ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal35h05 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK062656.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-E12, full insert sequence Length = 627 Score = 151 bits (76), Expect = 3e-33 Identities = 106/116 (91%) Strand = Plus / Plus Query: 140 tgagaagaagttcggaggaatcgcaccaaagaagcctctgatttcaaaggaccatgagcg 199 ||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 141 tgagaagaagtatggagggattgcaccaaagaagcctctgatttcaaaggaccatgagcg 200 Query: 200 cgcctacttcgattccgcggactgggtcctcggcaagcaagctgcaagcaacaacg 255 ||||||||| |||||||| |||||||| || |||||||||||||||| || ||||| Sbjct: 201 cgcctactttgattccgcagactgggttcttggcaagcaagctgcaaacagcaacg 256 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 282 aagccaaagctaaagaggacgccccatcaccagctcccccctcgcaagccggcctgcgc 340 ||||| ||||| ||||| ||||| |||||||||||||| ||||||||||| ||||||| Sbjct: 283 aagcccaagctcaagagaacgcctcatcaccagctccctcctcgcaagccaacctgcgc 341
>gb|AY110240.1| Zea mays CL5921_1 mRNA sequence Length = 872 Score = 91.7 bits (46), Expect = 3e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 141 gagaagaagttcggaggaatcgcaccaaagaagcctctgatttcaaaggaccatgagcgc 200 |||||||||| |||||| || ||||| |||||||| |||| || |||||||| |||||| Sbjct: 181 gagaagaagtacggagggatggcacccaagaagcccttgatatccaaggaccacgagcgc 240 Query: 201 gcctacttcgattccgcggactgggt 226 |||||||||||||| ||||||||||| Sbjct: 241 gcctacttcgattctgcggactgggt 266
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 75.8 bits (38), Expect = 2e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgcggactgggtcctcggcaag 236 |||||| |||||||||||||||||||||||| ||||||||||| |||||| Sbjct: 14100705 aggaccctgagcgcgcctacttcgattccgcagactgggtcctaggcaag 14100754 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 295 agaggacgccccatcaccagctcccccctcgcaagccggcctgcgcgtccggctgatc 352 |||| ||||||||||||||||||||||||||||| ||| |||| || ||| ||||||| Sbjct: 14101061 agagaacgccccatcaccagctcccccctcgcaacccgacctgtgcatccagctgatc 14101118 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 264 gcagcaatcgagtccttgaagccaaagctaaag 296 |||||||| |||||||||||||||||||||||| Sbjct: 14100888 gcagcaattgagtccttgaagccaaagctaaag 14100920 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 153 ggaggaatcgcaccaaagaagcctctgatttcaaagg 189 |||||||| |||| |||||||||||||||||||||| Sbjct: 14100405 ggaggaattacacccaagaagcctctgatttcaaagg 14100441
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 75.8 bits (38), Expect = 2e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgcggactgggtcctcggcaag 236 |||||| |||||||||||||||||||||||| ||||||||||| |||||| Sbjct: 14054985 aggaccctgagcgcgcctacttcgattccgcagactgggtcctaggcaag 14055034 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 295 agaggacgccccatcaccagctcccccctcgcaagccggcctgcgcgtccggctgatc 352 |||| ||||||||||||||||||||||||||||| ||| |||| || ||| ||||||| Sbjct: 14055341 agagaacgccccatcaccagctcccccctcgcaacccgacctgtgcatccagctgatc 14055398 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 264 gcagcaatcgagtccttgaagccaaagctaaag 296 |||||||| |||||||||||||||||||||||| Sbjct: 14055168 gcagcaattgagtccttgaagccaaagctaaag 14055200 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 153 ggaggaatcgcaccaaagaagcctctgatttcaaagg 189 |||||||| |||| |||||||||||||||||||||| Sbjct: 14054685 ggaggaattacacccaagaagcctctgatttcaaagg 14054721
>emb|AL732644.3|CNS08C9J Oryza sativa chromosome 12, . BAC OSJNBa0016A01 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 150703 Score = 75.8 bits (38), Expect = 2e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgcggactgggtcctcggcaag 236 |||||| |||||||||||||||||||||||| ||||||||||| |||||| Sbjct: 27246 aggaccctgagcgcgcctacttcgattccgcagactgggtcctaggcaag 27295 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 295 agaggacgccccatcaccagctcccccctcgcaagccggcctgcgcgtccggctgatc 352 |||| ||||||||||||||||||||||||||||| ||| |||| || ||| ||||||| Sbjct: 27602 agagaacgccccatcaccagctcccccctcgcaacccgacctgtgcatccagctgatc 27659 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 264 gcagcaatcgagtccttgaagccaaagctaaag 296 |||||||| |||||||||||||||||||||||| Sbjct: 27429 gcagcaattgagtccttgaagccaaagctaaag 27461 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 153 ggaggaatcgcaccaaagaagcctctgatttcaaagg 189 |||||||| |||| |||||||||||||||||||||| Sbjct: 26946 ggaggaattacacccaagaagcctctgatttcaaagg 26982
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 140 tgagaagaagttcggaggaatcgcaccaaagaagcctctgatttcaaagg 189 ||||||||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 10776946 tgagaagaagtatggagggattgcaccaaagaagcctctgatttcaaagg 10776897 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 187 aggaccatgagcgcgcctacttcgattccgcggactgggtcctcggcaag 236 |||||||||||||||||||||| |||||||| |||||||| || |||||| Sbjct: 10776612 aggaccatgagcgcgcctactttgattccgcagactgggttcttggcaag 10776563 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 295 agaggacgccccatcaccagctcccccctcgcaagccggcctgcgc 340 |||| ||||| |||||||||||||| ||||||||||| ||||||| Sbjct: 10776325 agagaacgcctcatcaccagctccctcctcgcaagccaacctgcgc 10776280 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 581 gtatttttctcccttttttc 600 |||||||||||||||||||| Sbjct: 23166262 gtatttttctcccttttttc 23166243 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 731614 gcaacggcaacggcaacggc 731595
>gb|AC135908.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1275B08, from chromosome 3, complete sequence Length = 108833 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgcggactgggtcctcggcaag 236 |||||||||||||||||||||| |||||||| |||||||| || |||||| Sbjct: 78275 aggaccatgagcgcgcctactttgattccgcagactgggttcttggcaag 78324 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 140 tgagaagaagttcggaggaatcgcaccaaagaagcctctgatttcaaagg 189 ||||||||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 77941 tgagaagaagtatggagggattgcaccaaagaagcctctgatttcaaagg 77990 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 295 agaggacgccccatcaccagctcccccctcgcaagccggcctgcgc 340 |||| ||||| |||||||||||||| ||||||||||| ||||||| Sbjct: 78562 agagaacgcctcatcaccagctccctcctcgcaagccaacctgcgc 78607
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 140 tgagaagaagttcggaggaatcgcaccaaagaagcctctgatttcaaagg 189 ||||||||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 10775047 tgagaagaagtatggagggattgcaccaaagaagcctctgatttcaaagg 10774998 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 187 aggaccatgagcgcgcctacttcgattccgcggactgggtcctcggcaag 236 |||||||||||||||||||||| |||||||| |||||||| || |||||| Sbjct: 10774713 aggaccatgagcgcgcctactttgattccgcagactgggttcttggcaag 10774664 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 295 agaggacgccccatcaccagctcccccctcgcaagccggcctgcgc 340 |||| ||||| |||||||||||||| ||||||||||| ||||||| Sbjct: 10774426 agagaacgcctcatcaccagctccctcctcgcaagccaacctgcgc 10774381 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 581 gtatttttctcccttttttc 600 |||||||||||||||||||| Sbjct: 23159290 gtatttttctcccttttttc 23159271 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 731612 gcaacggcaacggcaacggc 731593
>dbj|AK062385.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-102-C01, full insert sequence Length = 612 Score = 63.9 bits (32), Expect = 6e-07 Identities = 74/88 (84%) Strand = Plus / Plus Query: 165 ccaaagaagcctctgatttcaaaggaccatgagcgcgcctacttcgattccgcggactgg 224 |||||||| ||||| ||| |||||||||||||| ||||| ||||||||||| || ||| Sbjct: 246 ccaaagaaacctctcattaataaggaccatgagcgtgcctatttcgattccgccgattgg 305 Query: 225 gtcctcggcaagcaagctgcaagcaaca 252 | || |||||||||| |||||||||| Sbjct: 306 gcacttggcaagcaaggcgcaagcaaca 333
>gb|AF348415.2| Zea mays cytosolic aldehyde dehydrogenase RF2D (rf2d) mRNA, complete cds Length = 1901 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 72 ggctgcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||||||| ||||||| Sbjct: 123 ggctgcaacggcaacggcaacggcaacggcaac 155 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 133 gcaacggcaacggcaacggcaacggcaa 160
>gb|AF042712.1|AF042712 Drosophila pseudoobscura even-skipped (eve) gene, stripe 2 enhancer region Length = 1027 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||||||||| Sbjct: 344 gcaacggcaacggcaacggcatcggca 318 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 350 gcaacggcaacggcaacggcaacggca 324 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||| ||||||||||| Sbjct: 338 gcaacggcaacggcatcggcatcggca 312 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 352 cggcaacggcaacggcaacggcaac 328
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2801733 gcaacggcaacggcaacggcaacggcaac 2801705 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2801727 gcaacggcaacggcaacggcaacggcaac 2801699 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2801721 gcaacggcaacggcaacggcaacggcaac 2801693 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 2801715 gcaacggcaacggcaacggcaacggc 2801690 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 |||| |||||||||||||||| ||||||| Sbjct: 2801739 gcaagggcaacggcaacggcaacggcaac 2801711
>ref|NM_189297.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 423 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Plus Query: 165 ccaaagaagcctctgatttcaaaggaccatgagcgcgcctacttcgattccgc 217 |||||||| ||||| ||| |||||||||||||| ||||| ||||||||||| Sbjct: 103 ccaaagaaacctctcattaataaggaccatgagcgtgcctatttcgattccgc 155
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1401575 gcaacggcaacggcaacggcaacggcaac 1401547 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 1401576 ggcaacggcaacggcaacggcaac 1401553
>ref|XM_952082.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial mRNA Length = 1854 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1304 gcaacggcaacggcaacggcaacggcaac 1332 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1298 gcaacggcaacggcaacggcaacggcaac 1326 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 1294 aacggcaacggcaacggcaacggcaac 1320
>ref|XM_328190.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial mRNA Length = 1854 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1304 gcaacggcaacggcaacggcaacggcaac 1332 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1298 gcaacggcaacggcaacggcaacggcaac 1326 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 1294 aacggcaacggcaacggcaacggcaac 1320
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2142534 gcaacggcaacggcaacggcaacggcaac 2142562 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2142528 gcaacggcaacggcaacggcaacggcaac 2142556 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2142522 gcaacggcaacggcaacggcaacggcaac 2142550 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2137078 gcaacggcaacggcaacggcaacggcaac 2137050 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 2137080 cggcaacggcaacggcaacggcaac 2137056 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 2142521 ggcaacggcaacggcaacggcaac 2142544
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2981371 gcaacggcaacggcaacggcaacggcaac 2981343 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2981365 gcaacggcaacggcaacggcaacggcaac 2981337 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 2981359 gcaacggcaacggcaacggcaacggc 2981334 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 2981372 ggcaacggcaacggcaacggcaac 2981349 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2126459 gcaacggcaacggcaacggc 2126440 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 ggctgatcgatcgcgatgcg 364 |||||||||||||||||||| Sbjct: 88866 ggctgatcgatcgcgatgcg 88847
>emb|AJ303031.1|MMU303031 Mycosphaerella musicola microsatellite flanking region, clone MmSSR21 Length = 638 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 246 gcaacggcaacggcaacggcaacggcaac 274 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 240 gcaacggcaacggcaacggcaacggcaac 268 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 252 gcaacggcaacggcaacggcaacggc 277 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 238 cggcaacggcaacggcaacggcaac 262
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome Length = 3059876 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1879554 gcaacggcaacggcaacggcaacggcaac 1879526 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1879548 gcaacggcaacggcaacggcaacggcaac 1879520 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1879542 gcaacggcaacggcaacggcaacggcaac 1879514 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1879536 gcaacggcaacggcaacggcaacggcaac 1879508 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 1879530 gcaacggcaacggcaacggcaacggcaa 1879503 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 1879558 aacggcaacggcaacggcaacggcaac 1879532
>gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic monensin biosynthesis gene cluster, partial sequence Length = 103450 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 77508 gcaacggcaacggcaacggcaacggcaac 77480 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 79 acggcaacggcaacggcatcggcaac 104 |||||||||||||||||| ||||||| Sbjct: 77511 acggcaacggcaacggcaacggcaac 77486
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 709716 gcaacggcaacggcaacggcaacggcaac 709744 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 709710 gcaacggcaacggcaacggcaacggcaac 709738 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 709704 gcaacggcaacggcaacggcaacggcaac 709732 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 709698 gcaacggcaacggcaacggcaacggcaac 709726 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 709692 gcaacggcaacggcaacggcaacggcaac 709720 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 709722 gcaacggcaacggcaacggcaacggc 709747 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 709690 cggcaacggcaacggcaacggcaac 709714
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 3305686 gcaacggcaacggcaacggcaacggcaac 3305714 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1627479 gcaacggcaacggcaacggcaacggcaac 1627507 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1627473 gcaacggcaacggcaacggcaacggcaac 1627501 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1627467 gcaacggcaacggcaacggcaacggcaac 1627495 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1627461 gcaacggcaacggcaacggcaacggcaac 1627489 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1627455 gcaacggcaacggcaacggcaacggcaac 1627483 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 3305681 caacggcaacggcaacggcaacggcaac 3305708 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 1627450 caacggcaacggcaacggcaacggcaac 1627477
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2727404 gcaacggcaacggcaacggcaacggcaac 2727432 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304195 gcaacggcaacggcaacggcaacggcaac 304223 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304189 gcaacggcaacggcaacggcaacggcaac 304217 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304183 gcaacggcaacggcaacggcaacggcaac 304211 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304177 gcaacggcaacggcaacggcaacggcaac 304205 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304171 gcaacggcaacggcaacggcaacggcaac 304199 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304165 gcaacggcaacggcaacggcaacggcaac 304193 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304159 gcaacggcaacggcaacggcaacggcaac 304187 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304153 gcaacggcaacggcaacggcaacggcaac 304181 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304147 gcaacggcaacggcaacggcaacggcaac 304175 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304141 gcaacggcaacggcaacggcaacggcaac 304169 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304135 gcaacggcaacggcaacggcaacggcaac 304163 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304129 gcaacggcaacggcaacggcaacggcaac 304157 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304123 gcaacggcaacggcaacggcaacggcaac 304151 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304117 gcaacggcaacggcaacggcaacggcaac 304145 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304111 gcaacggcaacggcaacggcaacggcaac 304139 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304105 gcaacggcaacggcaacggcaacggcaac 304133 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304099 gcaacggcaacggcaacggcaacggcaac 304127 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304093 gcaacggcaacggcaacggcaacggcaac 304121 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304087 gcaacggcaacggcaacggcaacggcaac 304115 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304081 gcaacggcaacggcaacggcaacggcaac 304109 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304075 gcaacggcaacggcaacggcaacggcaac 304103 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304069 gcaacggcaacggcaacggcaacggcaac 304097 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304063 gcaacggcaacggcaacggcaacggcaac 304091 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304057 gcaacggcaacggcaacggcaacggcaac 304085 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304051 gcaacggcaacggcaacggcaacggcaac 304079 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304045 gcaacggcaacggcaacggcaacggcaac 304073 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304039 gcaacggcaacggcaacggcaacggcaac 304067 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304033 gcaacggcaacggcaacggcaacggcaac 304061 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304027 gcaacggcaacggcaacggcaacggcaac 304055 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304021 gcaacggcaacggcaacggcaacggcaac 304049 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304015 gcaacggcaacggcaacggcaacggcaac 304043 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304009 gcaacggcaacggcaacggcaacggcaac 304037 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 304003 gcaacggcaacggcaacggcaacggcaac 304031 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 303997 gcaacggcaacggcaacggcaacggcaac 304025 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 303991 gcaacggcaacggcaacggcaacggcaac 304019 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 303985 gcaacggcaacggcaacggcaacggcaac 304013 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 303979 gcaacggcaacggcaacggcaacggcaac 304007 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 303973 gcaacggcaacggcaacggcaacggcaac 304001 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 303967 gcaacggcaacggcaacggcaacggcaac 303995 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 |||||||||||||||||||| ||||| Sbjct: 427422 gcaacggcaacggcaacggcttcggc 427397 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 2727402 cggcaacggcaacggcaacggcaac 2727426 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 77 caacggcaacggcaacggcatcggcaac 104 ||||||||||| |||||||| ||||||| Sbjct: 1577491 caacggcaacgacaacggcaacggcaac 1577464 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 303966 ggcaacggcaacggcaacggcaac 303989
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2978240 gcaacggcaacggcaacggcaacggcaac 2978212 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2978234 gcaacggcaacggcaacggcaacggcaac 2978206 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2978228 gcaacggcaacggcaacggcaacggcaac 2978200 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2978222 gcaacggcaacggcaacggcaacggcaac 2978194 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2978210 gcaacggcaacggcaacggcagcggcaac 2978182 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1716216 gcaacggcaacggcaacggcaacggcaac 1716188 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 1716210 gcaacggcaacggcaacggcaacggcaac 1716182 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 2978216 gcaacggcaacggcaacggcaacggca 2978190 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 2978242 cggcaacggcaacggcaacggcaac 2978218 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 ggctgatcgatcgcgatgcg 364 |||||||||||||||||||| Sbjct: 3934414 ggctgatcgatcgcgatgcg 3934395 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2246763 gcaacggcaacggcaacggc 2246782
>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29 Length = 311000 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 205474 gcaacggcaacggcaacggcaacggcaac 205502 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 205480 gcaacggcaacggcaacggcaacggca 205506 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 205472 cggcaacggcaacggcaacggcaac 205496
>emb|AL355926.1|NCB17C10 Neurospora crassa DNA linkage group II BAC clone B17C10 Length = 68484 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 59645 gcaacggcaacggcaacggcaacggcaac 59673 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 59639 gcaacggcaacggcaacggcaacggcaac 59667 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 59635 aacggcaacggcaacggcaacggcaac 59661
>gb|AE012542.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 450 of 460 of the complete genome Length = 11491 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 8004 gcaacggcaacggcaacggcaacggcaac 7976 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 7998 gcaacggcaacggcaacggcaacggcaa 7971
>gb|DQ378280.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 43O10, complete sequence Length = 40809 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 74 ctgcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||||| ||||| Sbjct: 14050 ctgcaacggcaacggcaacggcaacggca 14078 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||| ||||||||||||||| ||||||| Sbjct: 14046 gcaactgcaacggcaacggcaacggcaac 14074
>gb|J02527.1|DROGART Drosophila melanogaster Gart polypeptide gene, complete cds, alternatively spliced and pupal cuticle protein gene, complete cds Length = 9953 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 79 acggcaacggcaacggcatcggcaactcg 107 |||||||||||||||||| |||||||||| Sbjct: 2901 acggcaacggcaacggcaacggcaactcg 2873 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 2898 gcaacggcaacggcaacggca 2878
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 5043698 gcaacggcaacggcaacggcaacggcaac 5043670 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 5043692 gcaacggcaacggcaacggcaacggcaa 5043665
>gb|AC007760.6|AC007760 Drosophila melanogaster, chromosome 3R, region 89B-89B, BAC clone BACR37I18, complete sequence Length = 195037 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 105810 gcaacggcaacggcaacggcaacggcaac 105838 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 105809 ggcaacggcaacggcaacggcaac 105832
>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone BACR05P04, complete sequence Length = 194335 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 15773 gcaacggcaacggcaacggcaacggcaac 15801 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 15772 ggcaacggcaacggcaacggcaac 15795
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 733835 gcaacggcaacggcaacggcaacggcaac 733863 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 733829 gcaacggcaacggcaacggcaacggcaac 733857 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 733827 cggcaacggcaacggcaacggcaac 733851 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 7055279 gcaacggcaacggcaacggc 7055260
>gb|AE003712.1| Drosophila melanogaster chromosome 3R, section 50 of 118 of the complete sequence Length = 226200 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 105222 gcaacggcaacggcaacggcaacggcaac 105250 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 105221 ggcaacggcaacggcaacggcaac 105244
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 4907920 gcaacggcaacggcaacggcaacggcaac 4907892 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2530886 gcaacggcaacggcaacggcaacggcaac 2530914 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2530880 gcaacggcaacggcaacggcaacggcaac 2530908 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2530874 gcaacggcaacggcaacggcaacggcaac 2530902 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 2530868 gcaacggcaacggcaacggcaacggcaac 2530896 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 4907925 caacggcaacggcaacggcaacggcaac 4907898 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 2530863 caacggcaacggcaacggcaacggcaac 2530890 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2256098 gcaacggcaacggcaacggc 2256079
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1182 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 131 gcaacggcaacggcaacggcaacggcaac 159 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 126 caacggcaacggcaacggcaacggcaac 153 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 137 gcaacggcaacggcaacggcaacggc 162
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 131 gcaacggcaacggcaacggcaacggcaac 159 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 126 caacggcaacggcaacggcaacggcaac 153 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 137 gcaacggcaacggcaacggcaacggc 162
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19621 gcaacggcaacggcaacggcaacggcaac 19649 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19615 gcaacggcaacggcaacggcaacggcaac 19643 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19609 gcaacggcaacggcaacggcaacggcaac 19637 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19603 gcaacggcaacggcaacggcaacggcaac 19631 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19597 gcaacggcaacggcaacggcaacggcaac 19625 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19591 gcaacggcaacggcaacggcaacggcaac 19619 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19585 gcaacggcaacggcaacggcaacggcaac 19613 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19579 gcaacggcaacggcaacggcaacggcaac 19607 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19573 gcaacggcaacggcaacggcaacggcaac 19601 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19567 gcaacggcaacggcaacggcaacggcaac 19595 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19561 gcaacggcaacggcaacggcaacggcaac 19589 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19555 gcaacggcaacggcaacggcaacggcaac 19583 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19549 gcaacggcaacggcaacggcaacggcaac 19577 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19543 gcaacggcaacggcaacggcaacggcaac 19571 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19537 gcaacggcaacggcaacggcaacggcaac 19565 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19531 gcaacggcaacggcaacggcaacggcaac 19559 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19525 gcaacggcaacggcaacggcaacggcaac 19553 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19519 gcaacggcaacggcaacggcaacggcaac 19547 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19513 gcaacggcaacggcaacggcaacggcaac 19541 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 19507 gcaacggcaacggcaacggcaacggcaac 19535 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 19506 ggcaacggcaacggcaacggcaac 19529
>dbj|AB073680.1| Turbo marmoratus mRNA for nacrein, complete cds Length = 1710 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||||| ||||||| Sbjct: 925 gcaacggcaacggcaacggcaacggcaac 953 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 931 gcaacggcaacggcaacggcaacggcaa 958 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 924 ggcaacggcaacggcaacggcaac 947
>ref|XM_705331.1| Candida albicans SC5314 hypothetical protein (CaO19.4553), mRNA Length = 2166 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 1262 caacggcaacggcaacggcaacggcaac 1289 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 1267 gcaacggcaacggcaacggca 1287 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 ||||| |||||||||||||| ||||||| Sbjct: 1256 caacgacaacggcaacggcaacggcaac 1283
>ref|XM_787519.1| PREDICTED: Strongylocentrotus purpuratus similar to PHD finger protein 10 (LOC587811), mRNA Length = 1224 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 19 atcatcgtctccttcttcctcctc 42 |||||||||||||||||||||||| Sbjct: 537 atcatcgtctccttcttcctcctc 514
>ref|XM_780854.1| PREDICTED: Strongylocentrotus purpuratus similar to PHD finger protein 10 (XAP135) (LOC580820), mRNA Length = 3198 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 19 atcatcgtctccttcttcctcctc 42 |||||||||||||||||||||||| Sbjct: 2079 atcatcgtctccttcttcctcctc 2056
>gb|AC167663.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940143D9, complete sequence Length = 118759 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 6047 gcaacggcaacggcaacggcaacggcaa 6074 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 6046 ggcaacggcaacggcaacggcaac 6069
>gb|AC167560.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940139D9, complete sequence Length = 118752 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 6046 gcaacggcaacggcaacggcaacggcaa 6073 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 6045 ggcaacggcaacggcaacggcaac 6068
>gb|AC167664.4| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940124D9, complete sequence Length = 118889 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||||||||||||||| |||||| Sbjct: 112713 gcaacggcaacggcaacggcaacggcaa 112686 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 112714 ggcaacggcaacggcaacggcaac 112691
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 10391 aacggcaacggcaacggcaacggcaac 10365 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 10387 gcaacggcaacggcaacggca 10367
>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence Length = 125927 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 74 ctgcaacggcaacggcaacggca 96 ||||||||||||||||||||||| Sbjct: 94922 ctgcaacggcaacggcaacggca 94944
>ref|XM_718288.1| Candida albicans SC5314 hypothetical protein (CaO19_12351), mRNA Length = 1380 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 889 aacggcaacggcaacggcaacggcaac 915 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 893 gcaacggcaacggcaacggca 913
>gb|AC132297.4| Mus musculus chromosome 7 clone RP24-330M18, complete sequence Length = 152941 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 127067 gcaacggcaacggcaacggcaacggca 127041 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 127061 gcaacggcaacggcaacggcagcggca 127035
>gb|AY341996.1| Drosophila miranda CG7255-like protein gene, partial cds Length = 639 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 511 aacggcaacggcaacggcaacggcaac 537 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 515 gcaacggcaacggcaacggca 535
>ref|XM_755711.1| Ustilago maydis 521 hypothetical protein (UM04657.1) partial mRNA Length = 5832 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| ||||||| Sbjct: 4834 aacggcaacggcaacggcaacggcaac 4860 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 4838 gcaacggcaacggcaacggca 4858
>gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete sequence Length = 227968 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 105735 gcaacggcaacggcaacggcagcggca 105761 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 105729 gcaacggcaacggcaacggcaacggca 105755
>ref|XM_739910.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000794.04.0) partial mRNA Length = 1176 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttcctcctcttc 45 |||||||||||||| | |||||||||||||| Sbjct: 187 cttcatcatcgtcttcctcttcctcctcttc 157
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgc 217 ||||||||||||| ||||| ||||||||||| Sbjct: 11317114 aggaccatgagcgtgcctatttcgattccgc 11317144 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 23835526 gcaacggcaacggcaacggc 23835545
>ref|XM_233245.3| PREDICTED: Rattus norvegicus similar to mesoderm induction early response 1 (MI-ER1) (LOC313418), mRNA Length = 3300 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttcctcctcttc 45 |||||||||| || ||||||||||||||||| Sbjct: 521 cttcatcatcttcaccttcttcctcctcttc 491
>gb|AY190942.1| Drosophila pseudoobscura clone DPSF01_33_N22 (D1412) genomic sequence Length = 44139 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggca 102 ||||||||||||||||||||||| Sbjct: 12628 cggcaacggcaacggcatcggca 12606 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||| ||||||||||| Sbjct: 12626 gcaacggcaacggcatcggcatcggca 12600
>dbj|AP002873.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0552C05 Length = 136586 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgc 217 ||||||||||||| ||||| ||||||||||| Sbjct: 30699 aggaccatgagcgtgcctatttcgattccgc 30729
>dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0475H04 Length = 143337 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Plus Query: 187 aggaccatgagcgcgcctacttcgattccgc 217 ||||||||||||| ||||| ||||||||||| Sbjct: 104519 aggaccatgagcgtgcctatttcgattccgc 104549
>gb|AC150275.2| Mus musculus BAC clone RP23-409M16 from 7, complete sequence Length = 224935 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 223645 gcaacggcaacggcaacggcaacggca 223619 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggca 102 ||||||||||||||||||||| ||||| Sbjct: 223639 gcaacggcaacggcaacggcagcggca 223613
>gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, complete sequence Length = 164932 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 16 ttcatcatcgtctccttcttcctcctcttc 45 ||||||||| ||| |||||||||||||||| Sbjct: 97716 ttcatcatcatcttcttcttcctcctcttc 97745
>ref|XM_480314.1| Oryza sativa (japonica cultivar-group), mRNA Length = 303 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcat 97 |||||||||||||||||||||| Sbjct: 22 gcaacggcaacggcaacggcat 1
>gb|BT017304.1| Zea mays clone EL01N0316E01.c mRNA sequence Length = 937 Score = 44.1 bits (22), Expect = 0.57 Identities = 37/42 (88%) Strand = Plus / Plus Query: 186 aaggaccatgagcgcgcctacttcgattccgcggactgggtc 227 |||||||| |||||||||||||| ||||| || |||| |||| Sbjct: 284 aaggaccacgagcgcgcctactttgattctgcagactaggtc 325
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 522907 gcaacggcaacggcaacggcaacggc 522932 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 522905 cggcaacggcaacggcaacggcaac 522929 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 ggctgatcgatcgcgatgcg 364 |||||||||||||||||||| Sbjct: 2961435 ggctgatcgatcgcgatgcg 2961416
>ref|XM_954064.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial mRNA Length = 1263 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 983 gcaacggcaacggcaacggcaacggc 1008 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 982 ggcaacggcaacggcaacggcaac 1005
>ref|XM_331604.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial mRNA Length = 1263 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 983 gcaacggcaacggcaacggcaacggc 1008 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 982 ggcaacggcaacggcaacggcaac 1005
>gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (CG10013), CG31217 (CG31217), and ultrabithorax (Ubx) genes, complete cds Length = 308092 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Minus Query: 77 caacggcaacggcaacggcatcggcaactc 106 |||| ||||||||||||||| ||||||||| Sbjct: 235923 caacagcaacggcaacggcaacggcaactc 235894 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 235918 gcaacggcaacggcaacggca 235898 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 caacggcaacggcaacggca 96 |||||||||||||||||||| Sbjct: 224036 caacggcaacggcaacggca 224017
>gb|AC105515.5| Rattus norvegicus 14 BAC CH230-13H11 (Children's Hospital Oakland Research Institute) complete sequence Length = 221805 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcat 97 |||||||||||||||||||||| Sbjct: 8187 gcaacggcaacggcaacggcat 8166
>emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II BAC contig B24N11 Length = 129306 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcat 97 |||||||||||||||||||||| Sbjct: 40487 gcaacggcaacggcaacggcat 40508
>emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig B1D14 Length = 138898 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 107423 gcaacggcaacggcaacggcaacggc 107448 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 107422 ggcaacggcaacggcaacggcaac 107445
>ref|NM_137678.2| Drosophila melanogaster Ipk1 CG30295-RA (Ipk1), mRNA Length = 2463 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 1965 gcaacggcaacggcaacggcaacggc 1990 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 1964 ggcaacggcaacggcaacggcaac 1987
>gb|AY061821.1| Drosophila melanogaster GH07317 full length cDNA Length = 2476 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 1965 gcaacggcaacggcaacggcaacggc 1990 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 1964 ggcaacggcaacggcaacggcaac 1987
>gb|AC012388.5| Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR10P16, complete sequence Length = 171972 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 92937 gcaacggcaacggcaacggcaacggc 92962 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 92936 ggcaacggcaacggcaacggcaac 92959
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 2220748 gcaacggcaacggcaacggcaacggc 2220773 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 |||||||||||||||||||| ||||| Sbjct: 1561002 gcaacggcaacggcaacggcttcggc 1561027 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 |||||||||||||||||||| ||||||| Sbjct: 2220754 gcaacggcaacggcaacggcgacggcaac 2220782
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcat 97 |||||||||||||||||||||| Sbjct: 4282922 gcaacggcaacggcaacggcat 4282901
>gb|AC008289.5|AC008289 Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR04E05, complete sequence Length = 163012 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 85390 gcaacggcaacggcaacggcaacggc 85365 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 85391 ggcaacggcaacggcaacggcaac 85368
>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone BACR10P11, complete sequence Length = 164035 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 158171 gcaacggcaacggcaacggcaacggc 158146 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 158172 ggcaacggcaacggcaacggcaac 158149
>dbj|AB088472.2| Gennaria diphylla OrcLFY gene for LFY-like protein OrcLFY, complete cds Length = 1562 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttc 36 |||||||||||||||||||||| Sbjct: 773 cttcatcatcgtctccttcttc 752
>dbj|AB088469.2| Dactylorhiza romana OrcLFY gene for LFY-like protein OrcLFY, complete cds Length = 1577 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttc 36 |||||||||||||||||||||| Sbjct: 782 cttcatcatcgtctccttcttc 761
>dbj|AB088466.2| Serapias lingua OrcLFY gene for LFY-like protein OrcLFY, complete cds Length = 1568 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttc 36 |||||||||||||||||||||| Sbjct: 773 cttcatcatcgtctccttcttc 752
>dbj|AB088454.2| Orchis quadripunctata OrcLFY gene for LFY-like protein OrcLFY, complete cds Length = 1559 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttc 36 |||||||||||||||||||||| Sbjct: 764 cttcatcatcgtctccttcttc 743
>dbj|AB088439.2| Orchis mascula OrcLFY gene for LFY-like protein OrcLFY, complete cds Length = 1568 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttc 36 |||||||||||||||||||||| Sbjct: 773 cttcatcatcgtctccttcttc 752
>gb|AC011438.3|AC011438 Genomic sequence for Arabidopsis thaliana BAC T23G18 from chromosome I, complete sequence Length = 91470 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 573 tcagttcagtatttttctcccttttt 598 |||| ||||||||||||||||||||| Sbjct: 33783 tcaggtcagtatttttctcccttttt 33758
>dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0054L03 Length = 183623 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcat 97 |||||||||||||||||||||| Sbjct: 45716 gcaacggcaacggcaacggcat 45695
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 1502005 gcaacggcaacggcaacggcaacggc 1501980 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||| ||||| ||||||| Sbjct: 1502125 gcaacggcaacggcaccggcagcggcaac 1502097 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 1502007 cggcaacggcaacggcaacggcaac 1501983 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 5889527 gcaacggcaacggcaacggc 5889546
>emb|BX005073.7| Zebrafish DNA sequence from clone CH211-129N18, complete sequence Length = 185849 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 15 cttcatcatcgtctccttcttcctcctctt 44 |||||||||| ||| ||||||||||||||| Sbjct: 169954 cttcatcatcatcttcttcttcctcctctt 169983
>dbj|AK110643.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-D02, full insert sequence Length = 1044 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 79 acggcaacggcaacggcatcggcaac 104 |||||||||||||||||| ||||||| Sbjct: 271 acggcaacggcaacggcaacggcaac 296 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 658 gcaacggcaacggcaacggca 678 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 656 cggcaacggcaacggcaacggcaac 680 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 274 gcaacggcaacggcaacggca 294
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 1919989 gcaacggcaacggcaacggcaacggc 1919964 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 1919991 cggcaacggcaacggcaacggcaac 1919967
>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete sequence Length = 303438 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 93097 gcaacggcaacggcaacggcaacggc 93122 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 93096 ggcaacggcaacggcaacggcaac 93119
>gb|AC004433.1|AC004433 Drosophila melanogaster, chromosome 2R, region 57B1-57B6, P1 clone DS03659, complete sequence Length = 85862 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggcatcggc 101 ||||||||||||||||||||| |||| Sbjct: 28561 gcaacggcaacggcaacggcaacggc 28536 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 28562 ggcaacggcaacggcaacggcaac 28539
>dbj|AB088851.1| Orchis italica gene for LFY-like protein OrcLFY, complete cds Length = 2549 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttc 36 |||||||||||||||||||||| Sbjct: 1741 cttcatcatcgtctccttcttc 1720
>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence Length = 152183 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 57714 tcatcatcatcttcttcttcctcctcttc 57686
>ref|NM_116309.2| Arabidopsis thaliana RNA binding / nucleic acid binding AT4G00830 transcript variant AT4G00830.1 mRNA, complete cds Length = 2267 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 274 tcatcatcatcttcttcttcctcctcttc 246
>ref|NM_001036489.1| Arabidopsis thaliana RNA binding / nucleic acid binding AT4G00830 transcript variant AT4G00830.2 mRNA, complete cds Length = 2455 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 462 tcatcatcatcttcttcttcctcctcttc 434
>ref|XM_521092.1| PREDICTED: Pan troglodytes similar to hypothetical protein FLJ39827 (LOC465669), mRNA Length = 2556 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttcg 46 ||||||||||||||||||||| Sbjct: 2204 tctccttcttcctcctcttcg 2184
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 3937353 cggcaacggcaacggcaccggcaac 3937377
>ref|XM_359451.1| Magnaporthe grisea 70-15 hypothetical protein (MG05326.4) partial mRNA Length = 1512 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 176 gcaacggcaacggcaacggca 196 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 |||| |||||||||||||||| ||||||| Sbjct: 170 gcaatggcaacggcaacggcaacggcaac 198
>ref|XM_365446.1| Magnaporthe grisea 70-15 hypothetical protein (MG02148.4) partial mRNA Length = 2160 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 1619 gcaacggcaacggcaacggca 1639
>ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial mRNA Length = 2178 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 1869 caacggcaacggcaacggcaacggc 1893 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 1874 gcaacggcaacggcaacggc 1893 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 ||||| |||||||||||||| ||||||| Sbjct: 1863 caacgacaacggcaacggcaacggcaac 1890
>ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial mRNA Length = 2178 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 1869 caacggcaacggcaacggcaacggc 1893 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 1874 gcaacggcaacggcaacggc 1893 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 ||||| |||||||||||||| ||||||| Sbjct: 1863 caacgacaacggcaacggcaacggcaac 1890
>ref|XM_588554.2| PREDICTED: Bos taurus similar to nardilysin (N-arginine dibasic convertase) (LOC511254), partial mRNA Length = 3832 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 126 tcatcatcatcttcttcttcctcctcttc 98
>ref|XM_715743.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (CaO19_13864), mRNA Length = 2499 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 434 caacggcaacggcaacggcaacggc 458 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 439 gcaacggcaacggcaacggc 458
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 893839 gcaacggcaacggcaacggca 893819
>ref|XM_751657.1| Ustilago maydis 521 hypothetical protein (UM00603.1) partial mRNA Length = 1713 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| | ||||||| Sbjct: 1415 gcaacggcaacggcaacggaaacggcaac 1443
>ref|XM_752979.1| Ustilago maydis 521 hypothetical protein (UM01925.1) partial mRNA Length = 3153 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 1412 gcaacggcaacggcaacggca 1432
>ref|XM_755102.1| Ustilago maydis 521 hypothetical protein (UM04048.1) partial mRNA Length = 1890 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 1839 gcaacggcaacggcaacggca 1859
>ref|XM_750841.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g15990) partial mRNA Length = 456 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 221 gcaacggcaacggcaacggca 241 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 |||| |||||||||||||||| ||||||| Sbjct: 215 gcaatggcaacggcaacggcaacggcaac 243
>ref|XM_385837.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05661.1) partial mRNA Length = 2184 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 32 gcaacggcaacggcaacggca 52
>ref|XM_381644.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01468.1) partial mRNA Length = 1380 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||| ||||||||||||| ||||||| Sbjct: 944 gcaacggtaacggcaacggcaacggcaac 972
>ref|XM_380925.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00749.1) partial mRNA Length = 1500 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 gtctccttcttcctcctcttc 45 ||||||||||||||||||||| Sbjct: 447 gtctccttcttcctcctcttc 427
>ref|XM_883733.1| Candida albicans SC5314 hypothetical protein (CaJ7.0238) partial mRNA Length = 2499 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 434 caacggcaacggcaacggcaacggc 458 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 439 gcaacggcaacggcaacggc 458
>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034O04, complete sequence Length = 164882 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 110667 caacggcaacggcaacggcaacggc 110691 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 110672 gcaacggcaacggcaacggc 110691
>ref|XM_716256.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (TRL1) partial mRNA Length = 2499 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 434 caacggcaacggcaacggcaacggc 458 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 439 gcaacggcaacggcaacggc 458
>ref|XM_739061.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000223.04.0) partial mRNA Length = 1395 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 1061 tcatcatcatcttcttcttcctcctcttc 1033
>ref|XM_661959.1| Cryptosporidium hominis TU502 trehalose synthase (Chro.80565) partial mRNA Length = 4197 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 3283 tcatcatcttcttcttcttcctcctcttc 3311
>gb|AC166543.2| Nectria haematococca clone JGIAYWI-5I13, complete sequence Length = 40607 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 19892 gcaacggcaacggcaacggca 19912
>gb|AY379776.1| Medicago truncatula strain Jemalong A17 chromosome 5 clone MtH1-052O10, complete sequence Length = 61009 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 584 tttttctcccttttttcaaat 604 ||||||||||||||||||||| Sbjct: 45100 tttttctcccttttttcaaat 45080
>gb|AC123570.7| Medicago truncatula clone mth2-33l22, complete sequence Length = 95559 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 584 tttttctcccttttttcaaat 604 ||||||||||||||||||||| Sbjct: 57713 tttttctcccttttttcaaat 57693
>gb|AC147960.8| Medicago truncatula clone mth2-27f16, complete sequence Length = 53944 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 584 tttttctcccttttttcaaat 604 ||||||||||||||||||||| Sbjct: 26554 tttttctcccttttttcaaat 26574
>emb|AL445072.17| Human DNA sequence from clone RP11-13E5 on chromosome X Contains a novel gene, the gene for a novel protein similar to KIAA1892 and a CpG island, complete sequence Length = 134277 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 569 gttttcagttcagtatttttctccctttt 597 ||||||| ||| ||||||||||||||||| Sbjct: 60805 gttttcaattctgtatttttctccctttt 60833
>ref|XM_502461.1| Yarrowia lipolytica CLIB122, YALI0D05841g predicted mRNA Length = 2430 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 1559 gcaacggcaacggcaacggca 1579 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 1557 cggcaacggcaacggcaacggcaac 1581
>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence Length = 1471779 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 322 ctcgcaagccggcctgcgcgt 342 ||||||||||||||||||||| Sbjct: 8226 ctcgcaagccggcctgcgcgt 8206
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 4874139 gcaacggcaacggcaacggca 4874119 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 4874141 cggcaacggcaacggcaacggcaac 4874117
>emb|AL356796.16| Human DNA sequence from clone RP11-82I1 on chromosome 9 Contains the 3' end of a novel gene (FLJ11985, MGC11337) (KIAA0870), the ORM1 gene for orosomucoid 1 (AGP1, AGP-A), the ORM2 gene for orosomucoid 2 (AGP2, AGP-B) and the gene for AT-hook transcription factor AKNA, complete sequence Length = 125673 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 303 ccccatcaccagctcccccct 323 ||||||||||||||||||||| Sbjct: 60585 ccccatcaccagctcccccct 60605
>emb|AL355852.23| Human DNA sequence from clone RP11-403E24 on chromosome X Contains gene FLJ39827 and a CpG island, complete sequence Length = 128765 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttcg 46 ||||||||||||||||||||| Sbjct: 104652 tctccttcttcctcctcttcg 104672
>emb|Z30236.1|NPHALCYA N.pharaonis (SP1/28) gene for halocyanin Length = 620 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||||||||| | ||||||| Sbjct: 142 gcaacggcaacggcaacggtaacggcaac 170
>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13 Length = 349606 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 126578 cggcaacggcaacggcaccggcaac 126602
>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14 Length = 316050 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 137443 cggcaacggcaacggcaccggcaac 137467
>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5 Length = 72305 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 56677 caacggcaacggcaacggcaacggc 56701 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 56682 gcaacggcaacggcaacggc 56701 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggcaac 104 ||||| |||||||||||||| ||||||| Sbjct: 56671 caacgacaacggcaacggcaacggcaac 56698
>emb|AL353822.2|NC15E6 Neurospora crassa DNA linkage group V Cosmid contig 15E6 Length = 61843 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 56977 caacggcaacggcaacggcaacggc 56953 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 77 caacggcaacggcaacggcatcggcaac 104 ||||| |||||||||||||| ||||||| Sbjct: 56983 caacgacaacggcaacggcaacggcaac 56956 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 56972 gcaacggcaacggcaacggc 56953
>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2 Length = 197975 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 159597 tcatcatcatcttcttcttcctcctcttc 159569
>emb|AL591113.14| Mouse DNA sequence from clone RP23-253E9 on chromosome 11 Contains a phosphoglycerate mutase (Pgam) family pseudogene, a pseudogene similar to part of chondroitin sulfate proteoglycan 6 Cspg6, the gene for a novel protein similar to human DSCAM-interacting protein 1, a novel gene, the Crlf3 gene for cytokine receptor-like factor 3, the 5' end of a novel gene and a CpG island, complete sequence Length = 204106 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 584 tttttctcccttttttcaaatcgag 608 |||||||||||||||| |||||||| Sbjct: 61902 tttttctcccttttttgaaatcgag 61878
>gb|AY113171.1| Arabidopsis thaliana AT4g00830/A_TM018A10_14 mRNA, complete cds Length = 1488 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 128 tcatcatcatcttcttcttcctcctcttc 100
>ref|NM_143605.2| Drosophila melanogaster CG11339-RA (CG11339), mRNA Length = 3855 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 1013 gcaacggcaacggcaacggca 1033
>gb|AF367357.1| Arabidopsis thaliana AT4g00830/A_TM018A10_14 mRNA, complete cds Length = 1838 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 273 tcatcatcatcttcttcttcctcctcttc 245
>gb|AC090686.4| Homo sapiens chromosome 8, clone RP11-771F20, complete sequence Length = 197065 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 566 ttggttttcagttcagtatttttct 590 |||||||||||||||| |||||||| Sbjct: 5800 ttggttttcagttcagcatttttct 5776
>gb|DQ350712.1| Ajellomyces capsulatus nitrosative stress induced transcription 6 (NIT6) gene, partial sequence Length = 2995 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 2975 gcaacggcaacggcaacggca 2995
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 5900783 caacggcaacggcaacggcaacggc 5900807 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 gctgctgaaacctgcttcat 20 |||||||||||||||||||| Sbjct: 23866526 gctgctgaaacctgcttcat 23866545 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 5900788 gcaacggcaacggcaacggc 5900807
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 22761893 gcaacggcaacggcaacggca 22761873 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 22761895 cggcaacggcaacggcaacggcaac 22761871 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 18197372 gcaacggcaacggcaacggc 18197353
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 24172889 gcaacggcaacggcaacggca 24172869 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 24172891 cggcaacggcaacggcaacggcaac 24172867
>gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR02B19, complete sequence Length = 171286 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 9259 gcaacggcaacggcaacggca 9279 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 9258 ggcaacggcaacggcaacggcaac 9281
>gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR01C11, complete sequence Length = 176991 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 155630 gcaacggcaacggcaacggca 155650 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 155629 ggcaacggcaacggcaacggcaac 155652
>gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, region 100C-100C, BAC clone BACR02G16, complete sequence Length = 177480 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 10519 gcaacggcaacggcaacggca 10539
>emb|BX841533.1|CNS09YG2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZB05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 910 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 219 tcatcatcatcttcttcttcctcctcttc 191
>gb|L13380.1|YSATRNALIG Candida albicans transfer RNA ligase gene, complete cds Length = 2763 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 554 caacggcaacggcaacggcaacggc 578 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 559 gcaacggcaacggcaacggc 578
>dbj|AP004781.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0691E09 Length = 149859 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 2978 gcaacggcaacggcaacggca 2958 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 2980 cggcaacggcaacggcaacggcaac 2956
>dbj|AP003711.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0417G12 Length = 163568 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 106347 gcaacggcaacggcaacggca 106327 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 106349 cggcaacggcaacggcaacggcaac 106325
>dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1092_A07 Length = 137081 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 81235 gcaacggcaacggcaacggca 81215 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 81237 cggcaacggcaacggcaacggcaac 81213
>dbj|AK073403.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042F02, full insert sequence Length = 2138 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 914 gcaacggcaacggcaacggca 934 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 912 cggcaacggcaacggcaacggcaac 936
>gb|AC155266.2| Mus musculus BAC clone RP23-259L1 from 12, complete sequence Length = 186747 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 130 agactgtcactgagaagaagt 150 ||||||||||||||||||||| Sbjct: 166471 agactgtcactgagaagaagt 166491
>gb|AC007751.3|AC007751 Homo sapiens, clone 5_A_11, complete sequence Length = 158963 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 566 ttggttttcagttcagtatttttct 590 |||||||||||||||| |||||||| Sbjct: 37020 ttggttttcagttcagcatttttct 37044
>gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12 of 118 of the complete sequence Length = 301379 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 207039 gcaacggcaacggcaacggca 207059 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 207038 ggcaacggcaacggcaacggcaac 207061
>gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 115 of 118 of the complete sequence Length = 232290 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 225016 gcaacggcaacggcaacggca 225036
>dbj|AP006544.1| Homo sapiens genomic DNA, chromosome 8q22.3, clone: KB1575F09, complete sequence Length = 126600 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 566 ttggttttcagttcagtatttttct 590 |||||||||||||||| |||||||| Sbjct: 59337 ttggttttcagttcagcatttttct 59313
>gb|AC163271.4| Mus musculus chromosome 7, clone RP24-353E13, complete sequence Length = 131940 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 581 gtatttttctcccttttttca 601 ||||||||||||||||||||| Sbjct: 111784 gtatttttctcccttttttca 111764
>dbj|AK122342.1| Mus musculus mRNA for mKIAA0670 protein Length = 4370 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 670 tcatcatcatcttcttcttcctcctcttc 642
>gb|AY633955.1| Drosophila cardini strain Basse Pointe y protein (y) gene, partial cds Length = 663 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 154 caacggcaacggcaacggcaacggc 178 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 159 gcaacggcaacggcaacggc 178
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||| ||||||||||| ||||||| Sbjct: 2426735 gcaacggcaccggcaacggcaccggcaac 2426763 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||| ||||||||||| ||||||| Sbjct: 2426723 gcaacggcaccggcaacggcaccggcaac 2426751 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 72 ggctgcaacggcaacggcaacggcatcggcaac 104 ||||| |||||||||||||| |||| ||||||| Sbjct: 1924683 ggctgtaacggcaacggcaatggcaacggcaac 1924651 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 ||||||||||||| ||||||| ||||||| Sbjct: 382531 gcaacggcaacggaaacggcaccggcaac 382559 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 72 ggctgcaacggcaacggcaacggcatcggcaac 104 |||||||||||||| ||| |||||| ||||||| Sbjct: 382509 ggctgcaacggcaatggcgacggcaacggcaac 382541
>gb|AC101704.15| Mus musculus chromosome 15, clone RP23-249O20, complete sequence Length = 173276 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 gtctccttcttcctcctcttc 45 ||||||||||||||||||||| Sbjct: 97185 gtctccttcttcctcctcttc 97165
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 5967260 caacggcaacggcaacggcaacggc 5967284 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 gctgctgaaacctgcttcat 20 |||||||||||||||||||| Sbjct: 24178195 gctgctgaaacctgcttcat 24178214 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 5967265 gcaacggcaacggcaacggc 5967284
>gb|AC132325.4| Mus musculus BAC clone RP24-273K21 from chromosome 12, complete sequence Length = 152661 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttcg 46 ||||||||||||||||||||| Sbjct: 38379 tctccttcttcctcctcttcg 38359
>gb|AC130474.12| Mus musculus chromosome 7, clone RP23-178C20, complete sequence Length = 232792 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttcg 46 ||||||||||||||||||||| Sbjct: 49546 tctccttcttcctcctcttcg 49566
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1145 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 135 caacggcaacggcaacggcaacggc 159 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 140 gcaacggcaacggcaacggc 159
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1222 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1209 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1463 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 130 caacggcaacggcaacggcaacggc 154 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 135 gcaacggcaacggcaacggc 154
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1464 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 130 caacggcaacggcaacggcaacggc 154 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 135 gcaacggcaacggcaacggc 154
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1434 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1153 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1206 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 140 caacggcaacggcaacggcaacggc 164 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 145 gcaacggcaacggcaacggc 164
>gb|AC134330.3| Mus musculus BAC clone RP24-311K19 from 7, complete sequence Length = 142053 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 581 gtatttttctcccttttttca 601 ||||||||||||||||||||| Sbjct: 127072 gtatttttctcccttttttca 127052
>gb|AC133083.3| Mus musculus BAC clone RP24-342G5 from 12, complete sequence Length = 191265 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 130 agactgtcactgagaagaagt 150 ||||||||||||||||||||| Sbjct: 146065 agactgtcactgagaagaagt 146045
>gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10 Length = 106184 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 17 tcatcatcgtctccttcttcctcctcttc 45 |||||||| ||| |||||||||||||||| Sbjct: 74968 tcatcatcatcttcttcttcctcctcttc 74996
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 4032495 gcaacggcaacggcaacggca 4032515 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 ggcaacggcaacggcatcggcaac 104 |||||||||||||||| ||||||| Sbjct: 4032494 ggcaacggcaacggcaacggcaac 4032517
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggca 96 ||||||||||||||||||||| Sbjct: 750763 gcaacggcaacggcaacggca 750743 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 cggcaacggcaacggcatcggcaac 104 ||||||||||||||||| ||||||| Sbjct: 750765 cggcaacggcaacggcaacggcaac 750741
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggcatcggc 101 |||||||||||||||||||| |||| Sbjct: 458660 caacggcaacggcaacggcaacggc 458684 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 458665 gcaacggcaacggcaacggc 458684
>dbj|AP004939.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT17M09, TM0105, complete sequence Length = 127990 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttcg 46 ||||||||||||||||||||| Sbjct: 98066 tctccttcttcctcctcttcg 98086
>gb|AC152981.2| Mus musculus 10 BAC RP23-154M15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 200104 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaac 104 |||||||||||||| |||||| ||||||| Sbjct: 84235 gcaacggcaacggcgacggcaacggcaac 84263
>gb|M21540.1|HUMA1GLY2 Human alpha-1-acid glycoprotein 2 (AGP2) gene, complete cds Length = 4944 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 303 ccccatcaccagctcccccct 323 ||||||||||||||||||||| Sbjct: 2108 ccccatcaccagctcccccct 2128
>dbj|AB073375.1| Ciona savignyi mRNA for Cs-ETR1, partial cds Length = 1083 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 570 ttttcagttcagtatttttctcccttttt 598 |||| ||||||||||||||||| |||||| Sbjct: 483 tttttagttcagtatttttctcgcttttt 511
>ref|NM_124080.2| Arabidopsis thaliana unknown protein AT5G47090 mRNA, complete cds Length = 1224 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 14 gcttcatcatcgtctccttcttcctcctcttc 45 ||||| ||||| ||| |||||||||||||||| Sbjct: 692 gcttcttcatcttcttcttcttcctcctcttc 661
>gb|BC083685.1| Rattus norvegicus similar to RIKEN cDNA 5430437P03, mRNA (cDNA clone MGC:94542 IMAGE:7189038), complete cds Length = 1368 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 247 tctccttcttcctcctcttc 228
>ref|XM_632348.1| Dictyostelium discoideum hypothetical protein (DDB0218881), partial mRNA Length = 984 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 18 catcatcgtctccttcttcctcctcttc 45 ||||||| ||| |||||||||||||||| Sbjct: 200 catcatcatcttcttcttcctcctcttc 227
>gb|AY398358.1| Danio rerio clone RK074A1B06 high-mobility group box 1 (HMGB1) mRNA, complete cds Length = 1422 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttcctcctcttcg 46 ||||||||||||| |||| |||||||||||| Sbjct: 801 cttcatcatcgtcatcttcgtcctcctcttcg 770
>ref|XM_639882.1| Dictyostelium discoideum hypothetical protein (DDB0231200), partial mRNA Length = 2439 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 17 tcatcatcgtctccttcttcctcctctt 44 |||||||| ||| ||||||||||||||| Sbjct: 2260 tcatcatcatcttcttcttcctcctctt 2287
>gb|AC152104.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A2, complete sequence Length = 37168 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 15 cttcatcatcgtctccttcttcctcctcttcg 46 |||||||||| || ||||||||||||||||| Sbjct: 5205 cttcatcatcctcgtcttcttcctcctcttcg 5236
>ref|NM_192679.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1461 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 407 gcaacggcaacggcaacggc 426
>ref|XM_478172.1| Oryza sativa (japonica cultivar-group), mRNA Length = 817 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 175 gcaacggcaacggcaacggc 156
>gb|AC138334.11| Mus musculus chromosome 7, clone RP23-306H5, complete sequence Length = 177803 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 tcatcgtctccttcttcctcctct 43 ||||||||||||||||||| |||| Sbjct: 71289 tcatcgtctccttcttccttctct 71312
>gb|AC101933.8| Mus musculus chromosome 7, clone RP24-70M5, complete sequence Length = 205123 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 45222 tctccttcttcctcctcttc 45203
>gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosome 1, complete sequence Length = 212447 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 187627 tctccttcttcctcctcttc 187646
>gb|AC102152.12| Mus musculus chromosome 7, clone RP23-314H9, complete sequence Length = 206923 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 138674 tctccttcttcctcctcttc 138693
>gb|AC150573.4| Bos taurus BAC CH240-238N22 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 163445 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 caaagaagcctctgatttca 185 |||||||||||||||||||| Sbjct: 39269 caaagaagcctctgatttca 39288
>gb|AY685231.1| Neurospora crassa F-box/WD-40 repeat-containing protein (fwd-1) mRNA, complete cds Length = 3033 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2677 gcaacggcaacggcaacggc 2696
>gb|AC135557.5| Oryza sativa chromosome 3 BAC OJ1285_H07 genomic sequence, complete sequence Length = 113685 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 581 gtatttttctcccttttttc 600 |||||||||||||||||||| Sbjct: 1064 gtatttttctcccttttttc 1083
>ref|XM_323892.1| Neurospora crassa OR74A hypothetical protein (NCU04540.1) partial mRNA Length = 3033 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2677 gcaacggcaacggcaacggc 2696
>ref|XM_367042.1| Magnaporthe grisea 70-15 chromosome V hypothetical protein (MG10672.4) partial mRNA Length = 2118 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaa 103 ||||||||| ||||||||||| |||||| Sbjct: 344 gcaacggcagcggcaacggcagcggcaa 371
>ref|XM_363683.1| Magnaporthe grisea 70-15 hypothetical protein (MG01609.4) partial mRNA Length = 549 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcggcaactcg 107 ||||||||||||||||| ||| ||| |||||| Sbjct: 374 gcaacggcaacggcaacagcaacggaaactcg 405
>ref|XM_422040.1| PREDICTED: Gallus gallus similar to anion exchanger 3 brain isoform (LOC424194), mRNA Length = 3750 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 443 tctccttcttcctcctcttc 424
>ref|XM_425978.1| PREDICTED: Gallus gallus similar to CG11212-PA (LOC428417), mRNA Length = 2895 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 cgcctcggccatggggcagc 129 |||||||||||||||||||| Sbjct: 369 cgcctcggccatggggcagc 388
>ref|XM_456531.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A04840g) partial mRNA Length = 1362 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 aagcaagctgcaagcaacaa 253 |||||||||||||||||||| Sbjct: 970 aagcaagctgcaagcaacaa 989
>gb|AC107206.4| Oryza sativa chromosome 3 BAC OSJNBa0063J18 genomic sequence, complete sequence Length = 154558 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 581 gtatttttctcccttttttc 600 |||||||||||||||||||| Sbjct: 2743 gtatttttctcccttttttc 2724
>gb|AC124353.5| Mus musculus BAC clone RP24-481I14 from chromosome 12, complete sequence Length = 152881 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 104044 tctccttcttcctcctcttc 104063
>gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome 18, complete sequence Length = 169195 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 107632 tctccttcttcctcctcttc 107651
>gb|AC135361.3| Mus musculus BAC clone RP23-216A21 from chromosome 14, complete sequence Length = 203946 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 39292 tctccttcttcctcctcttc 39311
>gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence Length = 103167 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 74 ctgcaacggcaacggcaacg 93 |||||||||||||||||||| Sbjct: 28195 ctgcaacggcaacggcaacg 28214
>ref|XM_950887.1| Neurospora crassa OR74A hypothetical protein (NCU04540.1) partial mRNA Length = 3033 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2677 gcaacggcaacggcaacggc 2696
>ref|XM_954186.1| Neurospora crassa OR74A hypothetical protein (NCU08189.1) partial mRNA Length = 1155 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 62 gcaacggcaacggcaacggc 81
>ref|XM_956291.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1) partial mRNA Length = 699 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 179 gcaacggcaacggcaacggc 198 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggc 101 ||||||||||||||||||| |||| Sbjct: 175 aacggcaacggcaacggcaacggc 198
>ref|XM_957135.1| Neurospora crassa OR74A hypothetical protein (NCU06390.1) partial mRNA Length = 1977 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 1888 gcaacggcaacggcaacggc 1907
>ref|XM_326244.1| Neurospora crassa OR74A hypothetical protein (NCU06390.1) partial mRNA Length = 1977 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 1888 gcaacggcaacggcaacggc 1907
>ref|XM_326790.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1) partial mRNA Length = 699 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 179 gcaacggcaacggcaacggc 198 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 aacggcaacggcaacggcatcggc 101 ||||||||||||||||||| |||| Sbjct: 175 aacggcaacggcaacggcaacggc 198
>gb|AC110133.5| Rattus norvegicus 3 BAC CH230-40N24 (Children's Hospital Oakland Research Institute) complete sequence Length = 32052 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 10979 tctccttcttcctcctcttc 10960
>gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, complete sequence Length = 181750 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 agctggttgcttatgtgtta 441 |||||||||||||||||||| Sbjct: 117537 agctggttgcttatgtgtta 117518
>ref|XM_328894.1| Neurospora crassa OR74A hypothetical protein (NCU08189.1) partial mRNA Length = 1155 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 62 gcaacggcaacggcaacggc 81
>gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, complete sequence Length = 236143 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 4266 tctccttcttcctcctcttc 4247
>gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome 13, complete sequence Length = 218640 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 147358 tctccttcttcctcctcttc 147377
>gb|AC079956.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-106D2, complete sequence Length = 183441 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 17 tcatcatcgtctccttcttcctcc 40 ||||||| |||||||||||||||| Sbjct: 53746 tcatcatggtctccttcttcctcc 53723
>gb|AY812154.1| Schistosoma japonicum SJCHGC03940 protein mRNA, partial cds Length = 461 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttcctcctc 42 ||||||| |||||| ||||||||||||| Sbjct: 409 cttcatcttcgtcttcttcttcctcctc 382
>ref|NM_001006964.1| Rattus norvegicus similar to RIKEN cDNA 5430437P03 (MGC94542), mRNA Length = 1368 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 247 tctccttcttcctcctcttc 228
>gb|AY190956.1| Drosophila virilis clone DVIF01_06_H02 (D1438) genomic sequence Length = 46427 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggcatcg 99 ||||||||||| |||||||||||| Sbjct: 4901 gcaacggcaacagcaacggcatcg 4924 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 73 gctgcaacggcaacggcaacggca 96 |||||||| ||||||||||||||| Sbjct: 437 gctgcaactgcaacggcaacggca 460
>gb|AY190943.1| Drosophila virilis clone DVIF01_25_B23 (D1415) genomic sequence Length = 35983 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 gctgcaacggcaacggcaac 92 |||||||||||||||||||| Sbjct: 8052 gctgcaacggcaacggcaac 8071
>ref|XM_846664.1| PREDICTED: Canis familiaris similar to translocation protein 1 (LOC609416), mRNA Length = 2854 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 18 catcatcgtctccttcttcctcctcttc 45 |||||| |||| |||||||||||||||| Sbjct: 1387 catcattgtcttcttcttcctcctcttc 1360
>gb|AC102668.12| Mus musculus chromosome 6, clone RP23-296I18, complete sequence Length = 186488 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 47500 tctccttcttcctcctcttc 47481
>ref|XM_853376.1| PREDICTED: Canis familiaris similar to translocation protein 1, transcript variant 2 (LOC485507), mRNA Length = 1404 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 18 catcatcgtctccttcttcctcctcttc 45 |||||| |||| |||||||||||||||| Sbjct: 1184 catcattgtcttcttcttcctcctcttc 1157
>ref|XM_844216.1| PREDICTED: Canis familiaris similar to translocation protein 1, transcript variant 1 (LOC485507), mRNA Length = 1348 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 18 catcatcgtctccttcttcctcctcttc 45 |||||| |||| |||||||||||||||| Sbjct: 1184 catcattgtcttcttcttcctcctcttc 1157
>ref|XM_751684.1| Ustilago maydis 521 hypothetical protein (UM00630.1) partial mRNA Length = 2568 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 2156 gcaacggcaacggcaacggc 2175
>ref|XM_755134.1| Ustilago maydis 521 hypothetical protein (UM04080.1) partial mRNA Length = 2019 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcaacggcaacggcaacggc 95 |||||||||||||||||||| Sbjct: 224 gcaacggcaacggcaacggc 243
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 tgcaacggcaacggcaacgg 94 |||||||||||||||||||| Sbjct: 3799013 tgcaacggcaacggcaacgg 3799032
>ref|XM_817510.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.70.3880) partial mRNA Length = 681 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 71 tggctgcaacggcaacggcaacggcatcggca 102 |||| ||| ||||||||||||||||| ||||| Sbjct: 533 tggcggcagcggcaacggcaacggcagcggca 564
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 299 gacgccccatcaccagctcccccctcgc 326 ||||||||||||||||| ||||| |||| Sbjct: 1260411 gacgccccatcaccagcacccccatcgc 1260438
>ref|XM_386525.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06349.1) partial mRNA Length = 1197 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 824 tctccttcttcctcctcttc 805
>ref|XM_810047.1| Trypanosoma cruzi strain CL Brener rac serine-threonine kinase (Tc00.1047053508965.60) partial mRNA Length = 2118 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggca 96 |||||||||||||||||||| Sbjct: 63 caacggcaacggcaacggca 82
>gb|AC124681.3| Mus musculus BAC clone RP24-261H7 from chromosome 16, complete sequence Length = 173837 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 94391 tctccttcttcctcctcttc 94410
>gb|AC123047.3| Mus musculus BAC clone RP24-378B22 from chromosome 7, complete sequence Length = 157795 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttgcttatgtgttaggagtc 447 |||||||||||||||||||| Sbjct: 54900 ttgcttatgtgttaggagtc 54881
>ref|XM_812330.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507809.100) partial mRNA Length = 4845 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 3986 tctccttcttcctcctcttc 3967
>ref|XM_815859.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053511283.260) partial mRNA Length = 6162 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 1835 tctccttcttcctcctcttc 1816
>gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, complete sequence Length = 192100 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 158587 tctccttcttcctcctcttc 158606
>emb|CR728378.1|CNS0GOYO Tetraodon nigroviridis full-length cDNA Length = 2047 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttcctcctc 42 |||||||||| ||||||||||| ||||| Sbjct: 639 cttcatcatcctctccttcttcttcctc 612
>emb|CR720125.1|CNS0GILF Tetraodon nigroviridis full-length cDNA Length = 1061 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 15 cttcatcatcgtctccttcttcctcctc 42 |||||||||| ||||||||||| ||||| Sbjct: 655 cttcatcatcctctccttcttcttcctc 628
>gb|AC149303.10| Medicago truncatula clone mth2-76a20, complete sequence Length = 141028 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 584 tttttctcccttttttcaaa 603 |||||||||||||||||||| Sbjct: 77164 tttttctcccttttttcaaa 77183
>gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Hospital Oakland Research Institute) complete sequence Length = 293757 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tctccttcttcctcctcttc 45 |||||||||||||||||||| Sbjct: 160980 tctccttcttcctcctcttc 160961
>gb|BT025066.1| Drosophila melanogaster IP15614 full insert cDNA Length = 1426 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 caacggcaacggcaacggca 96 |||||||||||||||||||| Sbjct: 148 caacggcaacggcaacggca 167 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,584,375 Number of Sequences: 3902068 Number of extensions: 5584375 Number of successful extensions: 158409 Number of sequences better than 10.0: 347 Number of HSP's better than 10.0 without gapping: 357 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 154030 Number of HSP's gapped (non-prelim): 4169 length of query: 656 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 633 effective length of database: 17,143,297,704 effective search space: 10851707446632 effective search space used: 10851707446632 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
