ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal32p02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_468556.1| Oryza sativa (japonica cultivar-group), mRNA 153 6e-34
2gb|AY324384.1| Oryza sativa (japonica cultivar-group) callose sy... 153 6e-34
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 153 6e-34
4dbj|AP005290.2| Oryza sativa (japonica cultivar-group) genomic D... 153 6e-34
5dbj|AP004082.3| Oryza sativa (japonica cultivar-group) genomic D... 153 6e-34
6dbj|AK105109.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 6e-34
7gb|DQ086484.1| Triticum aestivum putative 1,3-beta-glucan syntha... 117 3e-23
8dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
9dbj|AP005750.3| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
10dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
11ref|NM_193211.1| Oryza sativa (japonica cultivar-group), predic... 109 8e-21
12dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 109 8e-21
13dbj|AP003447.2| Oryza sativa (japonica cultivar-group) genomic D... 109 8e-21
14dbj|AP003445.2| Oryza sativa (japonica cultivar-group) genomic D... 109 8e-21
15gb|AY107727.1| Zea mays PCO075555 mRNA sequence 109 8e-21
16gb|AY108207.1| Zea mays PCO082315 mRNA sequence 103 5e-19
17ref|NM_193203.1| Oryza sativa (japonica cultivar-group), predic... 101 2e-18
18dbj|AK064446.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
19dbj|AP007257.2| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
20dbj|AP007226.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
21ref|NM_179622.2| Arabidopsis thaliana 1,3-beta-glucan synthase A... 70 7e-09
22ref|NM_179847.1| Arabidopsis thaliana ATGSL03 (GLUCAN SYNTHASE-L... 70 7e-09
23gb|AY337762.1| Arabidopsis thaliana LAP1 (At2g13680) mRNA, compl... 70 7e-09
24gb|AC007063.6| Arabidopsis thaliana chromosome 2 clone T10F5 map... 70 7e-09
25gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J11 ma... 70 7e-09
26gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 ma... 70 7e-09
27tpg|BK001470.1| TPA: TPA_exp: Arabidopsis thaliana callose synth... 70 7e-09
28dbj|AK117353.1| Arabidopsis thaliana At2g31960 mRNA for putative... 70 7e-09
29gb|DQ086487.1| Triticum aestivum putative 1,3-beta-glucan syntha... 64 4e-07
30emb|BX819158.1|CNS0A8YL Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
31gb|AF304372.2| Nicotiana alata putative beta-1,3-glucan synthase... 50 0.007
32ref|NM_100528.1| Arabidopsis thaliana ATGSL07 (GLUCAN SYNTHASE-L... 48 0.026
33gb|AC007592.4|AC007592 Genomic sequence for Arabidopsis thaliana... 48 0.026
34gb|AC153357.4| Mus musculus BAC clone RP24-124N8 from chromosome... 44 0.41
35ref|NM_100436.2| Arabidopsis thaliana CALS1 (CALLOSE SYNTHASE 1)... 44 0.41
36gb|AC091763.25| Mus musculus strain C57BL/6J clone rp23-198o2 ma... 44 0.41
37dbj|AK046085.1| Mus musculus adult male corpora quadrigemina cDN... 44 0.41
38gb|AF237733.1|AF237733 Arabidopsis thaliana callose synthase 1 c... 44 0.41
39gb|AC005106.2|AC005106 Genomic sequence for Arabidopsis thaliana... 44 0.41
40gb|AC140381.3| Mus musculus BAC clone RP23-176M4 from 10, comple... 44 0.41
41emb|AL353194.13| Human DNA sequence from clone RP11-119B16 on ch... 44 0.41
42emb|CT033787.9| Mouse DNA sequence from clone RP24-86C3 on chrom... 44 0.41
43gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genom... 44 0.41
44gb|DQ112034.1| Perna viridis clone PV104 microsatellite sequence 42 1.6
45gb|AC114637.9| Mus musculus chromosome 3, clone RP24-119G15, com... 42 1.6
46gb|AC147090.3| Pan troglodytes BAC clone RP43-58D11 from 7, comp... 42 1.6
47gb|AC122794.3| Mus musculus BAC clone RP24-202L5 from chromosome... 42 1.6
48gb|AC142294.1| Pan troglodytes BAC clone RP43-73M4 from 7, compl... 42 1.6
49emb|CR846094.7| Zebrafish DNA sequence from clone CH211-264F16 i... 42 1.6
50gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1... 42 1.6
51gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA... 42 1.6
52gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N... 42 1.6
53emb|AL137069.15| Human DNA sequence from clone RP11-167C5 on chr... 42 1.6
54gb|AC066616.7| Homo sapiens chromosome 15 clone RP11-925D8 map 1... 42 1.6
55gb|AC118343.1| Homo sapiens chromosome 19 clone LLNLR-234A10, co... 42 1.6
56gb|AC104657.2| Homo sapiens BAC clone RP11-567F17 from 4, comple... 42 1.6
57gb|AC092313.2| Homo sapiens chromosome 19 clone LLNLR-293G8, com... 42 1.6
58gb|AC093234.2| Homo sapiens chromosome 19 clone LLNLR-266A8, com... 42 1.6
59emb|AL079305.3|CNS00M8M Human chromosome 14 DNA sequence BAC R-3... 42 1.6
60gb|AC008734.7| Homo sapiens chromosome 19 clone CTD-2529P6, comp... 42 1.6
61dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond... 42 1.6
62gb|AY787127.1| Homo sapiens clone B_018-023_B3 SPANX-B gene, com... 40 6.4
63gb|AY293806.1| Paraurostyla weissei macronuclear DNA polymerase ... 40 6.4
64gb|AY293805.1| Paraurostyla weissei micronuclear DNA polymerase ... 40 6.4
65gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, co... 40 6.4
66gb|AC153607.15| Mus musculus 6 BAC RP23-100I21 (Roswell Park Can... 40 6.4
67gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 6.4
68gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.4
69gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, c... 40 6.4
70gb|AC149231.2| Pan troglodytes BAC clone CH251-481H1 from 7, com... 40 6.4
71gb|AC120397.7| Mus musculus chromosome 18, clone RP24-332E21, co... 40 6.4
72gb|AC147094.2| Pan troglodytes BAC clone RP43-52H15 from 7, comp... 40 6.4
73gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosom... 40 6.4
74gb|AY915763.1| Schistosoma japonicum SJCHGC09682 protein mRNA, p... 40 6.4
75gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com... 40 6.4
76gb|AC158652.5| Mus musculus 6 BAC RP23-238I17 (Roswell Park Canc... 40 6.4
77gb|AC114643.9| Mus musculus chromosome 6, clone RP24-127D6, comp... 40 6.4
78gb|AC133607.3| Mus musculus BAC clone RP23-153N7 from chromosome... 40 6.4
79gb|AC103610.9| Mus musculus chromosome 9, clone RP23-364M24, com... 40 6.4
80gb|AC132085.3| Mus musculus BAC clone RP24-550M24 from chromosom... 40 6.4
81gb|AC122530.3| Mus musculus BAC clone RP24-531C7 from chromosome... 40 6.4
82gb|AC123801.4| Mus musculus BAC clone RP24-374A1 from chromosome... 40 6.4
83gb|AC123823.3| Mus musculus BAC clone RP24-63C11 from chromosome... 40 6.4
84gb|AC128671.4| Mus musculus BAC clone RP23-247F12 from 18, compl... 40 6.4
85gb|AC136903.6| Mus musculus chromosome 9, clone RP23-475J16, com... 40 6.4
86gb|AC153143.4| Mus musculus BAC clone RP23-241N10 from chromosom... 40 6.4
87gb|AC166347.2| Mus musculus BAC clone RP24-87G12 from chromosome... 40 6.4
88gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosom... 40 6.4
89emb|CR376761.19| Zebrafish DNA sequence from clone DKEY-6F24 in ... 40 6.4
90emb|AL451048.13| Human DNA sequence from clone RP11-298A8 on chr... 40 6.4
91emb|AL354747.12| Human DNA sequence from clone RP11-362D13 on ch... 40 6.4
92gb|AC158213.4| Mus musculus chromosome 7, clone RP24-253H20, com... 40 6.4
93gb|AC105600.5| Rattus norvegicus 4 BAC CH230-209E1 (Children's H... 40 6.4
94emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chr... 40 6.4
95emb|AL590625.16| Mouse DNA sequence from clone RP23-467M8 on chr... 40 6.4
96emb|BX649467.5| Zebrafish DNA sequence from clone CH211-117L16 i... 40 6.4
97gb|DQ099285.1| Arachis hypogaea clone Ah-408 microsatellite sequ... 40 6.4
98gb|AC099789.2| Homo sapiens chromosome 1 clone RP11-377K22, comp... 40 6.4
99gb|AC106740.3| Homo sapiens chromosome 5 clone RP11-100E22, comp... 40 6.4
100gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q... 40 6.4
101gb|AC010371.7| Homo sapiens chromosome 5 clone CTD-2049O13, comp... 40 6.4
102gb|DQ205696.1| Etheostoma caeruleum clone Eca22EPA microsatellit... 40 6.4
103gb|AC069411.21| Homo sapiens 3 BAC RP11-609K13 (Roswell Park Can... 40 6.4
104gb|AC159204.2| Mus musculus BAC clone RP23-229H13 from chromosom... 40 6.4
105gb|AC154485.2| Mus musculus BAC clone RP24-117M9 from chromosome... 40 6.4
106dbj|AK039876.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 40 6.4
107dbj|AK047258.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 6.4
108emb|BX255929.7| Zebrafish DNA sequence from clone CH211-271P5 in... 40 6.4
109gb|AC157089.5| Mus musculus 10 BAC RP24-339G14 (Roswell Park Can... 40 6.4
110gb|AC107301.10| Homo sapiens 3 BAC RP11-544A22 (Roswell Park Can... 40 6.4
111gb|AC126614.8| Homo sapiens 12 BAC RP11-756H6 (Roswell Park Canc... 40 6.4
112gb|AC083875.1|AC083875 Homo sapiens chromosome 7 clone RP11-699P... 40 6.4
113gb|AC079244.29| Mus musculus strain C57BL/6J chromosome 9 clone ... 40 6.4
114gb|AC092181.9| Homo sapiens 3 BAC RP11-735O9 (Roswell Park Cance... 40 6.4
115dbj|AP004000.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
116dbj|AP003990.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
117emb|AL929270.14| Mouse DNA sequence from clone RP23-100K15 on ch... 40 6.4
118gb|AC153941.3| Mus musculus 10 BAC RP24-403F8 (Roswell Park Canc... 40 6.4
119emb|CR937049.3| CH230-323M7, complete sequence 40 6.4
120emb|CR925800.7| Zebrafish DNA sequence from clone ZFOS-476E6 in ... 40 6.4
121emb|AL356804.4|CNS05TDM Human chromosome 14 DNA sequence BAC R-7... 40 6.4
122gb|AC103664.12| Mus musculus chromosome 7, clone RP23-348F4, com... 40 6.4
123dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.4
124gb|AC132224.3| Mus musculus BAC clone RP24-554P12 from 1, comple... 40 6.4
125gb|AC134899.4| Mus musculus BAC clone RP24-81B7 from 6, complete... 40 6.4
126gb|AC141891.3| Mus musculus BAC clone RP23-378A8 from 6, complet... 40 6.4
127emb|BX927192.15| Zebrafish DNA sequence from clone DKEY-56M20 in... 40 6.4
128emb|AL935132.13| Mouse DNA sequence from clone RP23-8G23 on chro... 40 6.4
129emb|AL672051.14| Mouse DNA sequence from clone RP23-332O3 on chr... 40 6.4
130emb|AL672271.9| Mouse DNA sequence from clone RP23-450H23 on chr... 40 6.4
131emb|AL672287.12| Mouse DNA sequence from clone RP23-151I8 on chr... 40 6.4
132emb|AL844489.6| Mouse DNA sequence from clone RP23-101P8 on chro... 40 6.4
133emb|AL606967.14| Mouse DNA sequence from clone RP23-304D5 on chr... 40 6.4
134emb|AL732619.13| Mouse DNA sequence from clone RP23-122I3 on chr... 40 6.4
135dbj|AP001256.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 6.4

>ref|XM_468556.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 5910

 Score =  153 bits (77), Expect = 6e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                        
Query: 8    tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
            |||||||||| |||||||||||||||||||||||||| || ||||||||||| || || |
Sbjct: 5744 tcatggggctcctgctcttcaccccgatcgcgttcctcgcttggttcccgtttgtatccg 5803

                                                                        
Query: 68   agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
            ||||||||||  | |||||||||||||||||||||||| | ||||||||||||||| | |
Sbjct: 5804 agttccagaccagaatgctcttcaaccaggccttcagcagaggtctgcagatctcgcgaa 5863

                                     
Query: 128  tcctgggtgggcacaagaaggaccg 152
            |||| || || |||||||| |||||
Sbjct: 5864 tccttggcggccacaagaaagaccg 5888



to top

>gb|AY324384.1| Oryza sativa (japonica cultivar-group) callose synthase-like protein
            mRNA, partial cds
          Length = 2727

 Score =  153 bits (77), Expect = 6e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                        
Query: 8    tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
            |||||||||| |||||||||||||||||||||||||| || ||||||||||| || || |
Sbjct: 2561 tcatggggctcctgctcttcaccccgatcgcgttcctcgcttggttcccgtttgtatccg 2620

                                                                        
Query: 68   agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
            ||||||||||  | |||||||||||||||||||||||| | ||||||||||||||| | |
Sbjct: 2621 agttccagaccagaatgctcttcaaccaggccttcagcagaggtctgcagatctcgcgaa 2680

                                     
Query: 128  tcctgggtgggcacaagaaggaccg 152
            |||| || || |||||||| |||||
Sbjct: 2681 tccttggcggccacaagaaagaccg 2705



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  153 bits (77), Expect = 6e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                            
Query: 8        tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
                |||||||||| |||||||||||||||||||||||||| || ||||||||||| || || |
Sbjct: 35822467 tcatggggctcctgctcttcaccccgatcgcgttcctcgcttggttcccgtttgtatccg 35822526

                                                                            
Query: 68       agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
                ||||||||||  | |||||||||||||||||||||||| | ||||||||||||||| | |
Sbjct: 35822527 agttccagaccagaatgctcttcaaccaggccttcagcagaggtctgcagatctcgcgaa 35822586

                                         
Query: 128      tcctgggtgggcacaagaaggaccg 152
                |||| || || |||||||| |||||
Sbjct: 35822587 tccttggcggccacaagaaagaccg 35822611



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 356     tgtagtagtagtagtgtatg 375
               ||||||||||||||||||||
Sbjct: 4771245 tgtagtagtagtagtgtatg 4771226



to top

>dbj|AP005290.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1282_E10
          Length = 107284

 Score =  153 bits (77), Expect = 6e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                         
Query: 8     tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
             |||||||||| |||||||||||||||||||||||||| || ||||||||||| || || |
Sbjct: 13013 tcatggggctcctgctcttcaccccgatcgcgttcctcgcttggttcccgtttgtatccg 13072

                                                                         
Query: 68    agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
             ||||||||||  | |||||||||||||||||||||||| | ||||||||||||||| | |
Sbjct: 13073 agttccagaccagaatgctcttcaaccaggccttcagcagaggtctgcagatctcgcgaa 13132

                                      
Query: 128   tcctgggtgggcacaagaaggaccg 152
             |||| || || |||||||| |||||
Sbjct: 13133 tccttggcggccacaagaaagaccg 13157



to top

>dbj|AP004082.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1149_C12
          Length = 120743

 Score =  153 bits (77), Expect = 6e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                         
Query: 8     tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
             |||||||||| |||||||||||||||||||||||||| || ||||||||||| || || |
Sbjct: 93182 tcatggggctcctgctcttcaccccgatcgcgttcctcgcttggttcccgtttgtatccg 93241

                                                                         
Query: 68    agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
             ||||||||||  | |||||||||||||||||||||||| | ||||||||||||||| | |
Sbjct: 93242 agttccagaccagaatgctcttcaaccaggccttcagcagaggtctgcagatctcgcgaa 93301

                                      
Query: 128   tcctgggtgggcacaagaaggaccg 152
             |||| || || |||||||| |||||
Sbjct: 93302 tccttggcggccacaagaaagaccg 93326



to top

>dbj|AK105109.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-F07, full
           insert sequence
          Length = 1292

 Score =  153 bits (77), Expect = 6e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                       
Query: 8   tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
           |||||||||| |||||||||||||||||||||||||| || ||||||||||| || || |
Sbjct: 771 tcatggggctcctgctcttcaccccgatcgcgttcctcgcttggttcccgtttgtatccg 830

                                                                       
Query: 68  agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
           ||||||||||  | |||||||||||||||||||||||| | ||||||||||||||| | |
Sbjct: 831 agttccagaccagaatgctcttcaaccaggccttcagcagaggtctgcagatctcgcgaa 890

                                    
Query: 128 tcctgggtgggcacaagaaggaccg 152
           |||| || || |||||||| |||||
Sbjct: 891 tccttggcggccacaagaaagaccg 915



to top

>gb|DQ086484.1| Triticum aestivum putative 1,3-beta-glucan synthase 3 (GSL3) mRNA,
           partial cds
          Length = 481

 Score =  117 bits (59), Expect = 3e-23
 Identities = 122/143 (85%)
 Strand = Plus / Plus

                                                                       
Query: 10  atggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgag 69
           |||||||| ||||| ||||| || ||||||||||| ||||||||||| || ||||| |||
Sbjct: 330 atggggctcctgctgttcacgcccatcgcgttccttgcgtggttcccctttgtgtccgag 389

                                                                       
Query: 70  ttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatc 129
           ||||||||  ||||||| ||||||||||| |||||| | || |||||||||||  | |||
Sbjct: 390 ttccagaccaggatgcttttcaaccaggcgttcagcagaggcctgcagatctcccgtatc 449

                                  
Query: 130 ctgggtgggcacaagaaggaccg 152
           || || || ||||||||||||||
Sbjct: 450 ctcggcggccacaagaaggaccg 472



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  111 bits (56), Expect = 2e-21
 Identities = 101/116 (87%)
 Strand = Plus / Minus

                                                                            
Query: 37       gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccag 96
                |||||||| || ||||| || |||||||| |||||||||||  |||||||||||||||||
Sbjct: 30517977 gcgttccttgcttggtttcctttcgtgtccgagttccagaccaggatgctcttcaaccag 30517918

                                                                        
Query: 97       gccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaagaaggaccg 152
                ||||||||| | ||||||||||||||  | ||||| || ||||||||||| |||||
Sbjct: 30517917 gccttcagcagaggtctgcagatctcccgtatccttggcgggcacaagaaagaccg 30517862



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                           
Query: 43      ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
               |||||||||||||| ||||| || |||||||||||  || ||||||||||||||||||||
Sbjct: 4078046 ctggcgtggttccccttcgtctccgagttccagacgaggctgctcttcaaccaggccttc 4077987

                                   
Query: 103     agccgtggtctgcagatctc 122
               ||||| || || ||||||||
Sbjct: 4077986 agccgaggcctccagatctc 4077967



to top

>dbj|AP005750.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0069C14
          Length = 150579

 Score =  111 bits (56), Expect = 2e-21
 Identities = 101/116 (87%)
 Strand = Plus / Minus

                                                                         
Query: 37    gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccag 96
             |||||||| || ||||| || |||||||| |||||||||||  |||||||||||||||||
Sbjct: 16540 gcgttccttgcttggtttcctttcgtgtccgagttccagaccaggatgctcttcaaccag 16481

                                                                     
Query: 97    gccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaagaaggaccg 152
             ||||||||| | ||||||||||||||  | ||||| || ||||||||||| |||||
Sbjct: 16480 gccttcagcagaggtctgcagatctcccgtatccttggcgggcacaagaaagaccg 16425



to top

>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0017G10
          Length = 166700

 Score =  111 bits (56), Expect = 2e-21
 Identities = 101/116 (87%)
 Strand = Plus / Minus

                                                                          
Query: 37     gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccag 96
              |||||||| || ||||| || |||||||| |||||||||||  |||||||||||||||||
Sbjct: 155338 gcgttccttgcttggtttcctttcgtgtccgagttccagaccaggatgctcttcaaccag 155279

                                                                      
Query: 97     gccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaagaaggaccg 152
              ||||||||| | ||||||||||||||  | ||||| || ||||||||||| |||||
Sbjct: 155278 gccttcagcagaggtctgcagatctcccgtatccttggcgggcacaagaaagaccg 155223



to top

>ref|NM_193211.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 5634

 Score =  109 bits (55), Expect = 8e-21
 Identities = 82/91 (90%)
 Strand = Plus / Plus

                                                                        
Query: 41   tcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcct 100
            ||||| |||||||||| ||||| || ||||| ||||||||| ||||||||||||||||||
Sbjct: 5507 tcctgtcgtggttccccttcgtctccgagtttcagactcggctgctcttcaaccaggcct 5566

                                           
Query: 101  tcagccgtggtctgcagatctcgaggatcct 131
            ||||||| || ||||||||||| ||||||||
Sbjct: 5567 tcagccgggggctgcagatctccaggatcct 5597



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  109 bits (55), Expect = 8e-21
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                            
Query: 41       tcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcct 100
                ||||| |||||||||| ||||| || ||||| ||||||||| ||||||||||||||||||
Sbjct: 19299851 tcctgtcgtggttccccttcgtctccgagtttcagactcggctgctcttcaaccaggcct 19299792

                                               
Query: 101      tcagccgtggtctgcagatctcgaggatcct 131
                ||||||| || ||||||||||| ||||||||
Sbjct: 19299791 tcagccgggggctgcagatctccaggatcct 19299761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                            
Query: 49       tggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagccgt 108
                |||||||| |||||||| ||||||||||| ||  ||||||||||||||||||||||||||
Sbjct: 19254798 tggttccccttcgtgtccgagttccagacacgactgctcttcaaccaggccttcagccgt 19254739

                                       
Query: 109      ggtctgcagatctcgaggatcct 131
                || || |||||||| ||||||||
Sbjct: 19254738 ggcctccagatctcaaggatcct 19254716



to top

>dbj|AP003447.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OJ1619_F12
          Length = 133028

 Score =  109 bits (55), Expect = 8e-21
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                          
Query: 41     tcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcct 100
              ||||| |||||||||| ||||| || ||||| ||||||||| ||||||||||||||||||
Sbjct: 119472 tcctgtcgtggttccccttcgtctccgagtttcagactcggctgctcttcaaccaggcct 119413

                                             
Query: 101    tcagccgtggtctgcagatctcgaggatcct 131
              ||||||| || ||||||||||| ||||||||
Sbjct: 119412 tcagccgggggctgcagatctccaggatcct 119382



 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                         
Query: 49    tggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagccgt 108
             |||||||| |||||||| ||||||||||| ||  ||||||||||||||||||||||||||
Sbjct: 74419 tggttccccttcgtgtccgagttccagacacgactgctcttcaaccaggccttcagccgt 74360

                                    
Query: 109   ggtctgcagatctcgaggatcct 131
             || || |||||||| ||||||||
Sbjct: 74359 ggcctccagatctcaaggatcct 74337



to top

>dbj|AP003445.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1029_F04
          Length = 141834

 Score =  109 bits (55), Expect = 8e-21
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                         
Query: 41    tcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcct 100
             ||||| |||||||||| ||||| || ||||| ||||||||| ||||||||||||||||||
Sbjct: 27856 tcctgtcgtggttccccttcgtctccgagtttcagactcggctgctcttcaaccaggcct 27797

                                            
Query: 101   tcagccgtggtctgcagatctcgaggatcct 131
             ||||||| || ||||||||||| ||||||||
Sbjct: 27796 tcagccgggggctgcagatctccaggatcct 27766



to top

>gb|AY107727.1| Zea mays PCO075555 mRNA sequence
          Length = 2352

 Score =  109 bits (55), Expect = 8e-21
 Identities = 136/163 (83%)
 Strand = Plus / Plus

                                                                        
Query: 8    tcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctg 67
            |||||||  ||||| | |||||||||||||| ||||| || ||||||||||| || || |
Sbjct: 1947 tcatgggcttgctgttgttcaccccgatcgcattcctcgcttggttcccgtttgtttcgg 2006

                                                                        
Query: 68   agttccagactcggatgctcttcaaccaggccttcagccgtggtctgcagatctcgagga 127
            ||||||||||  ||||||| |||||||||||||||||  | ||||||||||| ||  | |
Sbjct: 2007 agttccagacaaggatgctgttcaaccaggccttcagtagaggtctgcagatttctcgta 2066

                                                       
Query: 128  tcctgggtgggcacaagaaggaccgggcggcgcggagcaagga 170
            |||| || || |||||||| |||||||| || |||| ||||||
Sbjct: 2067 tcctaggcggacacaagaaagaccgggctgcacggaacaagga 2109



to top

>gb|AY108207.1| Zea mays PCO082315 mRNA sequence
          Length = 1199

 Score =  103 bits (52), Expect = 5e-19
 Identities = 109/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 25  ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 84
           ||||| || ||||| ||||| || ||||||||||||||||| || ||||||||  |||||
Sbjct: 747 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 806

                                                                       
Query: 85  ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 144
           || ||||||||||| |||||| | ||||||||||||||  | |||||||| || ||||||
Sbjct: 807 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 866

                   
Query: 145 aaggaccg 152
           || |||||
Sbjct: 867 aaagaccg 874



to top

>ref|NM_193203.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1809

 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Plus

                                                                        
Query: 49   tggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagccgt 108
            |||||||| |||||||| ||||||||||| ||  ||||||||||||||||||||||||||
Sbjct: 1535 tggttccccttcgtgtccgagttccagacacgactgctcttcaaccaggccttcagccgt 1594

                                   
Query: 109  ggtctgcagatctcgaggatcct 131
            || || |||||||| ||||||||
Sbjct: 1595 ggcctccagatctcaaggatcct 1617



to top

>dbj|AK064446.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-110-F01, full
            insert sequence
          Length = 1923

 Score =  101 bits (51), Expect = 2e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                        
Query: 41   tcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcct 100
            ||||| |||||||||| ||||| || ||||| ||||||||| ||||||||| ||||||||
Sbjct: 1575 tcctgtcgtggttccccttcgtctccgagtttcagactcggctgctcttcagccaggcct 1634

                                           
Query: 101  tcagccgtggtctgcagatctcgaggatcct 131
            ||||||| || ||||||||||| ||||||||
Sbjct: 1635 tcagccgggggctgcagatctccaggatcct 1665



to top

>dbj|AP007257.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBb0019L07
          Length = 131650

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              |||||||||||||| ||||| || |||||||||||  || ||||||||||||||||||||
Sbjct: 121699 ctggcgtggttccccttcgtctccgagttccagacgaggctgctcttcaaccaggccttc 121640

                                  
Query: 103    agccgtggtctgcagatctc 122
              ||||| || || ||||||||
Sbjct: 121639 agccgaggcctccagatctc 121620



to top

>dbj|AP007226.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0036B04
          Length = 136159

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                         
Query: 43    ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
             |||||||||||||| ||||| || |||||||||||  || ||||||||||||||||||||
Sbjct: 11305 ctggcgtggttccccttcgtctccgagttccagacgaggctgctcttcaaccaggccttc 11246

                                 
Query: 103   agccgtggtctgcagatctc 122
             ||||| || || ||||||||
Sbjct: 11245 agccgaggcctccagatctc 11226



to top

>ref|NM_179622.2| Arabidopsis thaliana 1,3-beta-glucan synthase AT2G13680 mRNA,
            complete cds
          Length = 5772

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                        
Query: 46   gcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagc 105
            ||||||||||| ||||| ||||||||||||||  || | |||||||| || ||||| |||
Sbjct: 5662 gcgtggttccctttcgtctctgagttccagacaaggcttctcttcaatcaagcctttagc 5721

                           
Query: 106  cgtggtctgcagatc 120
            |||||||| ||||||
Sbjct: 5722 cgtggtctccagatc 5736



to top

>ref|NM_179847.1| Arabidopsis thaliana ATGSL03 (GLUCAN SYNTHASE-LIKE 3);
            1,3-beta-glucan synthase/ transferase, transferring
            glycosyl groups AT2G31960 (ATGSL03) mRNA, complete cds
          Length = 5880

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 37   gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaacca 95
            ||||||||||| ||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 5743 gcgttcctggcttggttcccgttcgtgtctgagtttcagacaagaatgctctttaacca 5801



to top

>gb|AY337762.1| Arabidopsis thaliana LAP1 (At2g13680) mRNA, complete cds
          Length = 5950

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                        
Query: 46   gcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagc 105
            ||||||||||| ||||| ||||||||||||||  || | |||||||| || ||||| |||
Sbjct: 5815 gcgtggttccctttcgtctctgagttccagacaaggcttctcttcaatcaagcctttagc 5874

                           
Query: 106  cgtggtctgcagatc 120
            |||||||| ||||||
Sbjct: 5875 cgtggtctccagatc 5889



to top

>gb|AC007063.6| Arabidopsis thaliana chromosome 2 clone T10F5 map PR1, complete
             sequence
          Length = 102585

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                         
Query: 46    gcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagc 105
             ||||||||||| ||||| ||||||||||||||  || | |||||||| || ||||| |||
Sbjct: 96451 gcgtggttccctttcgtctctgagttccagacaaggcttctcttcaatcaagcctttagc 96510

                            
Query: 106   cgtggtctgcagatc 120
             |||||||| ||||||
Sbjct: 96511 cgtggtctccagatc 96525



to top

>gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J11 map mi398, complete
             sequence
          Length = 104009

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                         
Query: 46    gcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagc 105
             ||||||||||| ||||| ||||||||||||||  || | |||||||| || ||||| |||
Sbjct: 14249 gcgtggttccctttcgtctctgagttccagacaaggcttctcttcaatcaagcctttagc 14308

                            
Query: 106   cgtggtctgcagatc 120
             |||||||| ||||||
Sbjct: 14309 cgtggtctccagatc 14323



to top

>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete
             sequence
          Length = 103194

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 37    gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaacca 95
             ||||||||||| ||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 89481 gcgttcctggcttggttcccgttcgtgtctgagtttcagacaagaatgctctttaacca 89423



to top

>tpg|BK001470.1| TPA: TPA_exp: Arabidopsis thaliana callose synthase (LAP1) mRNA,
            complete cds
          Length = 5772

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                        
Query: 46   gcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagc 105
            ||||||||||| ||||| ||||||||||||||  || | |||||||| || ||||| |||
Sbjct: 5662 gcgtggttccctttcgtctctgagttccagacaaggcttctcttcaatcaagcctttagc 5721

                           
Query: 106  cgtggtctgcagatc 120
            |||||||| ||||||
Sbjct: 5722 cgtggtctccagatc 5736



to top

>dbj|AK117353.1| Arabidopsis thaliana At2g31960 mRNA for putative glucan synthase,
            complete cds, clone: RAFL16-92-B13
          Length = 2390

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 37   gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaacca 95
            ||||||||||| ||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 2133 gcgttcctggcttggttcccgttcgtgtctgagtttcagacaagaatgctctttaacca 2191



to top

>gb|DQ086487.1| Triticum aestivum putative 1,3-beta-glucan synthase 12 (GSL12)
           mRNA, partial cds
          Length = 527

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 47  cgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagcc 106
           |||||||||| || |||||   ||||||| | || || || |||||||||||||||||||
Sbjct: 213 cgtggttcccctttgtgtccacgttccagtcgcgcatcctgttcaaccaggccttcagcc 272

                           
Query: 107 gtggtctgcagatctc 122
           |||||||| |||||||
Sbjct: 273 gtggtctggagatctc 288



to top

>emb|BX819158.1|CNS0A8YL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB52ZD04 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1385

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 37   gcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaacca 95
            |||| |||||| ||||||||||||||||||||||| |||||  | |||||||| |||||
Sbjct: 1179 gcgtccctggcttggttcccgttcgtgtctgagtttcagacaagaatgctctttaacca 1237



to top

>gb|AF304372.2| Nicotiana alata putative beta-1,3-glucan synthase (Gsl1) mRNA,
            complete cds
          Length = 6266

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 49   tggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagc 105
            |||||||| || || ||||||||||||||  || |||| ||||||||||| ||||||
Sbjct: 5908 tggttcccatttgtctctgagttccagacaaggctgcttttcaaccaggctttcagc 5964



to top

>ref|NM_100528.1| Arabidopsis thaliana ATGSL07 (GLUCAN SYNTHASE-LIKE 7);
            1,3-beta-glucan synthase/ transferase, transferring
            glycosyl groups AT1G06490 (ATGSL07) mRNA, complete cds
          Length = 5802

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                        
Query: 47   cgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagcc 106
            |||||||||| || |||||||||||||| ||| |  | || || || || |||||||| |
Sbjct: 5678 cgtggttcccatttgtgtctgagttccaaactagattactgtttaatcaagccttcagtc 5737

                            
Query: 107  gtggtctgcagatctc 122
            | ||||||||||||||
Sbjct: 5738 gcggtctgcagatctc 5753



to top

>gb|AC007592.4|AC007592 Genomic sequence for Arabidopsis thaliana BAC F12K11 from chromosome I,
             complete sequence
          Length = 93724

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                         
Query: 47    cgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagcc 106
             |||||||||| || |||||||||||||| ||| |  | || || || || |||||||| |
Sbjct: 65088 cgtggttcccatttgtgtctgagttccaaactagattactgtttaatcaagccttcagtc 65029

                             
Query: 107   gtggtctgcagatctc 122
             | ||||||||||||||
Sbjct: 65028 gcggtctgcagatctc 65013



to top

>gb|AC153357.4| Mus musculus BAC clone RP24-124N8 from chromosome 10, complete sequence
          Length = 189789

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 263    tcagtagtatgtatgtatgtat 284
              ||||||||||||||||||||||
Sbjct: 134537 tcagtagtatgtatgtatgtat 134516



to top

>ref|NM_100436.2| Arabidopsis thaliana CALS1 (CALLOSE SYNTHASE 1); transferase,
            transferring glycosyl groups AT1G05570 (CALS1) mRNA,
            complete cds
          Length = 6022

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                      
Query: 44   tggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcctt 101
            |||| ||||| || || |||||||||||||||||  | |||||||| ||||| |||||
Sbjct: 5732 tggcctggtttccttttgtgtctgagttccagacaagaatgctctttaaccaagcctt 5789



to top

>gb|AC091763.25| Mus musculus strain C57BL/6J clone rp23-198o2 map 10, complete sequence
          Length = 221545

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 263    tcagtagtatgtatgtatgtat 284
              ||||||||||||||||||||||
Sbjct: 160831 tcagtagtatgtatgtatgtat 160852



to top

>dbj|AK046085.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230341A15
           product:unclassifiable, full insert sequence
          Length = 2456

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 263 tcagtagtatgtatgtatgtat 284
           ||||||||||||||||||||||
Sbjct: 553 tcagtagtatgtatgtatgtat 532



to top

>gb|AF237733.1|AF237733 Arabidopsis thaliana callose synthase 1 catalytic subunit (CalS1)
            mRNA, complete cds
          Length = 6007

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                      
Query: 44   tggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcctt 101
            |||| ||||| || || |||||||||||||||||  | |||||||| ||||| |||||
Sbjct: 5732 tggcctggtttccttttgtgtctgagttccagacaagaatgctctttaaccaagcctt 5789



to top

>gb|AC005106.2|AC005106 Genomic sequence for Arabidopsis thaliana BAC T25N20 from chromosome I,
             complete sequence
          Length = 84203

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 44    tggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcctt 101
             |||| ||||| || || |||||||||||||||||  | |||||||| ||||| |||||
Sbjct: 80083 tggcctggtttccttttgtgtctgagttccagacaagaatgctctttaaccaagcctt 80026



to top

>gb|AC140381.3| Mus musculus BAC clone RP23-176M4 from 10, complete sequence
          Length = 223470

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 263   tcagtagtatgtatgtatgtat 284
             ||||||||||||||||||||||
Sbjct: 71762 tcagtagtatgtatgtatgtat 71741



to top

>emb|AL353194.13| Human DNA sequence from clone RP11-119B16 on chromosome 20 Contains the
             3' end of the gene for a novel protein (KIAA1271), a novel
             gene, the 5' end of PANK2 gene for Pantothenate kinase 2
             (Hallervorden-Spatz syndrome) and a CpG island, complete
             sequence
          Length = 56570

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 264   cagtagtatgtatgtatgtatt 285
             ||||||||||||||||||||||
Sbjct: 24970 cagtagtatgtatgtatgtatt 24949



to top

>emb|CT033787.9| Mouse DNA sequence from clone RP24-86C3 on chromosome 12, complete
             sequence
          Length = 194345

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 263   tcagtagtatgtatgtatgtat 284
             ||||||||||||||||||||||
Sbjct: 64249 tcagtagtatgtatgtatgtat 64228



to top

>gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genomic sequence, complete
             sequence
          Length = 103223

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 44    tggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggcctt 101
             |||| ||||| || || |||||||||||||||||  | |||||||| ||||| |||||
Sbjct: 29534 tggcctggtttccttttgtgtctgagttccagacaagaatgctctttaaccaagcctt 29477



to top

>gb|DQ112034.1| Perna viridis clone PV104 microsatellite sequence
          Length = 286

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 269 gtatgtatgtatgtattccag 289
           |||||||||||||||||||||
Sbjct: 54  gtatgtatgtatgtattccag 74



to top

>gb|AC114637.9| Mus musculus chromosome 3, clone RP24-119G15, complete sequence
          Length = 179087

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 269   gtatgtatgtatgtattccag 289
             |||||||||||||||||||||
Sbjct: 98050 gtatgtatgtatgtattccag 98070



to top

>gb|AC147090.3| Pan troglodytes BAC clone RP43-58D11 from 7, complete sequence
          Length = 200913

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 268   agtatgtatgtatgtattcca 288
             |||||||||||||||||||||
Sbjct: 76587 agtatgtatgtatgtattcca 76567



to top

>gb|AC122794.3| Mus musculus BAC clone RP24-202L5 from chromosome 8, complete sequence
          Length = 157120

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 265   agtagtatgtatgtatgtatt 285
             |||||||||||||||||||||
Sbjct: 42419 agtagtatgtatgtatgtatt 42439



to top

>gb|AC142294.1| Pan troglodytes BAC clone RP43-73M4 from 7, complete sequence
          Length = 173444

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 268    agtatgtatgtatgtattcca 288
              |||||||||||||||||||||
Sbjct: 112524 agtatgtatgtatgtattcca 112504



to top

>emb|CR846094.7| Zebrafish DNA sequence from clone CH211-264F16 in linkage group 24,
             complete sequence
          Length = 175626

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 265   agtagtatgtatgtatgtatt 285
             |||||||||||||||||||||
Sbjct: 89925 agtagtatgtatgtatgtatt 89905



to top

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 455535 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 455594

                   
Query: 103    agccg 107
              |||||
Sbjct: 455595 agccg 455599



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 374422 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 374481

                   
Query: 103    agccg 107
              |||||
Sbjct: 374482 agccg 374486



to top

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 454693 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 454752

                   
Query: 103    agccg 107
              |||||
Sbjct: 454753 agccg 454757



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 373595 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 373654

                   
Query: 103    agccg 107
              |||||
Sbjct: 373655 agccg 373659



to top

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 454689 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 454748

                   
Query: 103    agccg 107
              |||||
Sbjct: 454749 agccg 454753



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 373591 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 373650

                   
Query: 103    agccg 107
              |||||
Sbjct: 373651 agccg 373655



to top

>emb|AL137069.15| Human DNA sequence from clone RP11-167C5 on chromosome 9 Contains part
             of a variant of the PTPRD gene for protein tyrosine
             phosphatase, receptor type, D (HPTP, PTPD, HPTPD),
             complete sequence
          Length = 171852

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 403   gacttataacttgtgtacttt 423
             |||||||||||||||||||||
Sbjct: 95144 gacttataacttgtgtacttt 95164



to top

>gb|AC066616.7| Homo sapiens chromosome 15 clone RP11-925D8 map 15q21.3, complete
             sequence
          Length = 209779

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 172   gataggtagatggatagattg 192
             |||||||||||||||||||||
Sbjct: 74283 gataggtagatggatagattg 74263



to top

>gb|AC118343.1| Homo sapiens chromosome 19 clone LLNLR-234A10, complete sequence
          Length = 36965

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 269   gtatgtatgtatgtattccaggctg 293
             ||||||||||||||| |||||||||
Sbjct: 17627 gtatgtatgtatgtagtccaggctg 17603



to top

>gb|AC104657.2| Homo sapiens BAC clone RP11-567F17 from 4, complete sequence
          Length = 126525

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 267   tagtatgtatgtatgtattcc 287
             |||||||||||||||||||||
Sbjct: 79474 tagtatgtatgtatgtattcc 79494



to top

>gb|AC092313.2| Homo sapiens chromosome 19 clone LLNLR-293G8, complete sequence
          Length = 38582

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 269   gtatgtatgtatgtattccaggctg 293
             ||||||||||||||| |||||||||
Sbjct: 32669 gtatgtatgtatgtagtccaggctg 32693



to top

>gb|AC093234.2| Homo sapiens chromosome 19 clone LLNLR-266A8, complete sequence
          Length = 36965

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 269   gtatgtatgtatgtattccaggctg 293
             ||||||||||||||| |||||||||
Sbjct: 17627 gtatgtatgtatgtagtccaggctg 17603



to top

>emb|AL079305.3|CNS00M8M Human chromosome 14 DNA sequence BAC R-306B9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 188736

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 269   gtatgtatgtatgtattccag 289
             |||||||||||||||||||||
Sbjct: 15261 gtatgtatgtatgtattccag 15241



to top

>gb|AC008734.7| Homo sapiens chromosome 19 clone CTD-2529P6, complete sequence
          Length = 183137

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 269   gtatgtatgtatgtattccaggctg 293
             ||||||||||||||| |||||||||
Sbjct: 56469 gtatgtatgtatgtagtccaggctg 56493



to top

>dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochondrial DNA, complete genome
          Length = 490520

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 454546 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 454605

                   
Query: 103    agccg 107
              |||||
Sbjct: 454606 agccg 454610



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 43     ctggcgtggttcccgttcgtgtctgagttccagactcggatgctcttcaaccaggccttc 102
              ||||| |||||||| || || || |||||||||||  |  |||| ||||| |||||||||
Sbjct: 373459 ctggcatggttcccatttgtctcggagttccagacgagattgctattcaatcaggccttc 373518

                   
Query: 103    agccg 107
              |||||
Sbjct: 373519 agccg 373523



to top

>gb|AY787127.1| Homo sapiens clone B_018-023_B3 SPANX-B gene, complete cds
          Length = 11994

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 408 ataacttgtgtactttattaattataac 435
           ||||||||||||  ||||||||||||||
Sbjct: 961 ataacttgtgtatgttattaattataac 988



to top

>gb|AY293806.1| Paraurostyla weissei macronuclear DNA polymerase alpha gene, complete
            cds
          Length = 4746

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 380  acttatctgatattggtgat 399
            ||||||||||||||||||||
Sbjct: 3625 acttatctgatattggtgat 3644



to top

>gb|AY293805.1| Paraurostyla weissei micronuclear DNA polymerase alpha gene, complete
            sequence
          Length = 6930

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 380  acttatctgatattggtgat 399
            ||||||||||||||||||||
Sbjct: 5413 acttatctgatattggtgat 5432



to top

>gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, complete sequence
          Length = 206380

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 265    agtagtatgtatgtatgtat 284
              ||||||||||||||||||||
Sbjct: 139215 agtagtatgtatgtatgtat 139196



to top

>gb|AC153607.15| Mus musculus 6 BAC RP23-100I21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 222828

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 201868 gtatgtatgtatgtattcca 201849



to top

>gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section 6 of 9 of the complete
              sequence
          Length = 250421

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    gtagtatgtatgtatgtatt 285
              ||||||||||||||||||||
Sbjct: 175400 gtagtatgtatgtatgtatt 175381



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 10      atggggctgctgctcttcaccccg 33
               ||||||||||||| ||||||||||
Sbjct: 6180731 atggggctgctgcgcttcaccccg 6180754



to top

>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence
          Length = 198736

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   gtagtagtagtagtgtatgc 376
             ||||||||||||||||||||
Sbjct: 98827 gtagtagtagtagtgtatgc 98846



to top

>gb|AC149231.2| Pan troglodytes BAC clone CH251-481H1 from 7, complete sequence
          Length = 217836

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    tcctgggtgggcacaagaag 147
              ||||||||||||||||||||
Sbjct: 121242 tcctgggtgggcacaagaag 121261



to top

>gb|AC120397.7| Mus musculus chromosome 18, clone RP24-332E21, complete sequence
          Length = 178502

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 407    tataacttgtgtactttatt 426
              ||||||||||||||||||||
Sbjct: 158166 tataacttgtgtactttatt 158185



to top

>gb|AC147094.2| Pan troglodytes BAC clone RP43-52H15 from 7, complete sequence
          Length = 183596

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   tcctgggtgggcacaagaag 147
             ||||||||||||||||||||
Sbjct: 58012 tcctgggtgggcacaagaag 58031



to top

>gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosome 9, complete sequence
          Length = 158741

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   ataggtagatggatagattg 192
             ||||||||||||||||||||
Sbjct: 46149 ataggtagatggatagattg 46130



to top

>gb|AY915763.1| Schistosoma japonicum SJCHGC09682 protein mRNA, partial cds
          Length = 2231

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 267  tagtatgtatgtatgtattc 286
            ||||||||||||||||||||
Sbjct: 1955 tagtatgtatgtatgtattc 1974



to top

>gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, complete sequence
          Length = 149463

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 265    agtagtatgtatgtatgtat 284
              ||||||||||||||||||||
Sbjct: 108724 agtagtatgtatgtatgtat 108743



to top

>gb|AC158652.5| Mus musculus 6 BAC RP23-238I17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 217046

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 266   gtagtatgtatgtatgtatt 285
             ||||||||||||||||||||
Sbjct: 85736 gtagtatgtatgtatgtatt 85717



to top

>gb|AC114643.9| Mus musculus chromosome 6, clone RP24-127D6, complete sequence
          Length = 215696

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 294    caaattgcattggcaatgta 313
              ||||||||||||||||||||
Sbjct: 122368 caaattgcattggcaatgta 122349



to top

>gb|AC133607.3| Mus musculus BAC clone RP23-153N7 from chromosome 18, complete sequence
          Length = 223708

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 253    ttgtggcttgtcagtagtat 272
              ||||||||||||||||||||
Sbjct: 164453 ttgtggcttgtcagtagtat 164472



to top

>gb|AC103610.9| Mus musculus chromosome 9, clone RP23-364M24, complete sequence
          Length = 205900

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 23054 agtagtatgtatgtatgtat 23073



to top

>gb|AC132085.3| Mus musculus BAC clone RP24-550M24 from chromosome 13, complete
             sequence
          Length = 150362

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 72240 agtagtatgtatgtatgtat 72259



to top

>gb|AC122530.3| Mus musculus BAC clone RP24-531C7 from chromosome 7, complete sequence
          Length = 141027

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 270    tatgtatgtatgtattccag 289
              ||||||||||||||||||||
Sbjct: 137907 tatgtatgtatgtattccag 137888



to top

>gb|AC123801.4| Mus musculus BAC clone RP24-374A1 from chromosome 15, complete sequence
          Length = 150979

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 43677 agtagtatgtatgtatgtat 43696



to top

>gb|AC123823.3| Mus musculus BAC clone RP24-63C11 from chromosome 7, complete sequence
          Length = 185494

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 270    tatgtatgtatgtattccag 289
              ||||||||||||||||||||
Sbjct: 157753 tatgtatgtatgtattccag 157772



to top

>gb|AC128671.4| Mus musculus BAC clone RP23-247F12 from 18, complete sequence
          Length = 172016

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 407   tataacttgtgtactttatt 426
             ||||||||||||||||||||
Sbjct: 16401 tataacttgtgtactttatt 16420



to top

>gb|AC136903.6| Mus musculus chromosome 9, clone RP23-475J16, complete sequence
          Length = 180530

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    ataggtagatggatagattg 192
              ||||||||||||||||||||
Sbjct: 171926 ataggtagatggatagattg 171907



to top

>gb|AC153143.4| Mus musculus BAC clone RP23-241N10 from chromosome 13, complete sequence
          Length = 207860

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 265    agtagtatgtatgtatgtat 284
              ||||||||||||||||||||
Sbjct: 184151 agtagtatgtatgtatgtat 184170



to top

>gb|AC166347.2| Mus musculus BAC clone RP24-87G12 from chromosome 6, complete sequence
          Length = 193181

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 63912 gtatgtatgtatgtattcca 63893



to top

>gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosome 1, complete sequence
          Length = 196584

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 79045 gtatgtatgtatgtattcca 79064



to top

>emb|CR376761.19| Zebrafish DNA sequence from clone DKEY-6F24 in linkage group 2,
             complete sequence
          Length = 231384

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   ctgtagcggttgtggcttgt 263
             ||||||||||||||||||||
Sbjct: 74398 ctgtagcggttgtggcttgt 74417



to top

>emb|AL451048.13| Human DNA sequence from clone RP11-298A8 on chromosome Xq26.3-27.3
             Contains the gene for a novel protein similar to SPANX
             family member B1 (SPANXB1) and a novel gene, complete
             sequence
          Length = 99793

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 408   ataacttgtgtactttattaattataac 435
             ||||||||||||  ||||||||||||||
Sbjct: 97460 ataacttgtgtatgttattaattataac 97487



to top

>emb|AL354747.12| Human DNA sequence from clone RP11-362D13 on chromosome 10, complete
            sequence
          Length = 84615

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 269  gtatgtatgtatgtattcca 288
            ||||||||||||||||||||
Sbjct: 8277 gtatgtatgtatgtattcca 8296



to top

>gb|AC158213.4| Mus musculus chromosome 7, clone RP24-253H20, complete sequence
          Length = 175873

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    gtagtatgtatgtatgtatt 285
              ||||||||||||||||||||
Sbjct: 113962 gtagtatgtatgtatgtatt 113943



to top

>gb|AC105600.5| Rattus norvegicus 4 BAC CH230-209E1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 218874

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 105513 gtatgtatgtatgtattcca 105494



to top

>emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chromosome 13 Contains a
             nove gene, a ribosomal protein large p1 (Rplp1) pseudogene
             and the Cmah gene for CMP-N-Acetylneuraminic acid
             hydroxylase, complete sequence
          Length = 216800

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   gggtgggcacaagaaggacc 151
             ||||||||||||||||||||
Sbjct: 60167 gggtgggcacaagaaggacc 60148



to top

>emb|AL590625.16| Mouse DNA sequence from clone RP23-467M8 on chromosome 13 Contains the
             Foxf2 gene for forkhead box F2, a novel gene and two CpG
             islands, complete sequence
          Length = 165745

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   cgggcggcgcggagcaagga 170
             ||||||||||||||||||||
Sbjct: 16668 cgggcggcgcggagcaagga 16687



to top

>emb|BX649467.5| Zebrafish DNA sequence from clone CH211-117L16 in linkage group 4
             Contains the gene for a novel protein similar to
             vertebrate mitochondrial ribosomal protein S18A (MRPS18A)
             and two novel genes, complete sequence
          Length = 74769

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   acgataggtagatggataga 189
             ||||||||||||||||||||
Sbjct: 42959 acgataggtagatggataga 42978



to top

>gb|DQ099285.1| Arachis hypogaea clone Ah-408 microsatellite sequence
          Length = 364

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 353 gtttgtagtagtagtagtgt 372
           ||||||||||||||||||||
Sbjct: 187 gtttgtagtagtagtagtgt 168



to top

>gb|AC099789.2| Homo sapiens chromosome 1 clone RP11-377K22, complete sequence
          Length = 174162

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 270    tatgtatgtatgtattccag 289
              ||||||||||||||||||||
Sbjct: 102494 tatgtatgtatgtattccag 102513



to top

>gb|AC106740.3| Homo sapiens chromosome 5 clone RP11-100E22, complete sequence
          Length = 155443

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   tctgatattggtgattgtga 458
             ||||||||||||||||||||
Sbjct: 28533 tctgatattggtgattgtga 28552



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 385   tctgatattggtgattgtga 404
             ||||||||||||||||||||
Sbjct: 28533 tctgatattggtgattgtga 28552



to top

>gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q21, complete sequence
          Length = 166124

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   gataggtagatggatagatt 191
             ||||||||||||||||||||
Sbjct: 88761 gataggtagatggatagatt 88742



to top

>gb|AC010371.7| Homo sapiens chromosome 5 clone CTD-2049O13, complete sequence
          Length = 62028

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 439   tctgatattggtgattgtga 458
             ||||||||||||||||||||
Sbjct: 16439 tctgatattggtgattgtga 16420



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 385   tctgatattggtgattgtga 404
             ||||||||||||||||||||
Sbjct: 16439 tctgatattggtgattgtga 16420



to top

>gb|DQ205696.1| Etheostoma caeruleum clone Eca22EPA microsatellite sequence
          Length = 435

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 171 cgataggtagatggatagat 190
           ||||||||||||||||||||
Sbjct: 136 cgataggtagatggatagat 155



to top

>gb|AC069411.21| Homo sapiens 3 BAC RP11-609K13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 156733

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    gtagtatgtatgtatgtatt 285
              ||||||||||||||||||||
Sbjct: 108169 gtagtatgtatgtatgtatt 108150



to top

>gb|AC159204.2| Mus musculus BAC clone RP23-229H13 from chromosome 12, complete sequence
          Length = 211156

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 177493 gtatgtatgtatgtattcca 177474



to top

>gb|AC154485.2| Mus musculus BAC clone RP24-117M9 from chromosome 12, complete sequence
          Length = 154864

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 138276 gtatgtatgtatgtattcca 138295



to top

>dbj|AK039876.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A430024G23 product:unclassifiable, full
            insert sequence
          Length = 1771

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  agtagtatgtatgtatgtat 284
            ||||||||||||||||||||
Sbjct: 1034 agtagtatgtatgtatgtat 1015



to top

>dbj|AK047258.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930042M10
           product:unclassifiable, full insert sequence
          Length = 1525

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 cgggcggcgcggagcaagga 170
           ||||||||||||||||||||
Sbjct: 205 cgggcggcgcggagcaagga 186



to top

>emb|BX255929.7| Zebrafish DNA sequence from clone CH211-271P5 in linkage group 14,
             complete sequence
          Length = 147460

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 14177 agtagtatgtatgtatgtat 14196



to top

>gb|AC157089.5| Mus musculus 10 BAC RP24-339G14 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 160723

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   gataggtagatggatagatt 191
             ||||||||||||||||||||
Sbjct: 31191 gataggtagatggatagatt 31172



to top

>gb|AC107301.10| Homo sapiens 3 BAC RP11-544A22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188000

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 172    gataggtagatggatagatt 191
              ||||||||||||||||||||
Sbjct: 152556 gataggtagatggatagatt 152575



to top

>gb|AC126614.8| Homo sapiens 12 BAC RP11-756H6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 147545

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   gtagtatgtatgtatgtatt 285
             ||||||||||||||||||||
Sbjct: 22732 gtagtatgtatgtatgtatt 22751



to top

>gb|AC083875.1|AC083875 Homo sapiens chromosome 7 clone RP11-699P13, complete sequence
          Length = 150913

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   tcctgggtgggcacaagaag 147
             ||||||||||||||||||||
Sbjct: 96603 tcctgggtgggcacaagaag 96584



to top

>gb|AC079244.29| Mus musculus strain C57BL/6J chromosome 9 clone rp23-343k17, complete
             sequence
          Length = 223861

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 53692 gtatgtatgtatgtattcca 53711



to top

>gb|AC092181.9| Homo sapiens 3 BAC RP11-735O9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 183168

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    gtagtatgtatgtatgtatt 285
              ||||||||||||||||||||
Sbjct: 130679 gtagtatgtatgtatgtatt 130698



to top

>dbj|AP004000.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1115_B01
          Length = 129329

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 356   tgtagtagtagtagtgtatg 375
             ||||||||||||||||||||
Sbjct: 51835 tgtagtagtagtagtgtatg 51816



to top

>dbj|AP003990.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1073_F05
          Length = 124252

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 356   tgtagtagtagtagtgtatg 375
             ||||||||||||||||||||
Sbjct: 13404 tgtagtagtagtagtgtatg 13385



to top

>emb|AL929270.14| Mouse DNA sequence from clone RP23-100K15 on chromosome X, complete
             sequence
          Length = 115038

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 59496 agtagtatgtatgtatgtat 59515



to top

>gb|AC153941.3| Mus musculus 10 BAC RP24-403F8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 205654

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    gataggtagatggatagatt 191
              ||||||||||||||||||||
Sbjct: 203134 gataggtagatggatagatt 203115



to top

>emb|CR937049.3| CH230-323M7, complete sequence
          Length = 198674

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 156081 gtatgtatgtatgtattcca 156062



to top

>emb|CR925800.7| Zebrafish DNA sequence from clone ZFOS-476E6 in linkage group 4,
             complete sequence
          Length = 19867

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   ctgtagcggttgtggcttgt 263
             ||||||||||||||||||||
Sbjct: 16577 ctgtagcggttgtggcttgt 16558



to top

>emb|AL356804.4|CNS05TDM Human chromosome 14 DNA sequence BAC R-718G2 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 185015

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 179649 gtatgtatgtatgtattcca 179630



to top

>gb|AC103664.12| Mus musculus chromosome 7, clone RP23-348F4, complete sequence
          Length = 222413

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 266   gtagtatgtatgtatgtatt 285
             ||||||||||||||||||||
Sbjct: 80585 gtagtatgtatgtatgtatt 80566



to top

>dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, section 21/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    gataggtagatggatagatt 191
              ||||||||||||||||||||
Sbjct: 276328 gataggtagatggatagatt 276309



to top

>gb|AC132224.3| Mus musculus BAC clone RP24-554P12 from 1, complete sequence
          Length = 154996

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 269  gtatgtatgtatgtattcca 288
            ||||||||||||||||||||
Sbjct: 2767 gtatgtatgtatgtattcca 2748



to top

>gb|AC134899.4| Mus musculus BAC clone RP24-81B7 from 6, complete sequence
          Length = 197316

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    gtagtatgtatgtatgtatt 285
              ||||||||||||||||||||
Sbjct: 194823 gtagtatgtatgtatgtatt 194842



to top

>gb|AC141891.3| Mus musculus BAC clone RP23-378A8 from 6, complete sequence
          Length = 152261

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 96762 gtatgtatgtatgtattcca 96781



to top

>emb|BX927192.15| Zebrafish DNA sequence from clone DKEY-56M20 in linkage group 5,
             complete sequence
          Length = 152997

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   ctgtagcggttgtggcttgt 263
             ||||||||||||||||||||
Sbjct: 31163 ctgtagcggttgtggcttgt 31182



to top

>emb|AL935132.13| Mouse DNA sequence from clone RP23-8G23 on chromosome 2, complete
             sequence
          Length = 165444

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 95605 gtatgtatgtatgtattcca 95586



to top

>emb|AL672051.14| Mouse DNA sequence from clone RP23-332O3 on chromosome X, complete
             sequence
          Length = 163949

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 85379 gtatgtatgtatgtattcca 85398



to top

>emb|AL672271.9| Mouse DNA sequence from clone RP23-450H23 on chromosome X, complete
             sequence
          Length = 196613

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 88611 gtatgtatgtatgtattcca 88630



to top

>emb|AL672287.12| Mouse DNA sequence from clone RP23-151I8 on chromosome X, complete
             sequence
          Length = 81776

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 26234 agtagtatgtatgtatgtat 26253



to top

>emb|AL844489.6| Mouse DNA sequence from clone RP23-101P8 on chromosome 2, complete
              sequence
          Length = 213549

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    gtatgtatgtatgtattcca 288
              ||||||||||||||||||||
Sbjct: 205959 gtatgtatgtatgtattcca 205978



to top

>emb|AL606967.14| Mouse DNA sequence from clone RP23-304D5 on chromosome 4, complete
             sequence
          Length = 188425

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   agtagtatgtatgtatgtat 284
             ||||||||||||||||||||
Sbjct: 51918 agtagtatgtatgtatgtat 51937



to top

>emb|AL732619.13| Mouse DNA sequence from clone RP23-122I3 on chromosome 4, complete
             sequence
          Length = 225086

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   gtatgtatgtatgtattcca 288
             ||||||||||||||||||||
Sbjct: 87527 gtatgtatgtatgtattcca 87546



to top

>dbj|AP001256.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B732H1,
             LL56-APP region, complete sequence
          Length = 204699

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   gataggtagatggatagatt 191
             ||||||||||||||||||||
Sbjct: 20749 gataggtagatggatagatt 20730


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,297,707
Number of Sequences: 3902068
Number of extensions: 4297707
Number of successful extensions: 375100
Number of sequences better than 10.0: 135
Number of HSP's better than 10.0 without gapping: 137
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 373724
Number of HSP's gapped (non-prelim): 1374
length of query: 471
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 449
effective length of database: 17,147,199,772
effective search space: 7699092697628
effective search space used: 7699092697628
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top