| Clone Name | baal34c20 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF227240.1|AF227240 Rabbit oral papillomavirus, complete genome Length = 7565 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 427 gcagagctgctccacaagacatt 449 ||||||||||||||||||||||| Sbjct: 4252 gcagagctgctccacaagacatt 4274
>gb|M19497.1|RAPO1 Rabbit oral papillomavirus DNA fragment with E2 and E4 protein gene homologues Length = 1519 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 427 gcagagctgctccacaagacatt 449 ||||||||||||||||||||||| Sbjct: 875 gcagagctgctccacaagacatt 897
>ref|XM_720090.1| Plasmodium yoelii yoelii str. 17XNL neurofilament protein H form H2 (PY04830) partial mRNA Length = 2436 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 tgcttctacttctactggtga 469 ||||||||||||||||||||| Sbjct: 2001 tgcttctacttctactggtga 1981 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 tgcttctacttctactggtga 469 ||||||||||||||||||||| Sbjct: 1965 tgcttctacttctactggtga 1945 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 tgcttctacttctactggtga 469 ||||||||||||||||||||| Sbjct: 1929 tgcttctacttctactggtga 1909 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 tgcttctacttctactggtga 469 ||||||||||||||||||||| Sbjct: 1893 tgcttctacttctactggtga 1873 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 tgcttctacttctactggtga 469 ||||||||||||||||||||| Sbjct: 1785 tgcttctacttctactggtga 1765 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 tgcttctacttctactggtga 469 ||||||||||||||||||||| Sbjct: 1659 tgcttctacttctactggtga 1639
>gb|AC150391.2| Branchiostoma floridae clone CH302-119J21, complete sequence Length = 157607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 445 acattgcttctacttctact 464 |||||||||||||||||||| Sbjct: 81041 acattgcttctacttctact 81060
>gb|AY234384.1|AY234384S1 Rubrivivax gelatinosus strain S1 5' region photosynthesis gene cluster, partial sequence Length = 24637 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 358 cggtggcggcgctgacgcgc 377 |||||||||||||||||||| Sbjct: 12071 cggtggcggcgctgacgcgc 12090
>gb|AC159991.9| Mus musculus chromosome 1, clone RP23-413H17, complete sequence Length = 180715 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 343 tgttcctgagctccacggtg 362 |||||||||||||||||||| Sbjct: 97617 tgttcctgagctccacggtg 97636
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome Length = 1827111 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 ttgatgatgatactgctatg 317 |||||||||||||||||||| Sbjct: 312494 ttgatgatgatactgctatg 312513
>ref|XM_745197.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g05410) partial mRNA Length = 1854 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 agttcctcttgttcctgagc 353 |||||||||||||||||||| Sbjct: 557 agttcctcttgttcctgagc 538
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 358 cggtggcggcgctgacgcgc 377 |||||||||||||||||||| Sbjct: 96179 cggtggcggcgctgacgcgc 96198
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 358 cggtggcggcgctgacgcgc 377 |||||||||||||||||||| Sbjct: 7081 cggtggcggcgctgacgcgc 7100
>emb|BX640416.1| Bordetella pertussis strain Tohama I, complete genome; segment 6/12 Length = 349354 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 358 cggtggcggcgctgacgcgc 377 |||||||||||||||||||| Sbjct: 291999 cggtggcggcgctgacgcgc 292018
>dbj|AB243297.1| Rhizosolenia setigera RNA virus RsRNAV ORF-1, RsRNAV ORF-2 genes for polyprotein, capsid proteins, complete cds Length = 8877 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 tgatgatgatactgctatgg 318 |||||||||||||||||||| Sbjct: 1425 tgatgatgatactgctatgg 1444
>gb|AC110616.4| Homo sapiens BAC clone RP11-597I10 from 4, complete sequence Length = 80656 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 439 cacaagacattgcttctacttcta 462 |||||||||||||||| ||||||| Sbjct: 43690 cacaagacattgcttccacttcta 43667
>ref|NM_205829.1| Xenopus tropicalis hypothetical protein MGC75848 (MGC75848), mRNA Length = 2099 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atggatcaacttgatgatga 307 |||||||||||||||||||| Sbjct: 727 atggatcaacttgatgatga 746
>gb|BC066129.1| Xenopus tropicalis hypothetical protein MGC75848, mRNA (cDNA clone MGC:75848 IMAGE:5382660), complete cds Length = 2099 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atggatcaacttgatgatga 307 |||||||||||||||||||| Sbjct: 727 atggatcaacttgatgatga 746
>emb|CR761091.2| Xenopus tropicalis finished cDNA, clone TEgg073i18 Length = 2003 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atggatcaacttgatgatga 307 |||||||||||||||||||| Sbjct: 679 atggatcaacttgatgatga 698 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,415,658 Number of Sequences: 3902068 Number of extensions: 3415658 Number of successful extensions: 55179 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 55131 Number of HSP's gapped (non-prelim): 48 length of query: 485 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 463 effective length of database: 17,147,199,772 effective search space: 7939153494436 effective search space used: 7939153494436 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)