ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal34b04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_474191.1| Oryza sativa (japonica cultivar-group), predic... 48 0.034
2emb|AL662953.3|OSJN00153 Oryza sativa genomic DNA, chromosome 4,... 48 0.034
3gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence 48 0.034
4dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.034
5dbj|AK067399.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.034
6gb|AC183539.2| Pan troglodytes BAC clone CH251-340H7 from chromo... 42 2.1
7gb|AC121286.7| Mus musculus chromosome 12, clone RP23-36H21, com... 42 2.1
8gb|AC009652.14| Homo sapiens chromosome 11, clone RP11-428C19, c... 42 2.1
9gb|AC027026.11| Homo sapiens chromosome 11, clone RP11-589F4, co... 42 2.1
10gb|AC087241.11| Homo sapiens 12 BAC RP11-268P4 (Roswell Park Can... 42 2.1
11gb|AC055876.16| Homo sapiens chromosome 15, clone RP11-578F21, c... 42 2.1
12gb|AC153859.6| Mus musculus 10 BAC RP23-135F12 (Roswell Park Can... 42 2.1
13gb|AC005747.1|AC005747 Homo sapiens chromosome 17, clone hRPK.15... 42 2.1
14gb|AC153645.4| Mus musculus BAC clone RP24-534E8 from chromosome... 40 8.3
15gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 40 8.3
16gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, com... 40 8.3
17gb|AY360393.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.3
18gb|AY360394.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.3
19gb|AC008092.4| Drosophila melanogaster clone BACR22F22, complete... 40 8.3
20gb|AE017335.3| Bacillus anthracis str. 'Ames Ancestor' plasmid p... 40 8.3
21gb|AC147216.3| Pan troglodytes BAC clone RP43-156I12 from 7, com... 40 8.3
22gb|AC131710.3| Mus musculus BAC clone RP23-187M22 from 15, compl... 40 8.3
23gb|AF188935.1| Bacillus anthracis plasmid pXO2, complete sequence 40 8.3
24gb|AC091153.10| Homo sapiens chromosome 17, clone RP11-314A20, c... 40 8.3
25emb|AL049611.24|HSJ180E22 Human DNA sequence from clone RP1-180E... 40 8.3
26ref|XM_787580.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.3
27gb|AC027820.12| Homo sapiens chromosome 17, clone RP11-198F11, c... 40 8.3
28gb|AC156575.3| Mus musculus BAC clone RP23-4P20 from chromosome ... 40 8.3
29emb|CR933018.9| Zebrafish DNA sequence from clone CH211-224H1 in... 40 8.3
30gb|AC025888.8| Homo sapiens chromosome 18, clone RP11-479H18, co... 40 8.3
31gb|AE011191.1| Bacillus anthracis str. A2012 plasmid pXO2, compl... 40 8.3
32gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, co... 40 8.3
33gb|AC010767.7| Homo sapiens chromosome 17, clone RP11-188K10, co... 40 8.3
34dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.3
35gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, comple... 40 8.3
36gb|AC018553.6| Homo sapiens chromosome 16 clone RP11-434E6, comp... 40 8.3
37gb|AC007343.7| Homo sapiens chromosome 16 clone RP11-463J22, com... 40 8.3
38dbj|AP004458.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.3
39emb|BX897671.5| Zebrafish DNA sequence from clone CH211-214K5 in... 40 8.3
40gb|AE003676.4| Drosophila melanogaster chromosome 3R, section 14... 40 8.3
41gb|AC104898.9| Mus musculus chromosome 8, clone RP23-300I4, comp... 40 8.3
42gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1... 40 8.3
43gb|U02535.1|BAU02535 Bacillus anthracis plasmid pX02 positive tr... 40 8.3 
>ref|XM_474191.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1326

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 166 gaaaaggccaagggaaaacattctggattaaacctatattcaaagcaatggg 217
           |||||||||||||||||||||||  || | ||| |||||| | |||||||||
Sbjct: 542 gaaaaggccaagggaaaacattccagactgaacttatatttagagcaatggg 593
to top
>emb|AL662953.3|OSJN00153 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011F23,
             complete sequence
          Length = 149353

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 166   gaaaaggccaagggaaaacattctggattaaacctatattcaaagcaatggg 217
             |||||||||||||||||||||||  || | ||| |||||| | |||||||||
Sbjct: 43036 gaaaaggccaagggaaaacattccagactgaacttatatttagagcaatggg 42985
to top
>gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence
          Length = 181577

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 166   gaaaaggccaagggaaaacattctggattaaacctatattcaaagcaatggg 217
             |||||||||||||||||||||||  || | ||| |||||| | |||||||||
Sbjct: 43229 gaaaaggccaagggaaaacattccagactgaacttatatttagagcaatggg 43178
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                    
Query: 166      gaaaaggccaagggaaaacattctggattaaacctatattcaaagcaatggg 217
                |||||||||||||||||||||||  || | ||| |||||| | |||||||||
Sbjct: 33611976 gaaaaggccaagggaaaacattccagactgaacttatatttagagcaatggg 33611925
to top
>dbj|AK067399.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106M01, full
           insert sequence
          Length = 1693

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 166 gaaaaggccaagggaaaacattctggattaaacctatattcaaagcaatggg 217
           |||||||||||||||||||||||  || | ||| |||||| | |||||||||
Sbjct: 612 gaaaaggccaagggaaaacattccagactgaacttatatttagagcaatggg 663
to top
>gb|AC183539.2| Pan troglodytes BAC clone CH251-340H7 from chromosome 15, complete
              sequence
          Length = 155024

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 564    tttgtatatgtattgtatagt 584
              |||||||||||||||||||||
Sbjct: 105863 tttgtatatgtattgtatagt 105843
to top
>gb|AC121286.7| Mus musculus chromosome 12, clone RP23-36H21, complete sequence
          Length = 227648

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    aatggggtcaaatggaaaaaa 232
              |||||||||||||||||||||
Sbjct: 134744 aatggggtcaaatggaaaaaa 134764
to top
>gb|AC009652.14| Homo sapiens chromosome 11, clone RP11-428C19, complete sequence
          Length = 200823

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 44     cctgtctccatctccacaact 64
              |||||||||||||||||||||
Sbjct: 151620 cctgtctccatctccacaact 151600
to top
>gb|AC027026.11| Homo sapiens chromosome 11, clone RP11-589F4, complete sequence
          Length = 155376

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 44     cctgtctccatctccacaact 64
              |||||||||||||||||||||
Sbjct: 131523 cctgtctccatctccacaact 131543
to top
>gb|AC087241.11| Homo sapiens 12 BAC RP11-268P4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 146000

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 507   tatcttagtggttgtattcatcaat 531
             |||||||||||||||||| ||||||
Sbjct: 73489 tatcttagtggttgtatttatcaat 73465
to top
>gb|AC055876.16| Homo sapiens chromosome 15, clone RP11-578F21, complete sequence
          Length = 192533

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 564    tttgtatatgtattgtatagt 584
              |||||||||||||||||||||
Sbjct: 143313 tttgtatatgtattgtatagt 143333
to top
>gb|AC153859.6| Mus musculus 10 BAC RP23-135F12 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 222182

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 216   gggtcaaatggaaaaaagtag 236
             |||||||||||||||||||||
Sbjct: 54516 gggtcaaatggaaaaaagtag 54536
to top
>gb|AC005747.1|AC005747 Homo sapiens chromosome 17, clone hRPK.150_K_15, complete sequence
          Length = 166701

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 323    aagacttggtctgtttcatag 343
              |||||||||||||||||||||
Sbjct: 115355 aagacttggtctgtttcatag 115375
to top
>gb|AC153645.4| Mus musculus BAC clone RP24-534E8 from chromosome 13, complete sequence
          Length = 182805

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    aacctatattcaaagcaatg 215
              ||||||||||||||||||||
Sbjct: 119222 aacctatattcaaagcaatg 119241
to top
>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
            sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 196  aacctatattcaaagcaatg 215
            ||||||||||||||||||||
Sbjct: 5367 aacctatattcaaagcaatg 5386
to top
>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 190857

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 480    tatatgttgaatacaagtgc 499
              ||||||||||||||||||||
Sbjct: 108138 tatatgttgaatacaagtgc 108157
to top
>gb|AY360393.2| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0096K16,
             complete sequence
          Length = 164501

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 435   ttagtggttgtagctaactt 454
             ||||||||||||||||||||
Sbjct: 53038 ttagtggttgtagctaactt 53057
to top
>gb|AY360394.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0070J19,
             complete sequence
          Length = 158749

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 435   ttagtggttgtagctaactt 454
             ||||||||||||||||||||
Sbjct: 10209 ttagtggttgtagctaactt 10190
to top
>gb|AC008092.4| Drosophila melanogaster clone BACR22F22, complete sequence
          Length = 175045

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    aaaaggccaagggaaaacat 186
              ||||||||||||||||||||
Sbjct: 112784 aaaaggccaagggaaaacat 112765
to top
>gb|AE017335.3| Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence
          Length = 94830

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   tcaaatggaaaaaagtagca 238
             ||||||||||||||||||||
Sbjct: 68157 tcaaatggaaaaaagtagca 68176
to top
>gb|AC147216.3| Pan troglodytes BAC clone RP43-156I12 from 7, complete sequence
          Length = 199965

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 473   aatcttctatatgttgaata 492
             ||||||||||||||||||||
Sbjct: 32347 aatcttctatatgttgaata 32366
to top
>gb|AC131710.3| Mus musculus BAC clone RP23-187M22 from 15, complete sequence
          Length = 224591

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 420    aacatatgtatttccttagt 439
              ||||||||||||||||||||
Sbjct: 177664 aacatatgtatttccttagt 177645
to top
>gb|AF188935.1| Bacillus anthracis plasmid pXO2, complete sequence
          Length = 96231

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   tcaaatggaaaaaagtagca 238
             ||||||||||||||||||||
Sbjct: 68627 tcaaatggaaaaaagtagca 68646
to top
>gb|AC091153.10| Homo sapiens chromosome 17, clone RP11-314A20, complete sequence
          Length = 195494

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   cctgaaccacccctgtctcc 52
            ||||||||||||||||||||
Sbjct: 8249 cctgaaccacccctgtctcc 8230
to top
>emb|AL049611.24|HSJ180E22 Human DNA sequence from clone RP1-180E22 on chromosome 6p11.2-12.3
             Contains the 3' part of the gene for a novel protein with
             possible Calmodulin like calcium-binding domains, the gene
             for a TRAM-like protein (KIAA0057),  part of a novel gene
             and a CpG island, complete sequence
          Length = 109813

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 243   ggagatgttatggcttttgt 262
             ||||||||||||||||||||
Sbjct: 98747 ggagatgttatggcttttgt 98766
to top
>ref|XM_787580.1| PREDICTED: Strongylocentrotus purpuratus similar to scribble isoform
            b (LOC587871), mRNA
          Length = 1647

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 208  aagcaatggggtcaaatggaaaaa 231
            ||||||||||||||| ||||||||
Sbjct: 1401 aagcaatggggtcaattggaaaaa 1424
to top
>gb|AC027820.12| Homo sapiens chromosome 17, clone RP11-198F11, complete sequence
          Length = 154353

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    cctgaaccacccctgtctcc 52
             ||||||||||||||||||||
Sbjct: 47837 cctgaaccacccctgtctcc 47818
to top
>gb|AC156575.3| Mus musculus BAC clone RP23-4P20 from chromosome 13, complete sequence
          Length = 196560

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 452   cttgagtgaagtaaactaat 471
             ||||||||||||||||||||
Sbjct: 57939 cttgagtgaagtaaactaat 57958
to top
>emb|CR933018.9| Zebrafish DNA sequence from clone CH211-224H1 in linkage group 4,
             complete sequence
          Length = 181431

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 144   atggaaaaatgtttcagggg 163
             ||||||||||||||||||||
Sbjct: 40739 atggaaaaatgtttcagggg 40720
to top
>gb|AC025888.8| Homo sapiens chromosome 18, clone RP11-479H18, complete sequence
          Length = 178201

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 521   tattcatcaatggtgtcttgtgatgaat 548
             ||||| ||||||||||||| ||||||||
Sbjct: 50211 tattcttcaatggtgtcttttgatgaat 50238
to top
>gb|AE011191.1| Bacillus anthracis str. A2012 plasmid pXO2, complete sequence
          Length = 94829

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   tcaaatggaaaaaagtagca 238
             ||||||||||||||||||||
Sbjct: 68156 tcaaatggaaaaaagtagca 68175
to top
>gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, complete sequence
          Length = 143557

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    ccacccctgtctccatctcc 58
             ||||||||||||||||||||
Sbjct: 63378 ccacccctgtctccatctcc 63359
to top
>gb|AC010767.7| Homo sapiens chromosome 17, clone RP11-188K10, complete sequence
          Length = 184952

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 409   acttgtatattaacatatgtattt 432
             |||||||| |||||||||||||||
Sbjct: 51144 acttgtattttaacatatgtattt 51121
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 435      ttagtggttgtagctaactt 454
                ||||||||||||||||||||
Sbjct: 12383626 ttagtggttgtagctaactt 12383645
to top
>gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, complete sequence
          Length = 191827

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    aagggaaaacattctggatt 194
              ||||||||||||||||||||
Sbjct: 128790 aagggaaaacattctggatt 128771
to top
>gb|AC018553.6| Homo sapiens chromosome 16 clone RP11-434E6, complete sequence
          Length = 172315

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 541    tgatgaatacaagagcacaa 560
              ||||||||||||||||||||
Sbjct: 120473 tgatgaatacaagagcacaa 120454
to top
>gb|AC007343.7| Homo sapiens chromosome 16 clone RP11-463J22, complete sequence
          Length = 186732

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 541   tgatgaatacaagagcacaa 560
             ||||||||||||||||||||
Sbjct: 58558 tgatgaatacaagagcacaa 58539
to top
>dbj|AP004458.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0045D08
          Length = 160541

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 435    ttagtggttgtagctaactt 454
              ||||||||||||||||||||
Sbjct: 142275 ttagtggttgtagctaactt 142294
to top
>emb|BX897671.5| Zebrafish DNA sequence from clone CH211-214K5 in linkage group 4,
              complete sequence
          Length = 201108

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 144    atggaaaaatgtttcagggg 163
              ||||||||||||||||||||
Sbjct: 171684 atggaaaaatgtttcagggg 171703
to top
>gb|AE003676.4| Drosophila melanogaster chromosome 3R, section 14 of 118 of the
             complete sequence
          Length = 267607

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   aaaaggccaagggaaaacat 186
             ||||||||||||||||||||
Sbjct: 69618 aaaaggccaagggaaaacat 69599
to top
>gb|AC104898.9| Mus musculus chromosome 8, clone RP23-300I4, complete sequence
          Length = 181370

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 425    atgtatttccttagtggttgtagc 448
              ||||||||||| ||||||||||||
Sbjct: 122533 atgtatttcctgagtggttgtagc 122556
to top
>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 207    aaagcaatggggtcaaatggaaaa 230
              |||||||| |||||||||||||||
Sbjct: 789037 aaagcaatcgggtcaaatggaaaa 789014
to top
>gb|U02535.1|BAU02535 Bacillus anthracis plasmid pX02 positive trans-activator of capsule
           synthesis (acpA) gene, complete cds
          Length = 2289

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 219 tcaaatggaaaaaagtagca 238
           ||||||||||||||||||||
Sbjct: 147 tcaaatggaaaaaagtagca 166


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,940,378
Number of Sequences: 3902068
Number of extensions: 6940378
Number of successful extensions: 128209
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 128018
Number of HSP's gapped (non-prelim): 191
length of query: 609
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 586
effective length of database: 17,143,297,704
effective search space: 10045972454544
effective search space used: 10045972454544
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top