtgaaagtggcagcgactggatcactattcgtgttatgcgcattgcagacaggcaggc 126
             ||||||||||||||| || ||| ||||||||||||| |||  |||||| || | |||| |
Sbjct: 81925 aagtgaaagtggcagtgattgggtcactattcgtgtgatgaacattgctgataagcagac 81984

                                       
Query: 127   tatgcctgacaaattgtcctgggtga 152
             | || ||||||||||||| |||||||
Sbjct: 81985 tttgtctgacaaattgtcttgggtga 82010



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 148   ggtgaagttctcatctataagttggacgcatgacgggaaagggtttttctatgg 201
             |||||| ||||||||||| |||||||| ||||| || ||||| |||||||||||
Sbjct: 82115 ggtgaaattctcatctatcagttggacccatgatggaaaaggttttttctatgg 82168

>emb|X14336.1|INBI22 Filamentous Bacteriophage I2-2 genome
          Length = 6744

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 97  tcgtgttatgcgcattgcagaca 119
           |||||||||||||||||||||||
Sbjct: 45  tcgtgttatgcgcattgcagaca 67

>gb|BT016072.1| Drosophila melanogaster LP07359 full insert cDNA
          Length = 2398

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 37  cgaggatggaaagtacattgcttacgggctaagtgaaagtgg 78
           ||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 546 cgaggatggcaagtacatggcctacggcctgagtgaaagtgg 587

>gb|AC093102.2| Drosophila melanogaster clone BACR34C10, complete sequence
          Length = 179428

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 37     cgaggatggaaagtacattgcttacgggctaagtgaaagtgg 78
              ||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 176474 cgaggatggcaagtacatggcctacggcctgagtgaaagtgg 176515

>gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, complete sequence
          Length = 195972

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 188    gggtttttctatggcagatatcctgc 213
              |||||||||||| |||||||||||||
Sbjct: 176558 gggtttttctatagcagatatcctgc 176583

>ref|NM_135553.2| Drosophila melanogaster CG5355-RA (CG5355), mRNA
          Length = 2521

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 37  cgaggatggaaagtacattgcttacgggctaagtgaaagtgg 78
           ||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 679 cgaggatggcaagtacatggcctacggcctgagtgaaagtgg 720

>gb|AY051474.1| Drosophila melanogaster GH13952 full length cDNA
          Length = 2379

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 37  cgaggatggaaagtacattgcttacgggctaagtgaaagtgg 78
           ||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 528 cgaggatggcaagtacatggcctacggcctgagtgaaagtgg 569

>gb|AC007451.1|AC007451 Drosophila melanogaster, chromosome 2L, region 31D1-31F4, BAC clones
             DS00953 and BACR48K04, complete sequence
          Length = 161754

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 37    cgaggatggaaagtacattgcttacgggctaagtgaaagtgg 78
             ||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 72636 cgaggatggcaagtacatggcctacggcctgagtgaaagtgg 72595

>gb|AE003628.2| Drosophila melanogaster chromosome 2L, section 37 of 83 of the complete
              sequence
          Length = 269102

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 37     cgaggatggaaagtacattgcttacgggctaagtgaaagtgg 78
              ||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 174904 cgaggatggcaagtacatggcctacggcctgagtgaaagtgg 174863

>emb|AL512844.5| Human DNA sequence from clone RP11-90H3 on chromosome 1 Contains two
             matrin 3 (MATR3) pseudogenes, complete sequence
          Length = 159017

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   gttctcatctataagttgga 173
             ||||||||||||||||||||
Sbjct: 14448 gttctcatctataagttgga 14429

>emb|BX649370.5| Zebrafish DNA sequence from clone DKEY-97I11 in linkage group 24,
             complete sequence
          Length = 167578

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   aaattgtcctgggtgaagtt 156
             ||||||||||||||||||||
Sbjct: 65878 aaattgtcctgggtgaagtt 65897

>dbj|AB079597.1| Leptotyphlops dulcis mitochondrial DNA, complete genome
          Length = 16218

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   aatatcaatcttaatcatca 267
             ||||||||||||||||||||
Sbjct: 14789 aatatcaatcttaatcatca 14808


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,463,400
Number of Sequences: 3902068
Number of extensions: 2463400
Number of successful extensions: 42875
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42825
Number of HSP's gapped (non-prelim): 41
length of query: 327
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 305
effective length of database: 17,147,199,772
effective search space: 5229895930460
effective search space used: 5229895930460
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)