ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal34h15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC117262.2| Mus musculus BAC clone RP24-537M7 from 2, complet... 46 0.077
2gb|AC107781.9| Mus musculus, clone RP23-56O1, complete sequence 46 0.077
3emb|BX284649.14| Mouse DNA sequence from clone RP23-42M7 on chro... 46 0.077
4gb|BT016143.1| Drosophila melanogaster AT25839 full insert cDNA 42 1.2
5gb|AC146045.3| Pan troglodytes BAC clone RP43-14B22 from 7, comp... 42 1.2
6gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome... 42 1.2
7gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complet... 42 1.2
8emb|AL592221.6| Human DNA sequence from clone RP11-216F5 on chro... 42 1.2
9emb|AL360175.18| Human DNA sequence from clone RP11-524K22 on ch... 42 1.2
10emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on ch... 42 1.2
11ref|NM_165630.1| Drosophila melanogaster sec31 CG8266-RB, transc... 42 1.2
12ref|NM_136570.2| Drosophila melanogaster sec31 CG8266-RA, transc... 42 1.2
13gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, r... 42 1.2
14gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosom... 42 1.2
15gb|AC003668.2| Homo sapiens X PAC RP1-233D13 (Roswell Park Cance... 42 1.2
16gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15... 42 1.2
17gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, comp... 40 4.8
18gb|AC123948.4| Mus musculus BAC clone RP23-105C3 from chromosome... 40 4.8
19gb|AC110818.5| Mus musculus BAC clone RP23-198H8 from 16, comple... 40 4.8
20gb|AC104581.22| Homo sapiens chromosome 17, clone RP11-1099M24, ... 40 4.8
21dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.8
22dbj|AP004752.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.8
23emb|AL138995.5|CNS01DX0 Human chromosome 14 DNA sequence BAC C-2... 40 4.8
24emb|AL772300.10| Zebrafish DNA sequence from clone CH211-165G14,... 40 4.8

>gb|AC117262.2| Mus musculus BAC clone RP24-537M7 from 2, complete sequence
          Length = 156547

 Score = 46.1 bits (23), Expect = 0.077
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 214   agattgagatggcattgtgtatt 236
             |||||||||||||||||||||||
Sbjct: 21757 agattgagatggcattgtgtatt 21779



to top

>gb|AC107781.9| Mus musculus, clone RP23-56O1, complete sequence
          Length = 174437

 Score = 46.1 bits (23), Expect = 0.077
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 93    tggcttgtaactgcaccgtgggaaaat 119
             ||||||||||||||||| |||||||||
Sbjct: 25496 tggcttgtaactgcaccatgggaaaat 25522



to top

>emb|BX284649.14| Mouse DNA sequence from clone RP23-42M7 on chromosome 2, complete
             sequence
          Length = 127220

 Score = 46.1 bits (23), Expect = 0.077
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 214   agattgagatggcattgtgtatt 236
             |||||||||||||||||||||||
Sbjct: 69699 agattgagatggcattgtgtatt 69677



to top

>gb|BT016143.1| Drosophila melanogaster AT25839 full insert cDNA
          Length = 4096

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 78  cgacgcaggtgtggctggctt 98
           |||||||||||||||||||||
Sbjct: 790 cgacgcaggtgtggctggctt 810



to top

>gb|AC146045.3| Pan troglodytes BAC clone RP43-14B22 from 7, complete sequence
          Length = 151553

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 202   ttgatcaggattagattgaga 222
             |||||||||||||||||||||
Sbjct: 73064 ttgatcaggattagattgaga 73084



to top

>gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome 19, complete sequence
          Length = 186595

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 324   acagaaaaacaaaaatgctat 344
             |||||||||||||||||||||
Sbjct: 98134 acagaaaaacaaaaatgctat 98114



to top

>gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complete sequence
          Length = 216521

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 324    acagaaaaacaaaaatgctat 344
              |||||||||||||||||||||
Sbjct: 200169 acagaaaaacaaaaatgctat 200189



to top

>emb|AL592221.6| Human DNA sequence from clone RP11-216F5 on chromosome 9, complete
              sequence
          Length = 154827

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 202    ttgatcaggattagattgaga 222
              |||||||||||||||||||||
Sbjct: 145667 ttgatcaggattagattgaga 145647



to top

>emb|AL360175.18| Human DNA sequence from clone RP11-524K22 on chromosome 6 Contains a
             novel gene, complete sequence
          Length = 58166

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 326   agaaaaacaaaaatgctattt 346
             |||||||||||||||||||||
Sbjct: 13760 agaaaaacaaaaatgctattt 13740



to top

>emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on chromosome 10p11.1-11.23
             Contains the 3' end of the APBB1IP gene for amyloid beta
             (A4) precursor protein-binding family B member 1
             interacting protein and two novel genes, complete sequence
          Length = 144666

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 183   atattttgtggatgaggtgttgatc 207
             ||||| |||||||||||||||||||
Sbjct: 93118 atattctgtggatgaggtgttgatc 93142



to top

>ref|NM_165630.1| Drosophila melanogaster sec31 CG8266-RB, transcript variant B
           (sec31), mRNA
          Length = 4047

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 78  cgacgcaggtgtggctggctt 98
           |||||||||||||||||||||
Sbjct: 770 cgacgcaggtgtggctggctt 790



to top

>ref|NM_136570.2| Drosophila melanogaster sec31 CG8266-RA, transcript variant A
           (sec31), mRNA
          Length = 4044

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 78  cgacgcaggtgtggctggctt 98
           |||||||||||||||||||||
Sbjct: 770 cgacgcaggtgtggctggctt 790



to top

>gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, region 44F-45A, BAC clone
             BACR02C23, complete sequence
          Length = 168601

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 78    cgacgcaggtgtggctggctt 98
             |||||||||||||||||||||
Sbjct: 87725 cgacgcaggtgtggctggctt 87745



to top

>gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosome 19, complete sequence
          Length = 215073

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 324    acagaaaaacaaaaatgctat 344
              |||||||||||||||||||||
Sbjct: 162375 acagaaaaacaaaaatgctat 162355



to top

>gb|AC003668.2| Homo sapiens X PAC RP1-233D13 (Roswell Park Cancer Institute Human PAC
             Library ) complete sequence
          Length = 145859

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 202   ttgatcaggattagattgaga 222
             |||||||||||||||||||||
Sbjct: 67155 ttgatcaggattagattgaga 67135



to top

>gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15 of 73 of the complete
              sequence
          Length = 271696

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 78     cgacgcaggtgtggctggctt 98
              |||||||||||||||||||||
Sbjct: 100845 cgacgcaggtgtggctggctt 100865



to top

>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence
          Length = 187098

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 237   tgtgttgatacatttttgtt 256
             ||||||||||||||||||||
Sbjct: 51064 tgtgttgatacatttttgtt 51083



to top

>gb|AC123948.4| Mus musculus BAC clone RP23-105C3 from chromosome 10, complete sequence
          Length = 214819

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 291   tgttgctttggttgatattc 310
             ||||||||||||||||||||
Sbjct: 93165 tgttgctttggttgatattc 93146



to top

>gb|AC110818.5| Mus musculus BAC clone RP23-198H8 from 16, complete sequence
          Length = 182807

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 213   tagattgagatggcattgtgtatt 236
             |||||||||||||||| |||||||
Sbjct: 39875 tagattgagatggcatggtgtatt 39852



to top

>gb|AC104581.22| Homo sapiens chromosome 17, clone RP11-1099M24, complete sequence
          Length = 187718

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    gtgacagaaaaacaaaaatg 340
              ||||||||||||||||||||
Sbjct: 129020 gtgacagaaaaacaaaaatg 129001



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 195    tgaggtgttgatcaggattagatt 218
              ||||||||| ||||||||||||||
Sbjct: 640616 tgaggtgttaatcaggattagatt 640639



to top

>dbj|AP004752.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0501G04
          Length = 156603

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 195    tgaggtgttgatcaggattagatt 218
              ||||||||| ||||||||||||||
Sbjct: 118669 tgaggtgttaatcaggattagatt 118692



to top

>emb|AL138995.5|CNS01DX0 Human chromosome 14 DNA sequence BAC C-2588E21 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 163312

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 324    acagaaaaacaaaaatgcta 343
              ||||||||||||||||||||
Sbjct: 148951 acagaaaaacaaaaatgcta 148932



to top

>emb|AL772300.10| Zebrafish DNA sequence from clone CH211-165G14, complete sequence
          Length = 155951

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 302  ttgatattcgcttgagaacgtgac 325
            ||||| ||||||||||||||||||
Sbjct: 6936 ttgatgttcgcttgagaacgtgac 6959


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,042,735
Number of Sequences: 3902068
Number of extensions: 4042735
Number of successful extensions: 71804
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71744
Number of HSP's gapped (non-prelim): 60
length of query: 358
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 336
effective length of database: 17,147,199,772
effective search space: 5761459123392
effective search space used: 5761459123392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top