ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal34n10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome... 100 1e-17
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 100 1e-17
3gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 100 1e-17
4gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence 94 7e-16
5gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence 94 7e-16
6dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
7gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 92 3e-15
8emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa... 92 3e-15
9ref|NM_194080.1| Oryza sativa (japonica cultivar-group), mRNA 86 2e-13
10gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 86 2e-13
11gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genom... 86 2e-13
12dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 86 2e-13
13dbj|AK059123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 2e-13
14gb|AY109342.1| Zea mays CL3469_4 mRNA sequence 86 2e-13
15gb|AY110912.1| Zea mays CL3469_2 mRNA sequence 76 2e-10
16gb|AY109560.1| Zea mays CL3469_8 mRNA sequence 70 1e-08
17gb|AY846831.1| Triticum aestivum ribosomal protein S29 mRNA, com... 62 3e-06
18gb|AE006454.1| Lactococcus lactis subsp. lactis IL1403 section 2... 42 2.4
19gb|AC124712.5| Mus musculus BAC clone RP24-103K4 from chromosome... 42 2.4
20gb|AY310769.1| Nicotiana benthamiana clone 8-039 unknown mRNA 42 2.4
21gb|AF345525.1| TT virus isolate TCHN-D2 Orf2 and Orf1 genes, com... 42 2.4
22gb|AC025445.5| Homo sapiens chromosome 5 clone CTD-2049O17, comp... 42 2.4
23gb|AC000348.2|AC000348 Genomic sequence for Arabidopsis thaliana... 42 2.4
24emb|AL731776.7| Mouse DNA sequence from clone RP23-58B9 on chrom... 42 2.4
25emb|Z81535.3|CEF38A1 Caenorhabditis elegans Cosmid F38A1, comple... 42 2.4
26ref|XM_629928.1| Dictyostelium discoideum hypothetical protein (... 40 9.6
27gb|AC003067.59| Mus musculus Chromosome 16 BAC Clone tbx3 Synten... 40 9.6
28ref|XM_712669.1| Candida albicans SC5314 hypothetical protein (C... 40 9.6
29ref|XM_712668.1| Candida albicans SC5314 hypothetical protein (C... 40 9.6
30ref|XM_712575.1| Candida albicans SC5314 hypothetical protein (C... 40 9.6
31ref|XM_712574.1| Candida albicans SC5314 hypothetical protein (C... 40 9.6
32gb|DQ017120.1| Nelumbo nucifera RNA polymerase II second largest... 40 9.6
33gb|AC133488.30| Mus musculus strain C57BL/6J clone rp23-432e14, ... 40 9.6
34gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosom... 40 9.6
35emb|CR388381.12| Zebrafish DNA sequence from clone CH211-222P22 ... 40 9.6
36emb|AL109658.5|HSJ776F14 Human DNA sequence from clone RP4-776F1... 40 9.6
37emb|CR543861.1| Acinetobacter sp. ADP1 complete genome 40 9.6
38gb|AC098591.4| Homo sapiens BAC clone RP11-333E13 from 4, comple... 40 9.6
39emb|AL513466.1|NCB18D24 Neurospora crassa DNA linkage group V BA... 40 9.6
40emb|AL451018.1|NC99H12 Neurospora crassa DNA linkage group V Cos... 40 9.6
41gb|AC131053.2| Homo sapiens chromosome 18, clone RP11-348G23, co... 40 9.6
42gb|AC008019.60| Mus musculus strain 129S6/SvEvTac chromosome 16 ... 40 9.6
43gb|AC099848.2| Homo sapiens chromosome 18, clone RP11-856F24, co... 40 9.6
44emb|BX324156.6| Zebrafish DNA sequence from clone CH211-215C3 in... 40 9.6
45gb|DQ401084.1| Chlamydomonas sp. ICE-L ribosomal protein S29 sub... 40 9.6
46gb|AC003066.18| Mus musculus Chromosome 16 BAC Clone tbx1 Synten... 40 9.6
47gb|AF269414.1|AF269414 Staphylococcus epidermidis strain SR1 clo... 40 9.6
48gb|AC025679.4|AC025679 Homo sapiens chromosome 18, clone RP11-38... 40 9.6
49dbj|AK033250.1| Mus musculus 15 days embryo male testis cDNA, RI... 40 9.6
50emb|BX255899.5| Zebrafish DNA sequence from clone CH211-279I13 i... 40 9.6
51dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
52gb|AC093892.3| Homo sapiens BAC clone RP11-702L18 from 2, comple... 40 9.6
53gb|AC133574.15| Mus musculus strain C57BL/6J clone rp23-35b9, co... 40 9.6
54gb|AF270049.1|AF270049 Staphylococcus epidermidis strain SR1 clo... 40 9.6
55gb|AF269892.1|AF269892 Staphylococcus epidermidis strain SR1 clo... 40 9.6
56gb|AF269585.1|AF269585 Staphylococcus epidermidis strain SR1 clo... 40 9.6
57dbj|AP005071.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
58dbj|AP005316.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
59dbj|AK067614.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.6
60emb|X13254.1|NCCRP1R Neurospora crassa crp-1 mRNA for ribosomal ... 40 9.6
61emb|X06320.1|NCCRP1G Neurospora crassa crp-1 gene for ribosomal ... 40 9.6
62emb|AL139020.5|CNS01DX2 Human chromosome 14 DNA sequence BAC R-1... 40 9.6
63gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 40 9.6
64gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete g... 40 9.6
65gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome 40 9.6
66gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complet... 40 9.6
67dbj|D13509.1|MUSPAPA Mus musculus mRNA for PAP homologous protei... 40 9.6

>gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0039F06, complete sequence
          Length = 133022

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 56/58 (96%)
 Strand = Plus / Minus

                                                                       
Query: 90    actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctggta 147
             ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 87372 actccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtctggta 87315



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 56/58 (96%)
 Strand = Plus / Plus

                                                                          
Query: 90       actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctggta 147
                ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 24118054 actccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtctggta 24118111



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 56/58 (96%)
 Strand = Plus / Plus

                                                                          
Query: 90       actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctggta 147
                ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 24429723 actccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtctggta 24429780



to top

>gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence
          Length = 424

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctg 144
           ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 50  actccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcgtctg 104



to top

>gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence
          Length = 402

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctg 144
           ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 36  actccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcgtctg 90



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 55/58 (94%)
 Strand = Plus / Plus

                                                                          
Query: 90       actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctggta 147
                ||||||||||||||||||||||||||||||||||||| || || ||||||||||||||
Sbjct: 19577514 actccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgtctggta 19577571



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 55/58 (94%)
 Strand = Plus / Plus

                                                                          
Query: 90       actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctggta 147
                ||||||||||||||||||||||||||||||||||||| || || ||||||||||||||
Sbjct: 19503727 actccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgtctggta 19503784



to top

>emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa0009K11 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 144596

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 55/58 (94%)
 Strand = Plus / Plus

                                                                        
Query: 90     actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctggta 147
              ||||||||||||||||||||||||||||||||||||| || || ||||||||||||||
Sbjct: 109695 actccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgtctggta 109752



to top

>ref|NM_194080.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 509

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Plus

                                                          
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcc 136
           ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 40  actccaacgtgtggaactcgcaccccaagaactacggccccggatcc 86



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                               
Query: 90       actccaacgtgtggaactcccaccccaagaactacggccccggatcc 136
                ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 31739417 actccaacgtgtggaactcgcaccccaagaactacggccccggatcc 31739371



to top

>gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete
             sequence
          Length = 134496

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                            
Query: 90    actccaacgtgtggaactcccaccccaagaactacggccccggatcc 136
             ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 64643 actccaacgtgtggaactcgcaccccaagaactacggccccggatcc 64597



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                               
Query: 90       actccaacgtgtggaactcccaccccaagaactacggccccggatcc 136
                ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 31829933 actccaacgtgtggaactcgcaccccaagaactacggccccggatcc 31829887



to top

>dbj|AK059123.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-F08, full
           insert sequence
          Length = 457

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctg 144
           ||||||||||||||||||||||||||||||||||||| || || |||||||||||
Sbjct: 95  actccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgtctg 149



to top

>gb|AY109342.1| Zea mays CL3469_4 mRNA sequence
          Length = 814

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctg 144
           |||||||||| |||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 66  actccaacgtctggaactcgcaccccaagaactacgggcccggatcccgcgtctg 120



to top

>gb|AY110912.1| Zea mays CL3469_2 mRNA sequence
          Length = 489

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                         
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatc 135
           ||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 98  actccaacgtgtggaactcgcaccccaagaactacggccctggatc 143



to top

>gb|AY109560.1| Zea mays CL3469_8 mRNA sequence
          Length = 586

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctg 144
           |||||||||| |||||||| ||||| |||||||||||||| || |||||||||||
Sbjct: 40  actccaacgtttggaactcgcaccctaagaactacggccctggctcccgcgtctg 94



to top

>gb|AY846831.1| Triticum aestivum ribosomal protein S29 mRNA, complete cds
          Length = 398

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 90  actccaacgtgtggaactcccaccccaagaactacggccccggatcc 136
           |||| ||||| |||||||| |||||||||||||||||| ||||||||
Sbjct: 46  actcgaacgtctggaactcgcaccccaagaactacggcgccggatcc 92



to top

>gb|AE006454.1| Lactococcus lactis subsp. lactis IL1403 section 216 of 218 of the
            complete genome
          Length = 11723

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 21   gacgaggatcgaactcgcgag 41
            |||||||||||||||||||||
Sbjct: 2938 gacgaggatcgaactcgcgag 2958



to top

>gb|AC124712.5| Mus musculus BAC clone RP24-103K4 from chromosome 12, complete sequence
          Length = 169132

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 609   atgaaattgtgattacaaaaa 629
             |||||||||||||||||||||
Sbjct: 91557 atgaaattgtgattacaaaaa 91537



to top

>gb|AY310769.1| Nicotiana benthamiana clone 8-039 unknown mRNA
          Length = 392

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 110 caccccaagaactacggccccggatcccg 138
           |||||||||||||||||||| || |||||
Sbjct: 85  caccccaagaactacggccctggctcccg 113



to top

>gb|AF345525.1| TT virus isolate TCHN-D2 Orf2 and Orf1 genes, complete cds
          Length = 3196

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 466  cttgcaagttttaagctgcacttta 490
            ||||||||||| |||||||||||||
Sbjct: 2918 cttgcaagtttgaagctgcacttta 2894



to top

>gb|AC025445.5| Homo sapiens chromosome 5 clone CTD-2049O17, complete sequence
          Length = 184635

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 608   catgaaattgtgattacaaaa 628
             |||||||||||||||||||||
Sbjct: 70974 catgaaattgtgattacaaaa 70954



to top

>gb|AC000348.2|AC000348 Genomic sequence for Arabidopsis thaliana BAC T7N9 from chromosome I,
             complete sequence
          Length = 111566

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 673   tgagttgttgtaatcttattc 693
             |||||||||||||||||||||
Sbjct: 68756 tgagttgttgtaatcttattc 68736



to top

>emb|AL731776.7| Mouse DNA sequence from clone RP23-58B9 on chromosome X, complete
              sequence
          Length = 237321

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 599    tgttatggacatgaaattgtgatta 623
              ||||||||||| |||||||||||||
Sbjct: 175299 tgttatggacaagaaattgtgatta 175323



to top

>emb|Z81535.3|CEF38A1 Caenorhabditis elegans Cosmid F38A1, complete sequence
          Length = 37282

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 619   gattacaaaaataccatactagtat 643
             ||||||||||| |||||||||||||
Sbjct: 32309 gattacaaaaaaaccatactagtat 32333



to top

>ref|XM_629928.1| Dictyostelium discoideum hypothetical protein (DDB0184065), partial
           mRNA
          Length = 2970

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 399 tgctttttcatctgtttgct 418
           ||||||||||||||||||||
Sbjct: 606 tgctttttcatctgtttgct 587



to top

>gb|AC003067.59| Mus musculus Chromosome 16 BAC Clone tbx3 Syntenic To Homo sapiens
              22q11.2 DGCR Region, complete sequence
          Length = 262062

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 617    gtgattacaaaaataccata 636
              ||||||||||||||||||||
Sbjct: 153963 gtgattacaaaaataccata 153982



to top

>ref|XM_712669.1| Candida albicans SC5314 hypothetical protein (CaO19_5387), mRNA
          Length = 4041

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 67  cggaagcggagaagacgatg 86
           ||||||||||||||||||||
Sbjct: 234 cggaagcggagaagacgatg 253



to top

>ref|XM_712668.1| Candida albicans SC5314 hypothetical protein (CaO19_5386), mRNA
          Length = 414

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 67  cggaagcggagaagacgatg 86
           ||||||||||||||||||||
Sbjct: 150 cggaagcggagaagacgatg 131



to top

>ref|XM_712575.1| Candida albicans SC5314 hypothetical protein (CaO19_12842), mRNA
          Length = 4041

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 67  cggaagcggagaagacgatg 86
           ||||||||||||||||||||
Sbjct: 234 cggaagcggagaagacgatg 253



to top

>ref|XM_712574.1| Candida albicans SC5314 hypothetical protein (CaO19_12841), mRNA
          Length = 414

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 67  cggaagcggagaagacgatg 86
           ||||||||||||||||||||
Sbjct: 150 cggaagcggagaagacgatg 131



to top

>gb|DQ017120.1| Nelumbo nucifera RNA polymerase II second largest subunit (RPB2)
           gene, exons 2 through 23 and partial cds
          Length = 5530

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 470 caagttttaagctgcacttt 489
           ||||||||||||||||||||
Sbjct: 959 caagttttaagctgcacttt 978



to top

>gb|AC133488.30| Mus musculus strain C57BL/6J clone rp23-432e14, complete sequence
          Length = 202128

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 617    gtgattacaaaaataccata 636
              ||||||||||||||||||||
Sbjct: 140553 gtgattacaaaaataccata 140572



to top

>gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosome 9, complete sequence
          Length = 219833

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 603    atggacatgaaattgtgatt 622
              ||||||||||||||||||||
Sbjct: 210450 atggacatgaaattgtgatt 210469



to top

>emb|CR388381.12| Zebrafish DNA sequence from clone CH211-222P22 in linkage group 16,
             complete sequence
          Length = 141855

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 458   tggtggtgcttgcaagtttt 477
             ||||||||||||||||||||
Sbjct: 43581 tggtggtgcttgcaagtttt 43600



to top

>emb|AL109658.5|HSJ776F14 Human DNA sequence from clone RP4-776F14 on chromosome 20p12.2-13
             Contains the 5' end of the FKBP1A gene for FK506 binding
             protein 1A (12kDa), the NSFL1C gene for NSFL1 (p97)
             cofactor (p47), the PTPN1L gene for protein tyrosine
             phosphatase non-receptor type 1-like, the 3' end of a
             novel gene and two CpG islands, complete sequence
          Length = 119241

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 612   aaattgtgattacaaaaata 631
             ||||||||||||||||||||
Sbjct: 56167 aaattgtgattacaaaaata 56148



to top

>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome
          Length = 3598621

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     gacgaggatcgaactcgcga 40
              ||||||||||||||||||||
Sbjct: 297075 gacgaggatcgaactcgcga 297056



to top

>gb|AC098591.4| Homo sapiens BAC clone RP11-333E13 from 4, complete sequence
          Length = 179641

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 405    ttcatctgtttgctaggaat 424
              ||||||||||||||||||||
Sbjct: 150284 ttcatctgtttgctaggaat 150303



to top

>emb|AL513466.1|NCB18D24 Neurospora crassa DNA linkage group V BAC contig B18D24
          Length = 157180

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 447   atgttgtctgctggtggtgc 466
             ||||||||||||||||||||
Sbjct: 39975 atgttgtctgctggtggtgc 39956



to top

>emb|AL451018.1|NC99H12 Neurospora crassa DNA linkage group V Cosmid contig 99H12
          Length = 85165

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 447   atgttgtctgctggtggtgc 466
             ||||||||||||||||||||
Sbjct: 25266 atgttgtctgctggtggtgc 25285



to top

>gb|AC131053.2| Homo sapiens chromosome 18, clone RP11-348G23, complete sequence
          Length = 191115

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 615   ttgtgattacaaaaataccatact 638
             ||||||||||||||||| ||||||
Sbjct: 76412 ttgtgattacaaaaataacatact 76389



to top

>gb|AC008019.60| Mus musculus strain 129S6/SvEvTac chromosome 16 clone rp21-519i24,
             complete sequence
          Length = 189707

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 617   gtgattacaaaaataccata 636
             ||||||||||||||||||||
Sbjct: 29076 gtgattacaaaaataccata 29095



to top

>gb|AC099848.2| Homo sapiens chromosome 18, clone RP11-856F24, complete sequence
          Length = 132288

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 615   ttgtgattacaaaaataccatact 638
             ||||||||||||||||| ||||||
Sbjct: 10499 ttgtgattacaaaaataacatact 10476



to top

>emb|BX324156.6| Zebrafish DNA sequence from clone CH211-215C3 in linkage group 1,
             complete sequence
          Length = 214471

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   aactctcccaatggctcccg 186
             ||||||||||||||||||||
Sbjct: 73793 aactctcccaatggctcccg 73774



to top

>gb|DQ401084.1| Chlamydomonas sp. ICE-L ribosomal protein S29 subunit mRNA,
           complete cds
          Length = 735

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 109 ccaccccaagaactacggcc 128
           ||||||||||||||||||||
Sbjct: 76  ccaccccaagaactacggcc 95



to top

>gb|AC003066.18| Mus musculus Chromosome 16 BAC Clone tbx1 Syntenic To Homo sapiens
              22q11.2 DGCR Region, complete sequence
          Length = 176974

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 617    gtgattacaaaaataccata 636
              ||||||||||||||||||||
Sbjct: 142265 gtgattacaaaaataccata 142284



to top

>gb|AF269414.1|AF269414 Staphylococcus epidermidis strain SR1 clone step.1003d11 genomic
           sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 660 atgatatgtttgat-gagttgttgtaat 686
           |||||||||||||| |||||||||||||
Sbjct: 582 atgatatgtttgatagagttgttgtaat 555



to top

>gb|AC025679.4|AC025679 Homo sapiens chromosome 18, clone RP11-383C19, complete sequence
          Length = 166937

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 615   ttgtgattacaaaaataccatact 638
             ||||||||||||||||| ||||||
Sbjct: 83667 ttgtgattacaaaaataacatact 83690



to top

>dbj|AK033250.1| Mus musculus 15 days embryo male testis cDNA, RIKEN full-length
            enriched library, clone:8030475H09 product:coatomer
            protein complex, subunit beta 2 (beta prime), full insert
            sequence
          Length = 2631

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 603  atggacatgaaattgtgatt 622
            ||||||||||||||||||||
Sbjct: 1825 atggacatgaaattgtgatt 1844



to top

>emb|BX255899.5| Zebrafish DNA sequence from clone CH211-279I13 in linkage group 6,
              complete sequence
          Length = 149442

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 629    ataccatactagtatggggt 648
              ||||||||||||||||||||
Sbjct: 120160 ataccatactagtatggggt 120141



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 654      tttgtcatgatatgtttgat 673
                ||||||||||||||||||||
Sbjct: 16462932 tttgtcatgatatgtttgat 16462951



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 612     aaattgtgattacaaaaata 631
               ||||||||||||||||||||
Sbjct: 3740913 aaattgtgattacaaaaata 3740932



to top

>gb|AC093892.3| Homo sapiens BAC clone RP11-702L18 from 2, complete sequence
          Length = 111078

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 402   tttttcatctgtttgctaggaattaatg 429
             ||||||||| ||||| ||||||||||||
Sbjct: 51722 tttttcatcagtttgttaggaattaatg 51695



to top

>gb|AC133574.15| Mus musculus strain C57BL/6J clone rp23-35b9, complete sequence
          Length = 168432

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 617   gtgattacaaaaataccata 636
             ||||||||||||||||||||
Sbjct: 72482 gtgattacaaaaataccata 72501



to top

>gb|AF270049.1|AF270049 Staphylococcus epidermidis strain SR1 clone step.1043h08 genomic
            sequence
          Length = 3413

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 660  atgatatgtttgat-gagttgttgtaat 686
            |||||||||||||| |||||||||||||
Sbjct: 1531 atgatatgtttgatagagttgttgtaat 1504



to top

>gb|AF269892.1|AF269892 Staphylococcus epidermidis strain SR1 clone step.1029b11 genomic
           sequence
          Length = 2918

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                       
Query: 660 atgatatgtttgat-gagttgttgtaat 686
           |||||||||||||| |||||||||||||
Sbjct: 433 atgatatgtttgatagagttgttgtaat 460



to top

>gb|AF269585.1|AF269585 Staphylococcus epidermidis strain SR1 clone step.1012a05 genomic
            sequence
          Length = 3674

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                        
Query: 660  atgatatgtttgat-gagttgttgtaat 686
            |||||||||||||| |||||||||||||
Sbjct: 2553 atgatatgtttgatagagttgttgtaat 2580



to top

>dbj|AP005071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0669G09
          Length = 140067

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 612   aaattgtgattacaaaaata 631
             ||||||||||||||||||||
Sbjct: 81230 aaattgtgattacaaaaata 81249



to top

>dbj|AP005316.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0527E02
          Length = 176826

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 654   tttgtcatgatatgtttgat 673
             ||||||||||||||||||||
Sbjct: 36347 tttgtcatgatatgtttgat 36366



to top

>dbj|AK067614.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108P21, full
           insert sequence
          Length = 2533

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 654 tttgtcatgatatgtttgat 673
           ||||||||||||||||||||
Sbjct: 555 tttgtcatgatatgtttgat 536



to top

>emb|X13254.1|NCCRP1R Neurospora crassa crp-1 mRNA for ribosomal protein homologous to
           yeast cyH2 gene encoding L29
          Length = 850

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 447 atgttgtctgctggtggtgc 466
           ||||||||||||||||||||
Sbjct: 28  atgttgtctgctggtggtgc 9



to top

>emb|X06320.1|NCCRP1G Neurospora crassa crp-1 gene for ribosomal protein homologous to
           yeast cyH2 gene encoding L29
          Length = 2214

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 447 atgttgtctgctggtggtgc 466
           ||||||||||||||||||||
Sbjct: 762 atgttgtctgctggtggtgc 743



to top

>emb|AL139020.5|CNS01DX2 Human chromosome 14 DNA sequence BAC R-164H13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 166308

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 505    aaactgtgtttgatgtttga 524
              ||||||||||||||||||||
Sbjct: 158074 aaactgtgtttgatgtttga 158093



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 132   gatcccgcgtctggtaagcgcccactgc 159
             ||||||||||| || |||||||||||||
Sbjct: 13317 gatcccgcgtccggcaagcgcccactgc 13290



to top

>gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete genome
          Length = 2499279

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 660    atgatatgtttgat-gagttgttgtaat 686
              |||||||||||||| |||||||||||||
Sbjct: 369235 atgatatgtttgatagagttgttgtaat 369262



to top

>gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome
          Length = 1992676

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 564    gttgataagcaaggtttaat 583
              ||||||||||||||||||||
Sbjct: 459940 gttgataagcaaggtttaat 459959



to top

>gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complete sequence
          Length = 222299

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 603    atggacatgaaattgtgatt 622
              ||||||||||||||||||||
Sbjct: 210822 atggacatgaaattgtgatt 210803



to top

>dbj|D13509.1|MUSPAPA Mus musculus mRNA for PAP homologous protein, complete cds
          Length = 745

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   cccccgggctgaggaattcg 20
           ||||||||||||||||||||
Sbjct: 572 cccccgggctgaggaattcg 553


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,179,027
Number of Sequences: 3902068
Number of extensions: 5179027
Number of successful extensions: 99438
Number of sequences better than 10.0: 67
Number of HSP's better than 10.0 without gapping: 63
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 99048
Number of HSP's gapped (non-prelim): 436
length of query: 701
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 678
effective length of database: 17,143,297,704
effective search space: 11623155843312
effective search space used: 11623155843312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top