Clone Name	baal34o07
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|AJ298877.1|OSA298877 Oryza sativa cry2 gene for cryptochrome 2	414	e-112
2	ref|XM_466830.1| Oryza sativa (japonica cultivar-group), mRNA	398	e-108
3	ref|XM_466829.1| Oryza sativa (japonica cultivar-group), mRNA	398	e-108
4	ref|XM_506872.1| PREDICTED Oryza sativa (japonica cultivar-group...	398	e-108
5	dbj|AK099334.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
6	dbj|AK068394.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
7	dbj|AK065669.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
8	dbj|AB103094.1| Oryza sativa (japonica cultivar-group) OsCRY2 mR...	398	e-108
9	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	246	8e-62
10	emb|AJ490523.1|OSA490523 Oryza sativa (indica cultivar-group) cr...	246	8e-62
11	dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic D...	246	8e-62
12	dbj|AB028930.1| Adiantum capillus-veneris CRY4 gene for blue lig...	54	6e-04
13	dbj|AB028928.1| Adiantum capillus-veneris CRY4 mRNA for blue lig...	54	6e-04
14	gb|AY835380.1| Sorghum bicolor cryptochrome 2 gene, complete cds	46	0.15
15	gb|DQ231577.1| Nicotiana sylvestris cryptochrome 2 (cry2) mRNA, ...	46	0.15
16	ref|XM_472681.1| Oryza sativa (japonica cultivar-group), predic...	46	0.15
17	gb|AF545572.1| Sorghum bicolor cryptochrome 2 apoprotein (cry2) ...	46	0.15
18	emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4,...	46	0.15
19	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.15
20	dbj|AK072182.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.15
21	dbj|AB073547.2| Oryza sativa (japonica cultivar-group) OsCRY1b m...	46	0.15
22	ref|NM_025795.2| Mus musculus DNA segment, Chr 15, ERATO Doi 785...	44	0.57
23	gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, c...	44	0.57
24	gb|BC019554.1| Mus musculus endothelial cell growth factor 1 (pl...	44	0.57
25	ref|NM_138302.1| Mus musculus endothelial cell growth factor 1 (...	44	0.57
26	dbj|AK146642.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu...	44	0.57
27	dbj|AK013765.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	44	0.57
28	dbj|AK083981.1| Mus musculus 12 days embryo spinal ganglion cDNA...	44	0.57
29	dbj|AK002487.1| Mus musculus adult male kidney cDNA, RIKEN full-...	44	0.57
30	dbj|AK031135.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN...	44	0.57
31	dbj|AK085584.1| Mus musculus 0 day neonate kidney cDNA, RIKEN fu...	44	0.57
32	dbj|AK219815.1| Mus musculus cDNA, clone:Y2G0149L15, strand:minu...	44	0.57
33	dbj|AK186876.1| Mus musculus cDNA, clone:Y0G0139B09, strand:minu...	44	0.57
34	gb|AC137513.3| Mus musculus BAC clone RP24-460O22 from 15, compl...	44	0.57
35	dbj|AB060274.1| Mus musculus mRNA for thymidine phosphorylase, c...	44	0.57
36	gb|DQ201154.1| Hordeum vulgare subsp. vulgare cultivar Kompolti ...	42	2.3
37	gb|DQ201153.1| Hordeum vulgare subsp. vulgare cultivar Morex cry...	42	2.3
38	gb|DQ201152.1| Hordeum vulgare subsp. vulgare cultivar Dicktoo c...	42	2.3
39	gb|AC084423.1|AC084423 Caenorhabditis briggsae cosmid CB020D11, ...	42	2.3
40	gb|AY508973.1| Pisum sativum cultivar Torsdag cryptochrome 2A ap...	40	9.0
41	gb|AY705912.1| Zea mays cytotype NA hypothetical protein genes, ...	40	9.0
42	gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome	40	9.0
43	gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence	40	9.0
44	gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence	40	9.0
45	gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...	40	9.0
46	ref|XM_361526.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	9.0
47	gb|AC123654.9| Mus musculus chromosome 15, clone RP23-161D16, co...	40	9.0
48	gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge...	40	9.0
49	gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit...	40	9.0
50	gb|AC120888.2| Oryza sativa (japonica cultivar-group) chromosome...	40	9.0
51	gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion...	40	9.0
52	gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete ...	40	9.0
53	gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion...	40	9.0
54	gb|AY727930.1| Cornus sericea 26S ribosomal RNA gene, partial se...	40	9.0
55	gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia regio...	40	9.0
56	gb|AY161311.1| Pisum sativum cryptochrome 2A (CRY2A) mRNA, parti...	40	9.0
57	gb|AY260020.1| Grubbia tomentosa 26S ribosomal RNA gene, complet...	40	9.0
58	gb|AY260017.1| Mastixia eugenioides 26S ribosomal RNA gene, comp...	40	9.0
59	gb|AY260016.1| Mastixia pentandra 26S ribosomal RNA gene, comple...	40	9.0
60	gb|AY260015.1| Mastixia caudatilimba 26S ribosomal RNA gene, com...	40	9.0
61	gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete...	40	9.0
62	gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complet...	40	9.0
63	emb|AL354763.17| Human DNA sequence from clone RP11-357L1 on chr...	40	9.0
64	emb|CR555306.1| Azoarcus sp. EbN1 complete genome	40	9.0
65	emb|AJ621744.1| Gallus gallus gene for hypothetical protein, BAC...	40	9.0
66	dbj|AK148815.1| Mus musculus 2 days neonate sympathetic ganglion...	40	9.0
67	gb|AY935821.1| Rinorea pubiflora isolate 31 26S ribosomal RNA ge...	40	9.0
68	gb|AY935820.1| Prunus persica isolate 30 26S ribosomal RNA gene,...	40	9.0
69	gb|AF297539.1|AF297539 Cornus oblonga 26S ribosomal RNA gene, pa...	40	9.0
70	gb|AF297538.1|AF297538 Cornus racemosa 26S ribosomal RNA gene, p...	40	9.0
71	gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, part...	40	9.0
72	gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	40	9.0
73	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.0
74	gb|AC110758.3| Homo sapiens BAC clone RP11-24D11 from 4, complet...	40	9.0
75	gb|AF479163.1| Cornus officinalis 26S ribosomal RNA gene, comple...	40	9.0
76	gb|AF479119.1| Chrysobalanus icaco 26S ribosomal RNA gene, parti...	40	9.0
77	gb|AF479103.1| Spiraea betulifolia 26S ribosomal RNA gene, compl...	40	9.0
78	gb|AF479101.1| Photinia fraseri 26S ribosomal RNA gene, complete...	40	9.0
79	gb|AE009527.1| Brucella melitensis 16M chromosome I, section 84 ...	40	9.0
80	gb|AC138336.3| Homo sapiens chromosome 17, clone CTC-386K3, comp...	40	9.0
81	gb|AC138146.4| Homo sapiens chromosome 17, clone RP11-1143J18, c...	40	9.0
82	gb|AF130425.1|AF130425 Lycopersicon esculentum cryptochrome 2 mR...	40	9.0
83	gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	40	9.0
84	emb|BX088540.6| Zebrafish DNA sequence from clone CH211-225B7 in...	40	9.0
85	gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com...	40	9.0
86	emb|X06380.1|MIZMR1A Maize mitochondrial DNA for 5kB alpha-R1 re...	40	9.0
87	emb|X06379.1|MIZMR2B Maize mitochondrial DNA for 5kB beta-R2 repeat	40	9.0
88	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	9.0
89	gb|AC134555.4| Mus musculus BAC clone RP24-320K4 from 17, comple...	40	9.0
90	emb|CT033782.5| Mouse DNA sequence from clone RP23-39B12 on chro...	40	9.0
91	emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,...	40	9.0
92	emb|X58118.1|FA26SRN F.ananassa 26s rRNA gene	40	9.0
93	gb|AY508972.1| Pisum sativum cultivar Torsdag cryptochrome 2A ap...	40	9.0
94	emb|AL359381.8| Mouse DNA sequence from clone CT7-87K14 on chrom...	40	9.0

---

>emb|AJ298877.1|OSA298877 Oryza sativa cry2 gene for cryptochrome 2
          Length = 2477

 Score =  414 bits (209), Expect = e-112
 Identities = 437/513 (85%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 281 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 340

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | ||||||||||| || ||||||||||  |||||||||||||||||||||||||| || |
Sbjct: 341 cgttggccgccgcggcgagggacggcgttgtgctccctgtcttcatatggtgccctgcgg 400

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 401 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 460

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 461 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 520

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 521 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 580

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 581 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 640

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 641 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 700

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 701 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 760

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| || |||||||| || ||||| |||||||
Sbjct: 761 ctattgacatatcaccgtcacttgcaccttgga 793



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 624 ttgataacctaggtcttgaatcaagtaaggatg 656
           ||||| ||||||| ||||||||||| |||||||
Sbjct: 839 ttgatgacctaggacttgaatcaagcaaggatg 871

---

>ref|XM_466830.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2604

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 428 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 487

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 488 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 547

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 548 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 607

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 608 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 667

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 668 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 727

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 728 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 787

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 788 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 847

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 848 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 907

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 908 ctattgacgcatcaccgtcacttgcaccttgga 940



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 986  ttgatgacctaggacttgaatcaagcaaggatg 1018

---

>ref|XM_466829.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2549

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 429 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 488

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 489 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 548

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 549 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 608

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 609 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 668

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 669 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 728

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 729 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 788

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 789 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 848

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 849 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 908

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 909 ctattgacgcatcaccgtcacttgcaccttgga 941



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 987  ttgatgacctaggacttgaatcaagcaaggatg 1019

---

>ref|XM_506872.1| PREDICTED Oryza sativa (japonica cultivar-group), B1215B07.27-1
           mRNA
          Length = 2620

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 442 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 501

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 502 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 561

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 562 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 621

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 622 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 681

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 682 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 741

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 742 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 801

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 802 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 861

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 862 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 921

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 922 ctattgacgcatcaccgtcacttgcaccttgga 954



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 1000 ttgatgacctaggacttgaatcaagcaaggatg 1032

---

>dbj|AK099334.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033020H02, full
           insert sequence
          Length = 2548

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 428 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 487

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 488 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 547

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 548 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 607

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 608 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 667

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 668 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 727

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 728 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 787

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 788 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 847

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 848 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 907

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 908 ctattgacgcatcaccgtcacttgcaccttgga 940



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 986  ttgatgacctaggacttgaatcaagcaaggatg 1018

---

>dbj|AK068394.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013149M17, full
           insert sequence
          Length = 2604

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 428 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 487

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 488 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 547

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 548 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 607

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 608 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 667

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 668 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 727

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 728 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 787

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 788 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 847

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 848 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 907

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 908 ctattgacgcatcaccgtcacttgcaccttgga 940



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 986  ttgatgacctaggacttgaatcaagcaaggatg 1018

---

>dbj|AK065669.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013042O16, full
           insert sequence
          Length = 2620

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 442 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 501

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 502 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 561

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 562 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 621

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 622 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 681

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 682 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 741

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 742 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 801

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 802 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 861

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 862 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 921

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 922 ctattgacgcatcaccgtcacttgcaccttgga 954



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 1000 ttgatgacctaggacttgaatcaagcaaggatg 1032

---

>dbj|AB103094.1| Oryza sativa (japonica cultivar-group) OsCRY2 mRNA for cryptochrome
           2, complete cds
          Length = 2184

 Score =  398 bits (201), Expect = e-108
 Identities = 435/513 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
           |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 71  ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 130

                                                                       
Query: 143 ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
           | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 131 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 190

                                                                       
Query: 203 aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
           | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 191 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 250

                                                                       
Query: 263 accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
           ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 251 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 310

                                                                       
Query: 323 ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
           | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 311 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 370

                                                                       
Query: 383 atctatacgaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggcc 442
           |||| || |||||| |||| |||||||| ||||||||||| || || ||||||| ||  |
Sbjct: 371 atctgtatgaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcac 430

                                                                       
Query: 443 ttggaatttctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatg 502
           | |||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 431 tgggaatttccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatg 490

                                                                       
Query: 503 atgagaatgggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgc 562
           |||| | ||| |||||||||||||| || || ||||| ||||| || ||||||||||| |
Sbjct: 491 atgatagtggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattac 550

                                            
Query: 563 ctatcgaaatatcaccatcccttgccccttgga 595
           |||| ||   |||||| || ||||| |||||||
Sbjct: 551 ctattgacgcatcaccgtcacttgcaccttgga 583



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 624 ttgataacctaggtcttgaatcaagtaaggatg 656
           ||||| ||||||| ||||||||||| |||||||
Sbjct: 629 ttgatgacctaggacttgaatcaagcaaggatg 661

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  246 bits (124), Expect = 8e-62
 Identities = 259/304 (85%)
 Strand = Plus / Plus

                                                                            
Query: 83       ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
                |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 24934921 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 24934980

                                                                            
Query: 143      ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
                | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 24934981 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 24935040

                                                                            
Query: 203      aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
                | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 24935041 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 24935100

                                                                            
Query: 263      accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
                ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 24935101 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 24935160

                                                                            
Query: 323      ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
                | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 24935161 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 24935220

                    
Query: 383      atct 386
                ||||
Sbjct: 24935221 atct 24935224



 Score =  161 bits (81), Expect = 4e-36
 Identities = 174/205 (84%)
 Strand = Plus / Plus

                                                                            
Query: 391      gaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggccttggaatt 450
                |||||| |||| |||||||| ||||||||||| || || ||||||| ||  || ||||||
Sbjct: 24936386 gaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcactgggaatt 24936445

                                                                            
Query: 451      tctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatgatgagaat 510
                || || |||||||| |||||||||||||| |||||||||||||||||||||||||| | |
Sbjct: 24936446 tccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatgatgatagt 24936505

                                                                            
Query: 511      gggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgcctatcgaa 570
                || |||||||||||||| || || ||||| ||||| || ||||||||||| ||||| || 
Sbjct: 24936506 ggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattacctattgac 24936565

                                         
Query: 571      atatcaccatcccttgccccttgga 595
                  |||||| || ||||| |||||||
Sbjct: 24936566 gcatcaccgtcacttgcaccttgga 24936590



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                 
Query: 624      ttgataacctaggtcttgaatcaagtaaggatg 656
                ||||| ||||||| ||||||||||| |||||||
Sbjct: 24936903 ttgatgacctaggacttgaatcaagcaaggatg 24936935

---

>emb|AJ490523.1|OSA490523 Oryza sativa (indica cultivar-group) cry 2 gene for cryptochrome 2,
            exons 1-6
          Length = 8001

 Score =  246 bits (124), Expect = 8e-62
 Identities = 259/304 (85%)
 Strand = Plus / Plus

                                                                        
Query: 83   ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
            |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 1996 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 2055

                                                                        
Query: 143  ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
            | ||||||||||| || ||||||||||  |||||||||||||||||||||||||| || |
Sbjct: 2056 cgttggccgccgcggcgagggacggcgttgtgctccctgtcttcatatggtgccctgcgg 2115

                                                                        
Query: 203  aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
            | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 2116 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 2175

                                                                        
Query: 263  accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
            ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 2176 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 2235

                                                                        
Query: 323  ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
            | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 2236 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 2295

                
Query: 383  atct 386
            ||||
Sbjct: 2296 atct 2299



 Score =  176 bits (89), Expect = 6e-41
 Identities = 176/205 (85%)
 Strand = Plus / Plus

                                                                        
Query: 391  gaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggccttggaatt 450
            |||||| |||| |||||||| ||||||||||| || || ||||||| ||  || ||||||
Sbjct: 3458 gaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcactgggaatt 3517

                                                                        
Query: 451  tctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatgatgagaat 510
            || || |||||||| |||||||||||||| |||||||||||||||||||||||||| | |
Sbjct: 3518 tccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatgatgatagt 3577

                                                                        
Query: 511  gggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgcctatcgaa 570
            || |||||||||||||| || || ||||| ||||| || ||||||||||| ||||| || 
Sbjct: 3578 ggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattacctattgac 3637

                                     
Query: 571  atatcaccatcccttgccccttgga 595
            |||||||| || ||||| |||||||
Sbjct: 3638 atatcaccgtcacttgcaccttgga 3662



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 624  ttgataacctaggtcttgaatcaagtaaggatg 656
            ||||| ||||||| ||||||||||| |||||||
Sbjct: 3975 ttgatgacctaggacttgaatcaagcaaggatg 4007

---

>dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1215B07
          Length = 165957

 Score =  246 bits (124), Expect = 8e-62
 Identities = 259/304 (85%)
 Strand = Plus / Plus

                                                                         
Query: 83    ccggctcggagaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccgg 142
             |||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||||
Sbjct: 96204 ccggttcggagaggaccgtggtttggttcaggagggacctcaggatcgacgacaacccgg 96263

                                                                         
Query: 143   ctttggccgccgccgcaagggacggcgcggtgctccctgtcttcatatggtgcccggccg 202
             | |||||| |||| || ||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 96264 cgttggcctccgcggcgagggacggcgctgtgctccctgtcttcatatggtgccctgcgg 96323

                                                                         
Query: 203   aggaaggccgcttctaccccggccgctgctcccggtggtggctcaaggagtcgcttgccc 262
             | ||||| |  ||||| |||||||| |||||| |||||||||||||| |||||||  |||
Sbjct: 96324 atgaagggcagttctatcccggccggtgctccaggtggtggctcaagcagtcgctccccc 96383

                                                                         
Query: 263   accttgccaagtcgctcgaggcgctcggctgcccgctcgtgctcatccgagctcagacta 322
             ||||   | |||| || ||| ||||||| |||||||||||||| ||||||||  ||| ||
Sbjct: 96384 acctcagccagtcactggagtcgctcgggtgcccgctcgtgctgatccgagccgagagta 96443

                                                                         
Query: 323   ctcttgacgcgcttctgcagtgcgtccattccatccgcgccaccagagtggtctataatc 382
             | ||||| || ||||||| |||| |  ||||  || ||||||||||| |||| |||||||
Sbjct: 96444 cccttgaggctcttctgcggtgcattgattctgtcggcgccaccagattggtttataatc 96503

                 
Query: 383   atct 386
             ||||
Sbjct: 96504 atct 96507



 Score =  161 bits (81), Expect = 4e-36
 Identities = 174/205 (84%)
 Strand = Plus / Plus

                                                                         
Query: 391   gaccctatttcacttgtgcgggatgacaaaatcaagaatgagcttttgggccttggaatt 450
             |||||| |||| |||||||| ||||||||||| || || ||||||| ||  || ||||||
Sbjct: 97669 gaccctgtttctcttgtgcgtgatgacaaaataaaaaaagagctttcggcactgggaatt 97728

                                                                         
Query: 451   tctatgcagagtttcaatggtgatctgctatatgagccatgggaaatttatgatgagaat 510
             || || |||||||| |||||||||||||| |||||||||||||||||||||||||| | |
Sbjct: 97729 tccatccagagttttaatggtgatctgctgtatgagccatgggaaatttatgatgatagt 97788

                                                                         
Query: 511   gggcttgcatttacaactttcaatatgtattgggaaaaatgcatggaattgcctatcgaa 570
             || |||||||||||||| || || ||||| ||||| || ||||||||||| ||||| || 
Sbjct: 97789 ggacttgcatttacaacctttaacatgtactgggagaagtgcatggaattacctattgac 97848

                                      
Query: 571   atatcaccatcccttgccccttgga 595
               |||||| || ||||| |||||||
Sbjct: 97849 gcatcaccgtcacttgcaccttgga 97873



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 624   ttgataacctaggtcttgaatcaagtaaggatg 656
             ||||| ||||||| ||||||||||| |||||||
Sbjct: 98186 ttgatgacctaggacttgaatcaagcaaggatg 98218

---

>dbj|AB028930.1| Adiantum capillus-veneris CRY4 gene for blue light photoreceptor,
            complete cds
          Length = 4975

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 457  cagagtttcaatggtgatctgctatatgagccatgggaa 495
            |||||||||||||| ||| |||| |||||||||||||||
Sbjct: 2247 cagagtttcaatggcgatttgctgtatgagccatgggaa 2285

---

>dbj|AB028928.1| Adiantum capillus-veneris CRY4 mRNA for blue light photoreceptor,
           complete cds
          Length = 2892

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 457 cagagtttcaatggtgatctgctatatgagccatgggaa 495
           |||||||||||||| ||| |||| |||||||||||||||
Sbjct: 874 cagagtttcaatggcgatttgctgtatgagccatgggaa 912

---

>gb|AY835380.1| Sorghum bicolor cryptochrome 2 gene, complete cds
          Length = 3417

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 93  gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           ||||| ||| ||||||||| ||| |||||||||| | || |||||||||||
Sbjct: 78  gaggagcgtggtgtggttccggagggacctcagggtggaggacaacccggc 128



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 462  tttcaatggtgatctgctatatgagccatgggaa 495
            ||||||||  |||||||| |||||||||||||||
Sbjct: 1024 tttcaatgcggatctgctgtatgagccatgggaa 1057

---

>gb|DQ231577.1| Nicotiana sylvestris cryptochrome 2 (cry2) mRNA, complete cds
          Length = 1926

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 376 tataatcatctatacgaccctatttcacttgtgcgggatgacaaaatcaag 426
           |||||||||||||| || ||| |||||||||| || ||| |||| ||||||
Sbjct: 298 tataatcatctatatgatcctgtttcacttgttcgtgatcacaatatcaag 348

---

>ref|XM_472681.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2082

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 93  gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           |||||| || ||||||||||||| |||||| ||| | || |||||||||||
Sbjct: 33  gaggacggtggtgtggttcaggagggacctgagggtggaggacaacccggc 83

---

>gb|AF545572.1| Sorghum bicolor cryptochrome 2 apoprotein (cry2) mRNA, complete cds
          Length = 2206

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 93  gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           ||||| ||| ||||||||| ||| |||||||||| | || |||||||||||
Sbjct: 86  gaggagcgtggtgtggttccggagggacctcagggtggaggacaacccggc 136



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 462 tttcaatggtgatctgctatatgagccatgggaa 495
           ||||||||  |||||||| |||||||||||||||
Sbjct: 461 tttcaatgcggatctgctgtatgagccatgggaa 494

---

>emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14,
              complete sequence
          Length = 175698

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 93     gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
              |||||| || ||||||||||||| |||||| ||| | || |||||||||||
Sbjct: 128761 gaggacggtggtgtggttcaggagggacctgagggtggaggacaacccggc 128811

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                   
Query: 93       gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
                |||||| || ||||||||||||| |||||| ||| | || |||||||||||
Sbjct: 22525006 gaggacggtggtgtggttcaggagggacctgagggtggaggacaacccggc 22525056

---

>dbj|AK072182.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146D14, full
           insert sequence
          Length = 4629

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 93  gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           |||||| || ||||||||||||| |||||| ||| | || |||||||||||
Sbjct: 349 gaggacggtggtgtggttcaggagggacctgagggtggaggacaacccggc 399

---

>dbj|AB073547.2| Oryza sativa (japonica cultivar-group) OsCRY1b mRNA for
           cryptochrome 1b, complete cds
          Length = 2904

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 93  gaggaccgttgtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           |||||| || ||||||||||||| |||||| ||| | || |||||||||||
Sbjct: 455 gaggacggtggtgtggttcaggagggacctgagggtggaggacaacccggc 505

---

>ref|NM_025795.2| Mus musculus DNA segment, Chr 15, ERATO Doi 785, expressed
            (D15Ertd785e), mRNA
          Length = 3249

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 2776 ggaatttctatgcagagtttca 2797

---

>gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, complete sequence
          Length = 184010

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 445    ggaatttctatgcagagtttca 466
              ||||||||||||||||||||||
Sbjct: 150138 ggaatttctatgcagagtttca 150159

---

>gb|BC019554.1| Mus musculus endothelial cell growth factor 1 (platelet-derived),
           mRNA (cDNA clone MGC:28479 IMAGE:4163864), complete cds
          Length = 1158

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 445 ggaatttctatgcagagtttca 466
           ||||||||||||||||||||||
Sbjct: 428 ggaatttctatgcagagtttca 407

---

>ref|NM_138302.1| Mus musculus endothelial cell growth factor 1 (platelet-derived)
            (Ecgf1), mRNA
          Length = 2042

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 1619 ggaatttctatgcagagtttca 1598

---

>dbj|AK146642.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:I920037G21 product:weakly similar to
            Placental protein [Homo sapiens], full insert sequence
          Length = 3301

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 2829 ggaatttctatgcagagtttca 2850

---

>dbj|AK013765.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:2900072D10 product:similar to
           SCO2 PROTEIN HOMOLOG, MITOCHONDRIAL PRECURSOR [Homo
           sapiens], full insert sequence
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 445 ggaatttctatgcagagtttca 466
           ||||||||||||||||||||||
Sbjct: 537 ggaatttctatgcagagtttca 516

---

>dbj|AK083981.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130071K06 product:hypothetical
            protein, full insert sequence
          Length = 3175

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 2703 ggaatttctatgcagagtttca 2724

---

>dbj|AK002487.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
            library, clone:0610010J20 product:weakly similar to
            Placental protein [Homo sapiens], full insert sequence
          Length = 3230

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 2762 ggaatttctatgcagagtttca 2783

---

>dbj|AK031135.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length enriched
            library, clone:5930412I10 product:inferred: RIKEN cDNA
            0610010J20 gene, full insert sequence
          Length = 3217

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 2749 ggaatttctatgcagagtttca 2770

---

>dbj|AK085584.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched
            library, clone:D630044C19 product:hypothetical protein,
            full insert sequence
          Length = 3249

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 2776 ggaatttctatgcagagtttca 2797

---

>dbj|AK219815.1| Mus musculus cDNA, clone:Y2G0149L15, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000064869, based on BLAT search
          Length = 394

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 445 ggaatttctatgcagagtttca 466
           ||||||||||||||||||||||
Sbjct: 77  ggaatttctatgcagagtttca 56

---

>dbj|AK186876.1| Mus musculus cDNA, clone:Y0G0139B09, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000064869, based on BLAT search
          Length = 388

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 445 ggaatttctatgcagagtttca 466
           ||||||||||||||||||||||
Sbjct: 285 ggaatttctatgcagagtttca 264

---

>gb|AC137513.3| Mus musculus BAC clone RP24-460O22 from 15, complete sequence
          Length = 179386

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 445    ggaatttctatgcagagtttca 466
              ||||||||||||||||||||||
Sbjct: 153565 ggaatttctatgcagagtttca 153544

---

>dbj|AB060274.1| Mus musculus mRNA for thymidine phosphorylase, complete cds
          Length = 2042

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 445  ggaatttctatgcagagtttca 466
            ||||||||||||||||||||||
Sbjct: 1619 ggaatttctatgcagagtttca 1598

---

>gb|DQ201154.1| Hordeum vulgare subsp. vulgare cultivar Kompolti korai cryptochrome
           1b (Cry1b) gene, complete cds
          Length = 4753

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 103 gtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           ||||||||| ||| |||||||||| | || |||||||||||
Sbjct: 266 gtgtggttccggagggacctcagggtggaggacaacccggc 306

---

>gb|DQ201153.1| Hordeum vulgare subsp. vulgare cultivar Morex cryptochrome 1b
           (Cry1b) gene, complete cds
          Length = 4753

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 103 gtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           ||||||||| ||| |||||||||| | || |||||||||||
Sbjct: 266 gtgtggttccggagggacctcagggtggaggacaacccggc 306

---

>gb|DQ201152.1| Hordeum vulgare subsp. vulgare cultivar Dicktoo cryptochrome 1b
           (Cry1b) gene, complete cds
          Length = 4753

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 103 gtgtggttcaggaaggacctcaggatcgacgacaacccggc 143
           ||||||||| ||| |||||||||| | || |||||||||||
Sbjct: 266 gtgtggttccggagggacctcagggtggaggacaacccggc 306

---

>gb|AC084423.1|AC084423 Caenorhabditis briggsae cosmid CB020D11, complete sequence
          Length = 85565

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 433   cttttgggccttggaatttct 453
             |||||||||||||||||||||
Sbjct: 21444 cttttgggccttggaatttct 21424

---

>gb|AY508973.1| Pisum sativum cultivar Torsdag cryptochrome 2A apoprotein (CRY2A)
           gene, complete cds
          Length = 3065

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 460 agtttcaatggtgatctgctatatgagccatgggaaatttatgatgagaatgggcttgca 519
           |||| |||||| |||||| | |||||||| |||||  | ||||||||||| || | ||| 
Sbjct: 667 agttacaatggggatctgttgtatgagccttgggagttatatgatgagaagggacatgct 726

                   
Query: 520 tttacaac 527
           ||||||||
Sbjct: 727 tttacaac 734

---

>gb|AY705912.1| Zea mays cytotype NA hypothetical protein genes, complete cds;
            tRNA-Met (trnM-ct) gene, atpE-ct and atpB-ct pseudogenes,
            complete sequence; hypothetical protein genes, complete
            cds; NADH dehydrogenase subunit I (nad1) gene, partial
            cds; ribosomal protein S13 (rps13) gene, complete cds;
            and tRNA-Met (trnfM) gene, complete sequence;
            mitochondrial
          Length = 40000

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 577  ccatcccttgccccttggag 596
            ||||||||||||||||||||
Sbjct: 5183 ccatcccttgccccttggag 5202

---

>gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome
          Length = 569630

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 577    ccatcccttgccccttggag 596
              ||||||||||||||||||||
Sbjct: 248683 ccatcccttgccccttggag 248702



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 577  ccatcccttgccccttggag 596
            ||||||||||||||||||||
Sbjct: 5173 ccatcccttgccccttggag 5192

---

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 198     ggccgaggaaggccgcttct 217
               ||||||||||||||||||||
Sbjct: 2312976 ggccgaggaaggccgcttct 2312995

---

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 146     tggccgccgccgcaagggac 165
               ||||||||||||||||||||
Sbjct: 1095412 tggccgccgccgcaagggac 1095393

---

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 347    tccattccatccgcgccacc 366
              ||||||||||||||||||||
Sbjct: 455827 tccattccatccgcgccacc 455846

---

>ref|XM_361526.1| Magnaporthe grisea 70-15 hypothetical protein (MG04000.4) partial
            mRNA
          Length = 2394

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 268  gccaagtcgctcgaggcgct 287
            ||||||||||||||||||||
Sbjct: 1165 gccaagtcgctcgaggcgct 1184

---

>gb|AC123654.9| Mus musculus chromosome 15, clone RP23-161D16, complete sequence
          Length = 182376

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 518   catttacaactttcaatatg 537
             ||||||||||||||||||||
Sbjct: 74615 catttacaactttcaatatg 74634

---

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 146    tggccgccgccgcaagggacggcg 169
              |||||||||||||||| |||||||
Sbjct: 953784 tggccgccgccgcaagtgacggcg 953807

---

>gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mitochondrion, complete
              genome
          Length = 701046

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 577    ccatcccttgccccttggag 596
              ||||||||||||||||||||
Sbjct: 589736 ccatcccttgccccttggag 589755



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 577  ccatcccttgccccttggag 596
            ||||||||||||||||||||
Sbjct: 5183 ccatcccttgccccttggag 5202

---

>gb|AC120888.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone
             P0485F09, complete sequence
          Length = 161276

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 426   gaatgagcttttgggccttg 445
             ||||||||||||||||||||
Sbjct: 76417 gaatgagcttttgggccttg 76436

---

>gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion, complete genome
          Length = 569553

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 577    ccatcccttgccccttggag 596
              ||||||||||||||||||||
Sbjct: 504557 ccatcccttgccccttggag 504538

---

>gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 491 ggctttggccgccgccgcaa 472

---

>gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion, complete genome
          Length = 535825

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 577  ccatcccttgccccttggag 596
            ||||||||||||||||||||
Sbjct: 5174 ccatcccttgccccttggag 5193

---

>gb|AY727930.1| Cornus sericea 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 511 ggctttggccgccgccgcaa 492

---

>gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 2 of
              11 of the complete sequence
          Length = 613322

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 591    ttggaggtatagaaaacctt 610
              ||||||||||||||||||||
Sbjct: 422380 ttggaggtatagaaaacctt 422399

---

>gb|AY161311.1| Pisum sativum cryptochrome 2A (CRY2A) mRNA, partial cds
          Length = 1667

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 460 agtttcaatggtgatctgctatatgagccatgggaaatttatgatgagaatgggcttgca 519
           |||| |||||| |||||| | |||||||| |||||  | ||||||||||| || | ||| 
Sbjct: 921 agttacaatggggatctgttgtatgagccttgggagttatatgatgagaagggacatgct 980

                   
Query: 520 tttacaac 527
           ||||||||
Sbjct: 981 tttacaac 988

---

>gb|AY260020.1| Grubbia tomentosa 26S ribosomal RNA gene, complete sequence
          Length = 3252

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 528 ggctttggccgccgccgcaa 509

---

>gb|AY260017.1| Mastixia eugenioides 26S ribosomal RNA gene, complete sequence
          Length = 3363

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 524 ggctttggccgccgccgcaa 505

---

>gb|AY260016.1| Mastixia pentandra 26S ribosomal RNA gene, complete sequence
          Length = 3364

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 525 ggctttggccgccgccgcaa 506

---

>gb|AY260015.1| Mastixia caudatilimba 26S ribosomal RNA gene, complete sequence
          Length = 3372

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 528 ggctttggccgccgccgcaa 509

---

>gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete sequence
          Length = 3372

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 528 ggctttggccgccgccgcaa 509

---

>gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complete sequence
          Length = 3362

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 525 ggctttggccgccgccgcaa 506

---

>emb|AL354763.17| Human DNA sequence from clone RP11-357L1 on chromosome 13 Contains an
              ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G
              variant 1 (ATP6V1G1) pseudogene, complete sequence
          Length = 192963

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 591    ttggaggtatagaaaacctt 610
              ||||||||||||||||||||
Sbjct: 148920 ttggaggtatagaaaacctt 148939

---

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 583     cttgccccttggaggtatagaaaa 606
               ||||||| ||||||||||||||||
Sbjct: 4184265 cttgcccattggaggtatagaaaa 4184242

---

>emb|AJ621744.1| Gallus gallus gene for hypothetical protein, BAC bCHORI92M14 clone,
             contig 5
          Length = 68491

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   ggacggcgcggtgctccctg 181
             ||||||||||||||||||||
Sbjct: 64990 ggacggcgcggtgctccctg 65009

---

>dbj|AK148815.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120450I01
            product:unclassifiable, full insert sequence
          Length = 2179

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 433  cttttgggccttggaatttc 452
            ||||||||||||||||||||
Sbjct: 1973 cttttgggccttggaatttc 1992

---

>gb|AY935821.1| Rinorea pubiflora isolate 31 26S ribosomal RNA gene, partial
           sequence
          Length = 952

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 501 ggctttggccgccgccgcaa 482

---

>gb|AY935820.1| Prunus persica isolate 30 26S ribosomal RNA gene, partial sequence
          Length = 917

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 494 ggctttggccgccgccgcaa 475

---

>gb|AF297539.1|AF297539 Cornus oblonga 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 528 ggctttggccgccgccgcaa 509

---

>gb|AF297538.1|AF297538 Cornus racemosa 26S ribosomal RNA gene, partial sequence
          Length = 3350

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 529 ggctttggccgccgccgcaa 510

---

>gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 529 ggctttggccgccgccgcaa 510

---

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 250    gagtcgcttgcccaccttgc 269
              ||||||||||||||||||||
Sbjct: 795723 gagtcgcttgcccaccttgc 795742

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 426      gaatgagcttttgggccttg 445
                ||||||||||||||||||||
Sbjct: 25469526 gaatgagcttttgggccttg 25469545

---

>gb|AC110758.3| Homo sapiens BAC clone RP11-24D11 from 4, complete sequence
          Length = 165028

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 597    gtatagaaaacctttgtact 616
              ||||||||||||||||||||
Sbjct: 156016 gtatagaaaacctttgtact 156035

---

>gb|AF479163.1| Cornus officinalis 26S ribosomal RNA gene, complete sequence
          Length = 3311

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 504 ggctttggccgccgccgcaa 485

---

>gb|AF479119.1| Chrysobalanus icaco 26S ribosomal RNA gene, partial sequence
          Length = 1550

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 511 ggctttggccgccgccgcaa 492

---

>gb|AF479103.1| Spiraea betulifolia 26S ribosomal RNA gene, complete sequence
          Length = 3371

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 527 ggctttggccgccgccgcaa 508

---

>gb|AF479101.1| Photinia fraseri 26S ribosomal RNA gene, complete sequence
          Length = 3371

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 525 ggctttggccgccgccgcaa 506

---

>gb|AE009527.1| Brucella melitensis 16M chromosome I, section 84 of 195 of the
            complete sequence
          Length = 13430

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 146  tggccgccgccgcaagggac 165
            ||||||||||||||||||||
Sbjct: 7252 tggccgccgccgcaagggac 7271

---

>gb|AC138336.3| Homo sapiens chromosome 17, clone CTC-386K3, complete sequence
          Length = 94400

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   gacaaaatcaagaatgagct 434
             ||||||||||||||||||||
Sbjct: 71996 gacaaaatcaagaatgagct 72015

---

>gb|AC138146.4| Homo sapiens chromosome 17, clone RP11-1143J18, complete sequence
          Length = 42410

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   gacaaaatcaagaatgagct 434
             ||||||||||||||||||||
Sbjct: 27304 gacaaaatcaagaatgagct 27323

---

>gb|AF130425.1|AF130425 Lycopersicon esculentum cryptochrome 2 mRNA, complete cds
          Length = 2385

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 376 tataatcatctatacgaccctatttcacttgt 407
           |||||||||||||| || ||| ||||||||||
Sbjct: 430 tataatcatctatatgatcctgtttcacttgt 461

---

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 146     tggccgccgccgcaagggac 165
               ||||||||||||||||||||
Sbjct: 1112773 tggccgccgccgcaagggac 1112754

---

>emb|BX088540.6| Zebrafish DNA sequence from clone CH211-225B7 in linkage group 15,
             complete sequence
          Length = 176569

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    gcttttcttgggccgggtca 51
             ||||||||||||||||||||
Sbjct: 88670 gcttttcttgggccgggtca 88651

---

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 198     ggccgaggaaggccgcttct 217
               ||||||||||||||||||||
Sbjct: 2361299 ggccgaggaaggccgcttct 2361280

---

>emb|X06380.1|MIZMR1A Maize mitochondrial DNA for 5kB alpha-R1 repeat
          Length = 7815

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 577  ccatcccttgccccttggag 596
            ||||||||||||||||||||
Sbjct: 3876 ccatcccttgccccttggag 3895

---

>emb|X06379.1|MIZMR2B Maize mitochondrial DNA for 5kB beta-R2 repeat
          Length = 6127

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 577  ccatcccttgccccttggag 596
            ||||||||||||||||||||
Sbjct: 4060 ccatcccttgccccttggag 4079

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 426      gaatgagcttttgggccttg 445
                ||||||||||||||||||||
Sbjct: 25788196 gaatgagcttttgggccttg 25788215

---

>gb|AC134555.4| Mus musculus BAC clone RP24-320K4 from 17, complete sequence
          Length = 174388

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 433   cttttgggccttggaatttc 452
             ||||||||||||||||||||
Sbjct: 65661 cttttgggccttggaatttc 65680

---

>emb|CT033782.5| Mouse DNA sequence from clone RP23-39B12 on chromosome 17, complete
             sequence
          Length = 93115

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 530   tcaatatgtattgggaaaaa 549
             ||||||||||||||||||||
Sbjct: 33504 tcaatatgtattgggaaaaa 33485

---

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 146     tggccgccgccgcaagggac 165
               ||||||||||||||||||||
Sbjct: 1109924 tggccgccgccgcaagggac 1109905

---

>emb|X58118.1|FA26SRN F.ananassa 26s rRNA gene
          Length = 3377

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ggctttggccgccgccgcaa 160
           ||||||||||||||||||||
Sbjct: 529 ggctttggccgccgccgcaa 510

---

>gb|AY508972.1| Pisum sativum cultivar Torsdag cryptochrome 2A apoprotein (CRY2A)
           mRNA, complete cds
          Length = 2363

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 460 agtttcaatggtgatctgctatatgagccatgggaaatttatgatgagaatgggcttgca 519
           |||| |||||| |||||| | |||||||| |||||  | ||||||||||| || | ||| 
Sbjct: 590 agttacaatggggatctgttgtatgagccttgggagttatatgatgagaagggacatgct 649

                   
Query: 520 tttacaac 527
           ||||||||
Sbjct: 650 tttacaac 657

---

>emb|AL359381.8| Mouse DNA sequence from clone CT7-87K14 on chromosome 17, complete
             sequence
          Length = 102917

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 530   tcaatatgtattgggaaaaa 549
             ||||||||||||||||||||
Sbjct: 61714 tcaatatgtattgggaaaaa 61695


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,220,960
Number of Sequences: 3902068
Number of extensions: 5220960
Number of successful extensions: 85869
Number of sequences better than 10.0: 94
Number of HSP's better than 10.0 without gapping: 94
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85189
Number of HSP's gapped (non-prelim): 680
length of query: 656
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 633
effective length of database: 17,143,297,704
effective search space: 10851707446632
effective search space used: 10851707446632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---