ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal32h09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY844956.1| Zea mays beta-carotene hydroxylase (HYD1) mRNA, c... 817 0.0
2gb|BT018945.1| Zea mays clone Contig93.F mRNA sequence 813 0.0
3gb|AY844958.1| Zea mays beta-carotene hydroxylase (HYD3) mRNA, c... 813 0.0
4ref|XM_473611.1| Oryza sativa (japonica cultivar-group), predic... 759 0.0
5dbj|AK060559.1| Oryza sativa (japonica cultivar-group) cDNA clon... 759 0.0
6gb|AY104495.1| Zea mays PCO148057 mRNA sequence 638 e-180
7ref|NM_197521.1| Oryza sativa (japonica cultivar-group) putative... 569 e-159
8gb|BT009105.1| Triticum aestivum clone wkm2n.pk008.a5:fis, full ... 430 e-117
9emb|AJ416711.2|CSA416711 Crocus sativus mRNA for beta-carotene h... 355 1e-94
10gb|AY844957.1| Zea mays beta-carotene hydroxylase (HYD3) gene, c... 319 7e-84
11gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 303 4e-79
12gb|AC119747.1| Genomic sequence for Oryza sativa, Nipponbare str... 303 4e-79
13dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 303 4e-79
14gb|AC092389.4| Oryza sativa chromosome 10 BAC OSJNBa0053C23 geno... 301 2e-78
15dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 301 2e-78
16gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 301 2e-78
17emb|AL606624.4|OSJN00058 Oryza sativa genomic DNA, chromosome 4,... 287 2e-74
18dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 287 2e-74
19gb|AY077687.1| Sandersonia aurantiaca beta carotene hydroxylase ... 272 1e-69
20gb|AY579207.1| Crocus sativus beta carotene hydroxylase (BCH2Cs)... 226 7e-56
21gb|AF499108.1| Vitis vinifera beta-carotene hydroxylase (bch1) g... 135 2e-28
22emb|AJ278882.1|NPS278882 Narcissus pseudonarcissus mRNA for beta... 117 5e-23
23gb|AY860819.1| Chlamydomonas reinhardtii putative chloroplast ca... 101 3e-18
24gb|AF315289.1|AF315289 Citrus unshiu beta-carotene hydroxylase (... 84 7e-13
25gb|AY533828.1| Citrus sinensis beta-carotene hydroxylase mRNA, p... 76 2e-10
26gb|AF296158.2|AF296158 Citrus unshiu beta-carotene hydroxylase (... 76 2e-10
27dbj|AB114669.1| Citrus limon CitHYb mRNA for beta-ring hydroxyla... 76 2e-10
28dbj|AB114653.1| Citrus unshiu CitHYb mRNA for beta-ring hydroxyl... 74 7e-10
29gb|AY559054.1| Cymodocea nodosa clone Cy16 microsatellite sequence 70 1e-08
30emb|Y09722.1|CABCH2 C.annuum mRNA for beta-carotene hydroxylase ... 68 4e-08
31dbj|AB114661.1| Citrus sinensis CitHYb mRNA for beta-ring hydrox... 66 2e-07
32gb|AY575953.1| Glycine max beta-carotene hydroxylase mRNA, compl... 64 6e-07
33gb|DQ192194.1| Daucus carota subsp. sativus putative beta-ring c... 60 1e-05
34dbj|AB027187.1| Gentiana lutea GenCHYB mRNA for beta-carotene hy... 52 0.002
35gb|DQ002893.1| Citrus maxima beta carotene hydoxylase mRNA, comp... 52 0.002
36ref|XM_473890.1| Oryza sativa (japonica cultivar-group), predic... 46 0.15
37gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 46 0.15
38emb|AL662950.2|OSJN00152 Oryza sativa genomic DNA, chromosome 4,... 46 0.15
39emb|Y14809.1|LEY14809 Lycopersicon esculentum mRNA for beta-caro... 46 0.15
40dbj|AK106295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.15
41emb|Y14810.2|LEY14810 Lycopersicon esculentum partial mRNA for b... 46 0.15
42emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete ... 46 0.15
43gb|DQ192195.1| Daucus carota subsp. sativus beta-ring carotene h... 46 0.15
44dbj|AB205042.1| Chrysanthemum x morifolium CHYB mRNA for beta-ca... 44 0.59
45dbj|AB258438.1| Diospyros kaki DK-Hyb mRNA for beta-ring hydroxy... 44 0.59
46gb|AC123713.13| Mus musculus chromosome 7, clone RP23-391D20, co... 42 2.3
47ref|XM_512028.1| PREDICTED: Pan troglodytes similar to KIAA0802 ... 42 2.3
48gb|AC137110.11| Mus musculus chromosome 7, clone RP23-399P8, com... 42 2.3
49gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 42 2.3
50ref|NM_015210.1| Homo sapiens KIAA0802 (KIAA0802), mRNA 42 2.3
51gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 42 2.3
52dbj|AK131528.1| Homo sapiens cDNA FLJ16757 fis, clone BRACE3026993 42 2.3
53dbj|AK090691.1| Homo sapiens cDNA FLJ33372 fis, clone BRACE2005981 42 2.3
54dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 2.3
55ref|NM_136618.3| Drosophila melanogaster CG8055-RA (CG8055), mRNA 42 2.3
56gb|AC008186.5|AC008186 Drosophila melanogaster, chromosome 2R, r... 42 2.3
57dbj|AB018345.2| Homo sapiens mRNA for KIAA0802 protein, partial cds 42 2.3
58gb|AY069131.1| Drosophila melanogaster GH13992 full insert cDNA 42 2.3
59gb|AE003834.3| Drosophila melanogaster chromosome 2R, section 16... 42 2.3
60dbj|AP000864.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 42 2.3
61gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 9.2
62gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 9.2
63gb|AY598782.1| Simian adenovirus 3 strain ATCC VR-1449, complete... 40 9.2
64ref|XM_367779.1| Magnaporthe grisea 70-15 chromosome III hypothe... 40 9.2
65gb|AE009182.1| Agrobacterium tumefaciens str. C58 circular chrom... 40 9.2
66ref|NM_010709.1| Mus musculus ligatin (Lgtn), mRNA 40 9.2
67ref|XM_653669.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 9.2
68gb|AC109262.13| Mus musculus chromosome 1, clone RP23-31H15, com... 40 9.2
69ref|XM_988475.1| PREDICTED: Mus musculus gene model 24, (NCBI) (... 40 9.2
70ref|XM_906408.2| PREDICTED: Mus musculus gene model 24, (NCBI) (... 40 9.2
71ref|XM_111442.5| PREDICTED: Mus musculus gene model 24, (NCBI) (... 40 9.2
72emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 40 9.2
73gb|BC023709.1| Mus musculus ligatin, mRNA (cDNA clone IMAGE:5346... 40 9.2
74gb|BC025036.1| Mus musculus ligatin, mRNA (cDNA clone MGC:36900 ... 40 9.2
75emb|BX901957.4| Zebrafish DNA sequence from clone CH211-150G5 in... 40 9.2
76gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 9.2
77emb|AL121776.19|HSJ1050K3 Human DNA sequence from clone RP5-1050... 40 9.2
78emb|BX640452.1| Bordetella bronchiseptica strain RB50, complete ... 40 9.2
79emb|BX640436.1| Bordetella parapertussis strain 12822, complete ... 40 9.2
80emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ... 40 9.2
81emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 40 9.2
82emb|AL606968.9| Mouse DNA sequence from clone RP23-287K23 on chr... 40 9.2
83gb|AC160633.3| Mus musculus chromosome 8, clone RP23-407P24, com... 40 9.2
84gb|AE005941.1| Caulobacter crescentus CB15 section 267 of 359 of... 40 9.2
85dbj|AK133022.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 9.2
86gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 40 9.2
87dbj|AK139052.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 9.2
88dbj|AK161269.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 9.2
89ref|NM_175486.1| Mus musculus RIKEN cDNA 6430571L13 gene (643057... 40 9.2
90dbj|AK171115.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 9.2
91dbj|AK168120.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 40 9.2
92dbj|AK166085.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 40 9.2
93dbj|AK167980.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 40 9.2
94gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, co... 40 9.2
95dbj|AK170448.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 9.2
96dbj|AK170252.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 9.2
97dbj|AK043338.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 9.2
98dbj|AK085251.1| Mus musculus 0 day neonate kidney cDNA, RIKEN fu... 40 9.2
99dbj|AK047005.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 9.2
100dbj|AK036154.1| Mus musculus 16 days neonate cerebellum cDNA, RI... 40 9.2
101dbj|AK032501.1| Mus musculus adult male olfactory brain cDNA, RI... 40 9.2
102dbj|AK032358.1| Mus musculus adult male olfactory brain cDNA, RI... 40 9.2
103dbj|AK046539.1| Mus musculus adult male adrenal gland cDNA, RIKE... 40 9.2
104dbj|AK083638.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 9.2
105dbj|AK034115.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 9.2
106dbj|AK082748.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 9.2
107dbj|AK078472.1| Mus musculus 12 days embryo female mullerian duc... 40 9.2
108gb|AF327876.1|AF327876 Chlamydomonas reinhardtii PF6 protein gen... 40 9.2
109dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, compl... 40 9.2
110gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 40 9.2
111gb|AY631367.1| Sterna albostriata NADH dehydrogenase subunit 2 (... 40 9.2
112gb|AY631361.1| Chlidonias niger NADH dehydrogenase subunit 2 (ND... 40 9.2
113gb|AY631360.1| Chlidonias leucopterus NADH dehydrogenase subunit... 40 9.2
114gb|AY631357.1| Anous stolidus NADH dehydrogenase subunit 2 (ND2)... 40 9.2
115emb|AL808022.4| Mouse DNA sequence from clone RP23-263N6 on chro... 40 9.2
116gb|AC116892.10| Mus musculus chromosome 8, clone RP24-529J16, co... 40 9.2
117gb|AC005509.1|AC005509 Homo sapiens chromosome 4 clone B200N5 ma... 40 9.2
118gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 40 9.2
119gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 9.2
120gb|U58337.1|MMU58337 Mus musculus ligatin (Lgtn) mRNA, partial cds 40 9.2
121emb|AL672070.12| Mouse DNA sequence from clone RP23-115A1 on chr... 40 9.2
122emb|AL606756.17| Mouse DNA sequence from clone RP23-265O19 on ch... 40 9.2

>gb|AY844956.1| Zea mays beta-carotene hydroxylase (HYD1) mRNA, complete cds
          Length = 1392

 Score =  817 bits (412), Expect = 0.0
 Identities = 541/584 (92%)
 Strand = Plus / Plus

                                                                        
Query: 7    tacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcctccgtg 66
            ||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |||||
Sbjct: 429  tacctggtggccgccgtgatgtccagcctcggggtcacgtccatggccgtcgccgccgtg 488

                                                                        
Query: 67   tactaccgcttcgcctggcaaatggagggcggcgaggtgccgatgaccgagatgctgggc 126
            ||||| ||||||  |||||||||||||||||||| ||||||| ||| ||||||| | |||
Sbjct: 489  tactatcgcttcagctggcaaatggagggcggcgcggtgccggtgagcgagatgttcggc 548

                                                                        
Query: 127  acgttcgcgctctccgtcggcgcggcggtcgggatggagttctgggcgcagtgggcgcac 186
            ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||
Sbjct: 549  acgtttgcgctctccgtcggcgcggcggtcgggatggagttttgggcgcggtgggcgcac 608

                                                                        
Query: 187  aaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgcgcgac 246
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 609  cgggcgctgtggcacgcctccctgtggcacatgcacgagtcgcaccaccggccgcgcgag 668

                                                                        
Query: 247  gggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcgccctc 306
            || || ||||||||||||||||| ||||||||| |||||||||||||||||||| |||||
Sbjct: 669  ggcccattcgagctcaacgacgtgttcgccatcgtcaacgccgtgccggccatctccctc 728

                                                                        
Query: 307  ctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgggcctt 366
            |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 729  ctcgcctacggcttcttccaccgcggcctcgtgcccggcctatgcttcggcgcgggcctc 788

                                                                        
Query: 367  gggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgc 426
            ||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 789  gggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtccaccgccgc 848

                                                                        
Query: 427  ttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctcacaag 486
            || || ||||||||||||||| |||||||||||||||| |||||||||||||||||||||
Sbjct: 849  tttccggtcggccccatcgccaacgtgccctacttccgccgagtggctgccgctcacaag 908

                                                                        
Query: 487  atacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaaggag 546
            |||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||
Sbjct: 909  atacaccacatggacaagtttgagggcgtcccgtatgggctcttcctgggaccaaaggag 968

                                                        
Query: 547  ctggaggacgttggtggcctcgacgagctggagcaggagctcgc 590
            |||||||| || |||||||| |||||||||||  ||||||||||
Sbjct: 969  ctggaggaggtcggtggcctggacgagctggaaaaggagctcgc 1012



to top

>gb|BT018945.1| Zea mays clone Contig93.F mRNA sequence
          Length = 1119

 Score =  813 bits (410), Expect = 0.0
 Identities = 533/574 (92%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
           |||||||||||||||||||||| ||||| ||||| || ||||| ||||||||| ||||| 
Sbjct: 313 ggacgtacctggtggccgccgtgatgtctagcctcggagtcacgtccatggccgtcgccg 372

                                                                       
Query: 62  ccgtgtactaccgcttcgcctggcaaatggagggcggcgaggtgccgatgaccgagatgc 121
           |||||||||| ||||||  |||||||||||||||||||||||||||| ||| ||||| ||
Sbjct: 373 ccgtgtactatcgcttcagctggcaaatggagggcggcgaggtgccggtgatcgagacgc 432

                                                                       
Query: 122 tgggcacgttcgcgctctccgtcggcgcggcggtcgggatggagttctgggcgcagtggg 181
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 433 tgggcacgttcgcgctctccgtcggggcggcggtcgggatggagttctgggcgcggtggg 492

                                                                       
Query: 182 cgcacaaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgc 241
           |||||  ||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 493 cgcaccgggcgctgtggcacgcctccctgtggcacatgcacgagtcgcaccaccggccgc 552

                                                                       
Query: 242 gcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcg 301
           |||| || |||||||||||||||||||| ||||||||| ||||||||| |||||||||| 
Sbjct: 553 gcgagggccccttcgagctcaacgacgtgttcgccatcgtcaacgccgcgccggccatct 612

                                                                       
Query: 302 ccctcctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgg 361
           |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
Sbjct: 613 ccctcctcgcctacggcttcttccaccgcggcatcgtgcccggcctctgcttcggcgcgg 672

                                                                       
Query: 362 gccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccacc 421
           |||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 673 gcctggggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtccacc 732

                                                                       
Query: 422 gccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctc 481
           ||||||| || |||||||||||||||||||||||||||||||| |||||||||||| | |
Sbjct: 733 gccgctttccggtcggccccatcgccgacgtgccctacttccgccgagtggctgcctcgc 792

                                                                       
Query: 482 acaagatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggaccca 541
           |||||||||||||||||||||||||||  ||||| ||||||||||||||||||||||| |
Sbjct: 793 acaagatacaccacatggacaagttcggcggcgtcccgtatgggctcttcctgggaccaa 852

                                             
Query: 542 aggagctggaggacgttggtggcctcgacgagct 575
           ||||||||||||| ||||||||||| ||||||||
Sbjct: 853 aggagctggaggaggttggtggcctggacgagct 886



to top

>gb|AY844958.1| Zea mays beta-carotene hydroxylase (HYD3) mRNA, complete cds
          Length = 1277

 Score =  813 bits (410), Expect = 0.0
 Identities = 533/574 (92%)
 Strand = Plus / Plus

                                                                        
Query: 2    ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
            |||||||||||||||||||||| ||||| ||||| || ||||| ||||||||| ||||| 
Sbjct: 438  ggacgtacctggtggccgccgtgatgtctagcctcggagtcacgtccatggccgtcgccg 497

                                                                        
Query: 62   ccgtgtactaccgcttcgcctggcaaatggagggcggcgaggtgccgatgaccgagatgc 121
            |||||||||| ||||||  |||||||||||||||||||||||||||| ||| ||||| ||
Sbjct: 498  ccgtgtactatcgcttcagctggcaaatggagggcggcgaggtgccggtgatcgagacgc 557

                                                                        
Query: 122  tgggcacgttcgcgctctccgtcggcgcggcggtcgggatggagttctgggcgcagtggg 181
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 558  tgggcacgttcgcgctctccgtcggggcggcggtcgggatggagttctgggcgcggtggg 617

                                                                        
Query: 182  cgcacaaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgc 241
            |||||  ||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 618  cgcaccgggcgctgtggcacgcctccctgtggcacatgcacgagtcgcaccaccggccgc 677

                                                                        
Query: 242  gcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcg 301
            |||| || |||||||||||||||||||| ||||||||| ||||||||| |||||||||| 
Sbjct: 678  gcgagggccccttcgagctcaacgacgtgttcgccatcgtcaacgccgcgccggccatct 737

                                                                        
Query: 302  ccctcctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgg 361
            |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
Sbjct: 738  ccctcctcgcctacggcttcttccaccgcggcatcgtgcccggcctctgcttcggcgcgg 797

                                                                        
Query: 362  gccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccacc 421
            |||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 798  gcctggggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtccacc 857

                                                                        
Query: 422  gccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctc 481
            ||||||| || |||||||||||||||||||||||||||||||| |||||||||||| | |
Sbjct: 858  gccgctttccggtcggccccatcgccgacgtgccctacttccgccgagtggctgcctcgc 917

                                                                        
Query: 482  acaagatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggaccca 541
            |||||||||||||||||||||||||||  ||||| ||||||||||||||||||||||| |
Sbjct: 918  acaagatacaccacatggacaagttcggcggcgtcccgtatgggctcttcctgggaccaa 977

                                              
Query: 542  aggagctggaggacgttggtggcctcgacgagct 575
            ||||||||||||| ||||||||||| ||||||||
Sbjct: 978  aggagctggaggaggttggtggcctggacgagct 1011



to top

>ref|XM_473611.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 930

 Score =  759 bits (383), Expect = 0.0
 Identities = 548/603 (90%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
           ||||||||||||| || ||||||||||||||||| ||  |||| ||||||||| ||||| 
Sbjct: 320 ggacgtacctggttgcggccgtcatgtccagcctcggcttcacgtccatggccgtcgccg 379

                                                                       
Query: 62  ccgtgtactaccgcttcgcctggcaaatggagggcggcgaggtgccgatgaccgagatgc 121
           |||||||||||||||||   |||||| |||||||||| || |||||||||||||||||| 
Sbjct: 380 ccgtgtactaccgcttccattggcaactggagggcggggatgtgccgatgaccgagatgt 439

                                                                       
Query: 122 tgggcacgttcgcgctctccgtcggcgcggcggtcgggatggagttctgggcgcagtggg 181
           | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct: 440 ttggcacgtttgcgctctccgtcggcgcagcggttgggatggagttctgggcgcagtggg 499

                                                                       
Query: 182 cgcacaaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgc 241
           |||||    ||||||||||||| ||||||||||||||||||||||||||||||||  |||
Sbjct: 500 cgcaccgctcgctgtggcacgcctccctgtggcacatgcacgagtcgcaccaccgtgcgc 559

                                                                       
Query: 242 gcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcg 301
           |||| || || ||||||||||||||||| |||||||||| ||||||||||||||||||| 
Sbjct: 560 gcgagggcccgttcgagctcaacgacgtgttcgccatcaccaacgccgtgccggccatct 619

                                                                       
Query: 302 ccctcctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgg 361
           |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||
Sbjct: 620 ccctcctcgcctacggcttcttccaccggggcatcgtccccggcctctgcttcggcgcgg 679

                                                                       
Query: 362 gccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccacc 421
           |||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 680 gcctcgggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtccacc 739

                                                                       
Query: 422 gccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctc 481
           |||||||||||||||||||||||||  | ||||||||||||||||||||||| || || |
Sbjct: 740 gccgcttccccgtcggccccatcgcgaatgtgccctacttccggcgagtggccgcggccc 799

                                                                       
Query: 482 acaagatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggaccca 541
           ||||||||||||||| |||||||||||||||||||||||||||||| || || |||||||
Sbjct: 800 acaagatacaccacacggacaagttcgagggcgtaccgtatgggctgtttcttggaccca 859

                                                                       
Query: 542 aggagctggaggacgttggtggcctcgacgagctggagcaggagctcgccagaatcaacc 601
           ||||||||||||| |||||||| || || ||||||||| ||||||| || ||||||||||
Sbjct: 860 aggagctggaggaggttggtggtctggaagagctggagaaggagcttgcgagaatcaacc 919

              
Query: 602 gga 604
           |||
Sbjct: 920 gga 922



to top

>dbj|AK060559.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-E08, full
            insert sequence
          Length = 1457

 Score =  759 bits (383), Expect = 0.0
 Identities = 548/603 (90%)
 Strand = Plus / Plus

                                                                        
Query: 2    ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
            ||||||||||||| || ||||||||||||||||| ||  |||| ||||||||| ||||| 
Sbjct: 422  ggacgtacctggttgcggccgtcatgtccagcctcggcttcacgtccatggccgtcgccg 481

                                                                        
Query: 62   ccgtgtactaccgcttcgcctggcaaatggagggcggcgaggtgccgatgaccgagatgc 121
            |||||||||||||||||   |||||| |||||||||| || |||||||||||||||||| 
Sbjct: 482  ccgtgtactaccgcttccattggcaactggagggcggggatgtgccgatgaccgagatgt 541

                                                                        
Query: 122  tgggcacgttcgcgctctccgtcggcgcggcggtcgggatggagttctgggcgcagtggg 181
            | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct: 542  ttggcacgtttgcgctctccgtcggcgcagcggttgggatggagttctgggcgcagtggg 601

                                                                        
Query: 182  cgcacaaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgc 241
            |||||    ||||||||||||| ||||||||||||||||||||||||||||||||  |||
Sbjct: 602  cgcaccgctcgctgtggcacgcctccctgtggcacatgcacgagtcgcaccaccgtgcgc 661

                                                                        
Query: 242  gcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcg 301
            |||| || || ||||||||||||||||| |||||||||| ||||||||||||||||||| 
Sbjct: 662  gcgagggcccgttcgagctcaacgacgtgttcgccatcaccaacgccgtgccggccatct 721

                                                                        
Query: 302  ccctcctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgg 361
            |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||
Sbjct: 722  ccctcctcgcctacggcttcttccaccggggcatcgtccccggcctctgcttcggcgcgg 781

                                                                        
Query: 362  gccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccacc 421
            |||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 782  gcctcgggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtccacc 841

                                                                        
Query: 422  gccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctc 481
            |||||||||||||||||||||||||  | ||||||||||||||||||||||| || || |
Sbjct: 842  gccgcttccccgtcggccccatcgcgaatgtgccctacttccggcgagtggccgcggccc 901

                                                                        
Query: 482  acaagatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggaccca 541
            ||||||||||||||| |||||||||||||||||||||||||||||| || || |||||||
Sbjct: 902  acaagatacaccacacggacaagttcgagggcgtaccgtatgggctgtttcttggaccca 961

                                                                        
Query: 542  aggagctggaggacgttggtggcctcgacgagctggagcaggagctcgccagaatcaacc 601
            ||||||||||||| |||||||| || || ||||||||| ||||||| || ||||||||||
Sbjct: 962  aggagctggaggaggttggtggtctggaagagctggagaaggagcttgcgagaatcaacc 1021

               
Query: 602  gga 604
            |||
Sbjct: 1022 gga 1024



to top

>gb|AY104495.1| Zea mays PCO148057 mRNA sequence
          Length = 736

 Score =  638 bits (322), Expect = e-180
 Identities = 406/434 (93%)
 Strand = Plus / Plus

                                                                       
Query: 142 gtcggcgcggcggtcgggatggagttctgggcgcagtgggcgcacaaggcgctgtggcac 201
           ||||| |||||||||||||||||||||||||||| ||||||||||  |||||||||||||
Sbjct: 33  gtcggggcggcggtcgggatggagttctgggcgcggtgggcgcaccgggcgctgtggcac 92

                                                                       
Query: 202 gcgtccctgtggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctc 261
           || ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 93  gcctccctgtggcacatgcacgagtcgcaccaccggccgcgcgagggccccttcgagctc 152

                                                                       
Query: 262 aacgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttc 321
           |||||||| ||||||||| ||||||||| |||||||||| ||||||||||||||||||||
Sbjct: 153 aacgacgtgttcgccatcgtcaacgccgcgccggccatctccctcctcgcctacggcttc 212

                                                                       
Query: 322 ttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttc 381
           |||||||||||| |||| |||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 213 ttccaccgcggcatcgtgcccggcctctgcttcggcgcgggcctggggattacgctgttc 272

                                                                       
Query: 382 gggatggcatacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggcccc 441
           || ||||| |||||||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 273 ggcatggcctacatgttcgtccacgacggcctggtccaccgccgctttccggtcggcccc 332

                                                                       
Query: 442 atcgccgacgtgccctacttccggcgagtggctgccgctcacaagatacaccacatggac 501
           ||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||
Sbjct: 333 atcgccgacgtgccctacttccgccgagtggctgcctcgcacaagatacaccacatggac 392

                                                                       
Query: 502 aagttcgagggcgtaccgtatgggctcttcctgggacccaaggagctggaggacgttggt 561
           |||||||  ||||| ||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 393 aagttcggcggcgtcccgtatgggctcttcctgggaccaaaggagctggaggaggttggt 452

                         
Query: 562 ggcctcgacgagct 575
           ||||| ||||||||
Sbjct: 453 ggcctggacgagct 466



to top

>ref|NM_197521.1| Oryza sativa (japonica cultivar-group) putative beta-carotene
           hydroxylase (OSJNBa0053C23.24), mRNA
          Length = 879

 Score =  569 bits (287), Expect = e-159
 Identities = 496/566 (87%), Gaps = 6/566 (1%)
 Strand = Plus / Plus

                                                                       
Query: 4   acgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcctcc 63
           |||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| ||
Sbjct: 244 acgtacctggtggcggcggtgatgtccagcctcgggttcacgtccatggccgccgccgcc 303

                                                                       
Query: 64  gtgtactaccgcttcgcctggcaaatggagg------gcggcgaggtgccgatgaccgag 117
           || ||||||||||||||||||||||||||||      ||||||| || |||  ||| |||
Sbjct: 304 gtctactaccgcttcgcctggcaaatggaggccggcggcggcgacgttccggcgacggag 363

                                                                       
Query: 118 atgctgggcacgttcgcgctctccgtcggcgcggcggtcgggatggagttctgggcgcag 177
           ||| | |||||||||||| | || || || |||||||| ||||||||||||||||||| |
Sbjct: 364 atggtcggcacgttcgcgttgtcggtgggggcggcggtggggatggagttctgggcgcgg 423

                                                                       
Query: 178 tgggcgcacaaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccgg 237
           |||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||| 
Sbjct: 424 tgggcgcaccgggcgctgtggcacgcgtcgctgtggcacatgcacgagtcgcaccaccgc 483

                                                                       
Query: 238 ccgcgcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggcc 297
           ||||||||||| || |||||||||||||||||||||||||||  ||||||||  ||||||
Sbjct: 484 ccgcgcgacggcccgttcgagctcaacgacgtcttcgccatcgccaacgccgccccggcc 543

                                                                       
Query: 298 atcgccctcctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggc 357
           ||| ||||||||||||||||| || || ||||||||||| ||||||||||||||||||||
Sbjct: 544 atctccctcctcgcctacggcctcctcaaccgcggcctcctccccggcctctgcttcggc 603

                                                                       
Query: 358 gcgggccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtc 417
           ||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 604 gcggggcttgggattacgctgttcgggatggcgtacatgttcgtccacgacggcctggtc 663

                                                                       
Query: 418 caccgccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgcc 477
           ||||| ||||||||||| || |||||||   |||||||||||||||| ||||| ||||||
Sbjct: 664 caccggcgcttccccgtggggcccatcgagaacgtgccctacttccgccgagttgctgcc 723

                                                                       
Query: 478 gctcacaagatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctggga 537
           || ||| ||||||| |||| |||||||||||| ||||| || || || || ||||| |||
Sbjct: 724 gcccaccagatacatcacacggacaagttcgaaggcgtgccctacggcctgttcctcgga 783

                                     
Query: 538 cccaaggagctggaggacgttggtgg 563
           ||||||||| ||||||| || |||||
Sbjct: 784 cccaaggagttggaggaggtgggtgg 809



to top

>gb|BT009105.1| Triticum aestivum clone wkm2n.pk008.a5:fis, full insert mRNA
           sequence
          Length = 773

 Score =  430 bits (217), Expect = e-117
 Identities = 328/365 (89%)
 Strand = Plus / Plus

                                                                       
Query: 190 gcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgcgcgacggg 249
           ||||||||||||||||| |||||| |||||||||||||||||||||  || |||||||||
Sbjct: 8   gcgctgtggcacgcgtcgctgtgggacatgcacgagtcgcaccacctcccccgcgacggg 67

                                                                       
Query: 250 cccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctc 309
           |||||||||||||||||||| ||||||||| |||||||||| || ||||| |||||||||
Sbjct: 68  cccttcgagctcaacgacgtgttcgccatcgtcaacgccgtccccgccatggccctcctc 127

                                                                       
Query: 310 gcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttggg 369
           |||| |||||||||| ||||||||||| |||||||||||||||||||||| || || |||
Sbjct: 128 gccttcggcttcttcaaccgcggcctcctccccggcctctgcttcggcgccggtctgggg 187

                                                                       
Query: 370 attacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgcttc 429
           || ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||
Sbjct: 188 atcacgctgttcgggatggcctacatgttcgtccacgacggcctggtgcaccgccgcttc 247

                                                                       
Query: 430 cccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctcacaagata 489
           ||||| ||||||||||   |||||||||||||||||||||| || ||||| ||| |||| 
Sbjct: 248 cccgtgggccccatcgagaacgtgccctacttccggcgagtcgccgccgcgcaccagatc 307

                                                                       
Query: 490 caccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaaggagctg 549
           || |||||||||||||||||  |||| || || ||||||||||| || ||||||||||||
Sbjct: 308 catcacatggacaagttcgacagcgtgccatacgggctcttcctcggccccaaggagctg 367

                
Query: 550 gagga 554
           |||||
Sbjct: 368 gagga 372



to top

>emb|AJ416711.2|CSA416711 Crocus sativus mRNA for beta-carotene hydroxylase (bch1cs gene)
          Length = 918

 Score =  355 bits (179), Expect = 1e-94
 Identities = 437/523 (83%)
 Strand = Plus / Plus

                                                                       
Query: 41  tcacctccatggccatcgcctccgtgtactaccgcttcgcctggcaaatggagggcggcg 100
           |||| |||||||||  |||| |||| |||||||||||||| |||||||||||||| || |
Sbjct: 323 tcacatccatggccgccgccgccgtctactaccgcttcgcttggcaaatggagggagggg 382

                                                                       
Query: 101 aggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcggcggtcggga 160
           | |||||  |||| ||||||  ||| |||||||| ||||| ||||| ||||| || ||||
Sbjct: 383 atgtgccagtgacggagatggcgggaacgttcgctctctcggtcggggcggccgtgggga 442

                                                                       
Query: 161 tggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcacatgc 220
           |||||||||||||   |||||| |||  ||| || ||||||||||| || ||||||||||
Sbjct: 443 tggagttctgggccaggtgggcccaccgggcactctggcacgcgtcgctctggcacatgc 502

                                                                       
Query: 221 acgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgccatca 280
           ||||||| |||||||||||| | || || || |||||||||||||||||||||||||| |
Sbjct: 503 acgagtcccaccaccggccgagggagggccctttcgagctcaacgacgtcttcgccataa 562

                                                                       
Query: 281 tcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctcgtcc 340
           ||||||| || || |||||||||||||||  || ||||||||||||| | || ||| |||
Sbjct: 563 tcaacgcggtccccgccatcgccctcctcaacttcggcttcttccacagaggtctcctcc 622

                                                                       
Query: 341 ccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggcatacatgttcg 400
           |||||||||| |||||||| || || ||||| ||||| || || || || ||||||||||
Sbjct: 623 ccggcctctgtttcggcgccgggctggggatcacgctgtttggtattgcgtacatgttcg 682

                                                                       
Query: 401 tccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgacgtgccctact 460
           |||||||||| || |||||||| || ||||| || || ||||||||||||||||||||||
Sbjct: 683 tccacgacgggctagtccaccggcggttccctgtggggcccatcgccgacgtgccctact 742

                                                                       
Query: 461 tccggcgagtggctgccgctcacaagatacaccacatggacaagttcgagggcgtaccgt 520
           ||| ||| || || || |||||| |||| ||||||  ||| |||||||| || || || |
Sbjct: 743 tccagcgcgtcgccgctgctcaccagatccaccactcggagaagttcgaaggggtgccct 802

                                                      
Query: 521 atgggctcttcctgggacccaaggagctggaggacgttggtgg 563
           |||| || ||| |||| ||||||||  |||||||  |||||||
Sbjct: 803 atggactgttcatggggcccaaggaattggaggagattggtgg 845



to top

>gb|AY844957.1| Zea mays beta-carotene hydroxylase (HYD3) gene, complete cds
          Length = 2400

 Score =  319 bits (161), Expect = 7e-84
 Identities = 197/209 (94%)
 Strand = Plus / Plus

                                                                        
Query: 153  ggtcgggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtg 212
            ||||||||||||||||||||||| ||||||||||  ||||||||||||||| ||||||||
Sbjct: 1284 ggtcgggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcctccctgtg 1343

                                                                        
Query: 213  gcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtctt 272
            ||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||
Sbjct: 1344 gcacatgcacgagtcgcaccaccggccgcgcgagggccccttcgagctcaacgacgtgtt 1403

                                                                        
Query: 273  cgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcgg 332
            ||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1404 cgccatcgtcaacgccgcgccggccatctccctcctcgcctacggcttcttccaccgcgg 1463

                                         
Query: 333  cctcgtccccggcctctgcttcggcgcgg 361
            | |||| ||||||||||||||||||||||
Sbjct: 1464 catcgtgcccggcctctgcttcggcgcgg 1492



 Score =  182 bits (92), Expect = 1e-42
 Identities = 122/132 (92%)
 Strand = Plus / Plus

                                                                        
Query: 360  gggccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtcca 419
            |||||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 1643 gggcctggggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtcca 1702

                                                                        
Query: 420  ccgccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgc 479
            ||||||||| || |||||||||||||||||||||||||||||||| |||||||||||| |
Sbjct: 1703 ccgccgctttccggtcggccccatcgccgacgtgccctacttccgccgagtggctgcctc 1762

                        
Query: 480  tcacaagataca 491
             |||||| ||||
Sbjct: 1763 gcacaaggtaca 1774



 Score =  105 bits (53), Expect = 2e-19
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
           |||||||||||||||||||||| ||||| ||||| || ||||| ||||||||| ||||| 
Sbjct: 864 ggacgtacctggtggccgccgtgatgtctagcctcggagtcacgtccatggccgtcgccg 923

                                            
Query: 62  ccgtgtactaccgcttcgcctggcaaatggagg 94
           |||||||||| ||||||  ||||||||||||||
Sbjct: 924 ccgtgtactatcgcttcagctggcaaatggagg 956



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                        
Query: 92   agggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcgg 151
            ||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||| ||||
Sbjct: 1135 agggcggcgaggtgccggtgatcgagacgctgggcacgttcgcgctctccgtcggggcgg 1194

                
Query: 152  cggt 155
            ||||
Sbjct: 1195 cggt 1198



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                        
Query: 485  agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
            ||||||||||||||||||||||||  ||||| ||||||||||||||||||||||| ||||
Sbjct: 1965 agatacaccacatggacaagttcggcggcgtcccgtatgggctcttcctgggaccaaagg 2024



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 542  aggagctggaggacgttggtggcctcgacgagct 575
            ||||||||||||| ||||||||||| ||||||||
Sbjct: 2120 aggagctggaggaggttggtggcctggacgagct 2153



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  303 bits (153), Expect = 4e-79
 Identities = 192/205 (93%)
 Strand = Plus / Minus

                                                                           
Query: 157     gggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcac 216
               ||||||||||||||||||| ||||||||||  |||||||||||||||||| |||||||||
Sbjct: 1418149 gggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcgtcgctgtggcac 1418090

                                                                           
Query: 217     atgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgcc 276
               |||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 1418089 atgcacgagtcgcaccaccgcccgcgagacgggccgttcgagctcaacgacgtcttcgcc 1418030

                                                                           
Query: 277     atcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctc 336
               |||| ||||||||| ||||||||  |||||||||||||||||||||||  ||||||||||
Sbjct: 1418029 atcaccaacgccgtcccggccatgtccctcctcgcctacggcttcttcacccgcggcctc 1417970

                                        
Query: 337     gtccccggcctctgcttcggcgcgg 361
               |||||||||||||||||||||||||
Sbjct: 1417969 gtccccggcctctgcttcggcgcgg 1417945



 Score =  145 bits (73), Expect = 2e-31
 Identities = 94/101 (93%)
 Strand = Plus / Minus

                                                                           
Query: 367     gggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgc 426
               ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1417006 gggatcacgctgttcgggatggcgtacatgttcgtccacgacggcctggtccaccgccgc 1416947

                                                        
Query: 427     ttccccgtcggccccatcgccgacgtgccctacttccggcg 467
               ||||| || || ||||||||| |||||||||||||||||||
Sbjct: 1416946 ttcccggtggggcccatcgccaacgtgccctacttccggcg 1416906



 Score =  105 bits (53), Expect = 2e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                           
Query: 2       ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
               |||||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| 
Sbjct: 1418493 ggacgtacctggtggcagcggtgatgtccagcctcgggatcacgtccatggccgccgccg 1418434

                                                
Query: 62      ccgtgtactaccgcttcgcctggcaaatggagg 94
               |||| ||||||||||||||||||||||||||||
Sbjct: 1418433 ccgtctactaccgcttcgcctggcaaatggagg 1418401



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                           
Query: 485     agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
               ||||||| ||||||||||||||||| || || || |||||||| ||||| || |||||||
Sbjct: 1416765 agatacatcacatggacaagttcgaaggtgtgccatatgggctgttccttggtcccaagg 1416706



to top

>gb|AC119747.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1293G11,
             from chromosome 3, complete sequence
          Length = 147806

 Score =  303 bits (153), Expect = 4e-79
 Identities = 192/205 (93%)
 Strand = Plus / Minus

                                                                         
Query: 157   gggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcac 216
             ||||||||||||||||||| ||||||||||  |||||||||||||||||| |||||||||
Sbjct: 79652 gggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcgtcgctgtggcac 79593

                                                                         
Query: 217   atgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgcc 276
             |||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 79592 atgcacgagtcgcaccaccgcccgcgagacgggccgttcgagctcaacgacgtcttcgcc 79533

                                                                         
Query: 277   atcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctc 336
             |||| ||||||||| ||||||||  |||||||||||||||||||||||  ||||||||||
Sbjct: 79532 atcaccaacgccgtcccggccatgtccctcctcgcctacggcttcttcacccgcggcctc 79473

                                      
Query: 337   gtccccggcctctgcttcggcgcgg 361
             |||||||||||||||||||||||||
Sbjct: 79472 gtccccggcctctgcttcggcgcgg 79448



 Score =  145 bits (73), Expect = 2e-31
 Identities = 94/101 (93%)
 Strand = Plus / Minus

                                                                         
Query: 367   gggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgc 426
             ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 78509 gggatcacgctgttcgggatggcgtacatgttcgtccacgacggcctggtccaccgccgc 78450

                                                      
Query: 427   ttccccgtcggccccatcgccgacgtgccctacttccggcg 467
             ||||| || || ||||||||| |||||||||||||||||||
Sbjct: 78449 ttcccggtggggcccatcgccaacgtgccctacttccggcg 78409



 Score =  105 bits (53), Expect = 2e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                         
Query: 2     ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
             |||||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| 
Sbjct: 79996 ggacgtacctggtggcagcggtgatgtccagcctcgggatcacgtccatggccgccgccg 79937

                                              
Query: 62    ccgtgtactaccgcttcgcctggcaaatggagg 94
             |||| ||||||||||||||||||||||||||||
Sbjct: 79936 ccgtctactaccgcttcgcctggcaaatggagg 79904



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 485   agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
             ||||||| ||||||||||||||||| || || || |||||||| ||||| || |||||||
Sbjct: 78268 agatacatcacatggacaagttcgaaggtgtgccatatgggctgttccttggtcccaagg 78209



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  303 bits (153), Expect = 4e-79
 Identities = 192/205 (93%)
 Strand = Plus / Minus

                                                                           
Query: 157     gggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcac 216
               ||||||||||||||||||| ||||||||||  |||||||||||||||||| |||||||||
Sbjct: 1418147 gggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcgtcgctgtggcac 1418088

                                                                           
Query: 217     atgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgcc 276
               |||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 1418087 atgcacgagtcgcaccaccgcccgcgagacgggccgttcgagctcaacgacgtcttcgcc 1418028

                                                                           
Query: 277     atcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctc 336
               |||| ||||||||| ||||||||  |||||||||||||||||||||||  ||||||||||
Sbjct: 1418027 atcaccaacgccgtcccggccatgtccctcctcgcctacggcttcttcacccgcggcctc 1417968

                                        
Query: 337     gtccccggcctctgcttcggcgcgg 361
               |||||||||||||||||||||||||
Sbjct: 1417967 gtccccggcctctgcttcggcgcgg 1417943



 Score =  145 bits (73), Expect = 2e-31
 Identities = 94/101 (93%)
 Strand = Plus / Minus

                                                                           
Query: 367     gggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgc 426
               ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1417004 gggatcacgctgttcgggatggcgtacatgttcgtccacgacggcctggtccaccgccgc 1416945

                                                        
Query: 427     ttccccgtcggccccatcgccgacgtgccctacttccggcg 467
               ||||| || || ||||||||| |||||||||||||||||||
Sbjct: 1416944 ttcccggtggggcccatcgccaacgtgccctacttccggcg 1416904



 Score =  105 bits (53), Expect = 2e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                           
Query: 2       ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
               |||||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| 
Sbjct: 1418491 ggacgtacctggtggcagcggtgatgtccagcctcgggatcacgtccatggccgccgccg 1418432

                                                
Query: 62      ccgtgtactaccgcttcgcctggcaaatggagg 94
               |||| ||||||||||||||||||||||||||||
Sbjct: 1418431 ccgtctactaccgcttcgcctggcaaatggagg 1418399



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                           
Query: 485     agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
               ||||||| ||||||||||||||||| || || || |||||||| ||||| || |||||||
Sbjct: 1416763 agatacatcacatggacaagttcgaaggtgtgccatatgggctgttccttggtcccaagg 1416704



to top

>gb|AC092389.4| Oryza sativa chromosome 10 BAC OSJNBa0053C23 genomic sequence, complete
              sequence
          Length = 194361

 Score =  301 bits (152), Expect = 2e-78
 Identities = 239/268 (89%)
 Strand = Plus / Plus

                                                                          
Query: 94     ggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcggcg 153
              |||||||| || |||  ||| |||||| | |||||||||||| | || || || ||||||
Sbjct: 103491 ggcggcgacgttccggcgacggagatggtcggcacgttcgcgttgtcggtgggggcggcg 103550

                                                                          
Query: 154    gtcgggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtgg 213
              || ||||||||||||||||||| ||||||||||  |||||||||||||||||| ||||||
Sbjct: 103551 gtggggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcgtcgctgtgg 103610

                                                                          
Query: 214    cacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttc 273
              ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 103611 cacatgcacgagtcgcaccaccgcccgcgcgacggcccgttcgagctcaacgacgtcttc 103670

                                                                          
Query: 274    gccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggc 333
              ||||||  ||||||||  ||||||||| ||||||||||||||||| || || ||||||||
Sbjct: 103671 gccatcgccaacgccgccccggccatctccctcctcgcctacggcctcctcaaccgcggc 103730

                                          
Query: 334    ctcgtccccggcctctgcttcggcgcgg 361
              ||| ||||||||||||||||||||||||
Sbjct: 103731 ctcctccccggcctctgcttcggcgcgg 103758



 Score =  151 bits (76), Expect = 4e-33
 Identities = 106/116 (91%)
 Strand = Plus / Plus

                                                                          
Query: 364    cttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgc 423
              |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 104161 cttgggattacgctgttcgggatggcgtacatgttcgtccacgacggcctggtccaccgg 104220

                                                                      
Query: 424    cgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgc 479
              ||||||||||| || |||||||   |||||||||||||||| ||||| ||||||||
Sbjct: 104221 cgcttccccgtggggcccatcgagaacgtgccctacttccgccgagttgctgccgc 104276



 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                          
Query: 4      acgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcctcc 63
              |||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| ||
Sbjct: 103329 acgtacctggtggcggcggtgatgtccagcctcgggttcacgtccatggccgccgccgcc 103388

                                             
Query: 64     gtgtactaccgcttcgcctggcaaatggagg 94
              || ||||||||||||||||||||||||||||
Sbjct: 103389 gtctactaccgcttcgcctggcaaatggagg 103419



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                          
Query: 485    agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
              ||||||| |||| |||||||||||| ||||| || || || || ||||| ||||||||||
Sbjct: 104409 agatacatcacacggacaagttcgaaggcgtgccctacggcctgttcctcggacccaagg 104468



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  301 bits (152), Expect = 2e-78
 Identities = 239/268 (89%)
 Strand = Plus / Plus

                                                                            
Query: 94       ggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcggcg 153
                |||||||| || |||  ||| |||||| | |||||||||||| | || || || ||||||
Sbjct: 20225756 ggcggcgacgttccggcgacggagatggtcggcacgttcgcgttgtcggtgggggcggcg 20225815

                                                                            
Query: 154      gtcgggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtgg 213
                || ||||||||||||||||||| ||||||||||  |||||||||||||||||| ||||||
Sbjct: 20225816 gtggggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcgtcgctgtgg 20225875

                                                                            
Query: 214      cacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttc 273
                ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 20225876 cacatgcacgagtcgcaccaccgcccgcgcgacggcccgttcgagctcaacgacgtcttc 20225935

                                                                            
Query: 274      gccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggc 333
                ||||||  ||||||||  ||||||||| ||||||||||||||||| || || ||||||||
Sbjct: 20225936 gccatcgccaacgccgccccggccatctccctcctcgcctacggcctcctcaaccgcggc 20225995

                                            
Query: 334      ctcgtccccggcctctgcttcggcgcgg 361
                ||| ||||||||||||||||||||||||
Sbjct: 20225996 ctcctccccggcctctgcttcggcgcgg 20226023



 Score =  151 bits (76), Expect = 4e-33
 Identities = 106/116 (91%)
 Strand = Plus / Plus

                                                                            
Query: 364      cttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgc 423
                |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 20226426 cttgggattacgctgttcgggatggcgtacatgttcgtccacgacggcctggtccaccgg 20226485

                                                                        
Query: 424      cgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgc 479
                ||||||||||| || |||||||   |||||||||||||||| ||||| ||||||||
Sbjct: 20226486 cgcttccccgtggggcccatcgagaacgtgccctacttccgccgagttgctgccgc 20226541



 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                            
Query: 4        acgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcctcc 63
                |||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| ||
Sbjct: 20225594 acgtacctggtggcggcggtgatgtccagcctcgggttcacgtccatggccgccgccgcc 20225653

                                               
Query: 64       gtgtactaccgcttcgcctggcaaatggagg 94
                || ||||||||||||||||||||||||||||
Sbjct: 20225654 gtctactaccgcttcgcctggcaaatggagg 20225684



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                            
Query: 485      agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
                ||||||| |||| |||||||||||| ||||| || || || || ||||| ||||||||||
Sbjct: 20226674 agatacatcacacggacaagttcgaaggcgtgccctacggcctgttcctcggacccaagg 20226733



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  301 bits (152), Expect = 2e-78
 Identities = 239/268 (89%)
 Strand = Plus / Plus

                                                                            
Query: 94       ggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcggcg 153
                |||||||| || |||  ||| |||||| | |||||||||||| | || || || ||||||
Sbjct: 20237032 ggcggcgacgttccggcgacggagatggtcggcacgttcgcgttgtcggtgggggcggcg 20237091

                                                                            
Query: 154      gtcgggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtgg 213
                || ||||||||||||||||||| ||||||||||  |||||||||||||||||| ||||||
Sbjct: 20237092 gtggggatggagttctgggcgcggtgggcgcaccgggcgctgtggcacgcgtcgctgtgg 20237151

                                                                            
Query: 214      cacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttc 273
                ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 20237152 cacatgcacgagtcgcaccaccgcccgcgcgacggcccgttcgagctcaacgacgtcttc 20237211

                                                                            
Query: 274      gccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggc 333
                ||||||  ||||||||  ||||||||| ||||||||||||||||| || || ||||||||
Sbjct: 20237212 gccatcgccaacgccgccccggccatctccctcctcgcctacggcctcctcaaccgcggc 20237271

                                            
Query: 334      ctcgtccccggcctctgcttcggcgcgg 361
                ||| ||||||||||||||||||||||||
Sbjct: 20237272 ctcctccccggcctctgcttcggcgcgg 20237299



 Score =  151 bits (76), Expect = 4e-33
 Identities = 106/116 (91%)
 Strand = Plus / Plus

                                                                            
Query: 364      cttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgc 423
                |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 20237702 cttgggattacgctgttcgggatggcgtacatgttcgtccacgacggcctggtccaccgg 20237761

                                                                        
Query: 424      cgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgc 479
                ||||||||||| || |||||||   |||||||||||||||| ||||| ||||||||
Sbjct: 20237762 cgcttccccgtggggcccatcgagaacgtgccctacttccgccgagttgctgccgc 20237817



 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                            
Query: 4        acgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcctcc 63
                |||||||||||||| || || ||||||||||| ||| |||| |||||||||  |||| ||
Sbjct: 20236870 acgtacctggtggcggcggtgatgtccagcctcgggttcacgtccatggccgccgccgcc 20236929

                                               
Query: 64       gtgtactaccgcttcgcctggcaaatggagg 94
                || ||||||||||||||||||||||||||||
Sbjct: 20236930 gtctactaccgcttcgcctggcaaatggagg 20236960



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                            
Query: 485      agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
                ||||||| |||| |||||||||||| ||||| || || || || ||||| ||||||||||
Sbjct: 20237950 agatacatcacacggacaagttcgaaggcgtgccctacggcctgttcctcggacccaagg 20238009



to top

>emb|AL606624.4|OSJN00058 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011J08,
             complete sequence
          Length = 157734

 Score =  287 bits (145), Expect = 2e-74
 Identities = 190/205 (92%)
 Strand = Plus / Plus

                                                                         
Query: 157   gggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcac 216
             ||||||||||||||||||||||||||||||    ||||||||||||| ||||||||||||
Sbjct: 40674 gggatggagttctgggcgcagtgggcgcaccgctcgctgtggcacgcctccctgtggcac 40733

                                                                         
Query: 217   atgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgcc 276
             ||||||||||||||||||||  ||||||| || || ||||||||||||||||| ||||||
Sbjct: 40734 atgcacgagtcgcaccaccgtgcgcgcgagggcccgttcgagctcaacgacgtgttcgcc 40793

                                                                         
Query: 277   atcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctc 336
             |||| ||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||
Sbjct: 40794 atcaccaacgccgtgccggccatctccctcctcgcctacggcttcttccaccggggcatc 40853

                                      
Query: 337   gtccccggcctctgcttcggcgcgg 361
             |||||||||||||||||||||||||
Sbjct: 40854 gtccccggcctctgcttcggcgcgg 40878



 Score =  172 bits (87), Expect = 1e-39
 Identities = 117/127 (92%)
 Strand = Plus / Plus

                                                                         
Query: 360   gggccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtcca 419
             |||||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 40987 gggcctcgggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtcca 41046

                                                                         
Query: 420   ccgccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgc 479
             |||||||||||||||||||||||||||  | ||||||||||||||||||||||| || ||
Sbjct: 41047 ccgccgcttccccgtcggccccatcgcgaatgtgccctacttccggcgagtggccgcggc 41106

                    
Query: 480   tcacaag 486
              ||||||
Sbjct: 41107 ccacaag 41113



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                         
Query: 2     ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
             ||||||||||||| || ||||||||||||||||| ||  |||| ||||||||| ||||| 
Sbjct: 40281 ggacgtacctggttgcggccgtcatgtccagcctcggcttcacgtccatggccgtcgccg 40340

                              
Query: 62    ccgtgtactaccgcttc 78
             |||||||||||||||||
Sbjct: 40341 ccgtgtactaccgcttc 40357



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                         
Query: 485   agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
             |||||||||||| |||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 41233 agatacaccacacggacaagttcgagggcgtaccgtatgggctgtttcttggacccaagg 41292



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 92    agggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcgg 151
             ||||||| || |||||||||||||||||| | |||||||| ||||||||||||||||| |
Sbjct: 40509 agggcggggatgtgccgatgaccgagatgtttggcacgtttgcgctctccgtcggcgcag 40568

                 
Query: 152   cggt 155
             ||||
Sbjct: 40569 cggt 40572



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                         
Query: 542   aggagctggaggacgttggtggcctcgacgagctggagcaggagctcgccagaatcaacc 601
             ||||||||||||| |||||||| || || ||||||||| ||||||| || ||||||||||
Sbjct: 41412 aggagctggaggaggttggtggtctggaagagctggagaaggagcttgcgagaatcaacc 41471

                
Query: 602   gga 604
             |||
Sbjct: 41472 gga 41474



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  287 bits (145), Expect = 2e-74
 Identities = 190/205 (92%)
 Strand = Plus / Plus

                                                                            
Query: 157      gggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcac 216
                ||||||||||||||||||||||||||||||    ||||||||||||| ||||||||||||
Sbjct: 29131206 gggatggagttctgggcgcagtgggcgcaccgctcgctgtggcacgcctccctgtggcac 29131265

                                                                            
Query: 217      atgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgcc 276
                ||||||||||||||||||||  ||||||| || || ||||||||||||||||| ||||||
Sbjct: 29131266 atgcacgagtcgcaccaccgtgcgcgcgagggcccgttcgagctcaacgacgtgttcgcc 29131325

                                                                            
Query: 277      atcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctc 336
                |||| ||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||
Sbjct: 29131326 atcaccaacgccgtgccggccatctccctcctcgcctacggcttcttccaccggggcatc 29131385

                                         
Query: 337      gtccccggcctctgcttcggcgcgg 361
                |||||||||||||||||||||||||
Sbjct: 29131386 gtccccggcctctgcttcggcgcgg 29131410



 Score =  172 bits (87), Expect = 1e-39
 Identities = 117/127 (92%)
 Strand = Plus / Plus

                                                                            
Query: 360      gggccttgggattacgcttttcgggatggcatacatgttcgtccacgacggcctggtcca 419
                |||||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 29131519 gggcctcgggattacgctgttcggcatggcctacatgttcgtccacgacggcctggtcca 29131578

                                                                            
Query: 420      ccgccgcttccccgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgc 479
                |||||||||||||||||||||||||||  | ||||||||||||||||||||||| || ||
Sbjct: 29131579 ccgccgcttccccgtcggccccatcgcgaatgtgccctacttccggcgagtggccgcggc 29131638

                       
Query: 480      tcacaag 486
                 ||||||
Sbjct: 29131639 ccacaag 29131645



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                            
Query: 2        ggacgtacctggtggccgccgtcatgtccagcctaggggtcacctccatggccatcgcct 61
                ||||||||||||| || ||||||||||||||||| ||  |||| ||||||||| ||||| 
Sbjct: 29130813 ggacgtacctggttgcggccgtcatgtccagcctcggcttcacgtccatggccgtcgccg 29130872

                                 
Query: 62       ccgtgtactaccgcttc 78
                |||||||||||||||||
Sbjct: 29130873 ccgtgtactaccgcttc 29130889



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                            
Query: 485      agatacaccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaagg 544
                |||||||||||| |||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 29131765 agatacaccacacggacaagttcgagggcgtaccgtatgggctgtttcttggacccaagg 29131824



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                            
Query: 92       agggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctccgtcggcgcgg 151
                ||||||| || |||||||||||||||||| | |||||||| ||||||||||||||||| |
Sbjct: 29131041 agggcggggatgtgccgatgaccgagatgtttggcacgtttgcgctctccgtcggcgcag 29131100

                    
Query: 152      cggt 155
                ||||
Sbjct: 29131101 cggt 29131104



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                            
Query: 542      aggagctggaggacgttggtggcctcgacgagctggagcaggagctcgccagaatcaacc 601
                ||||||||||||| |||||||| || || ||||||||| ||||||| || ||||||||||
Sbjct: 29131944 aggagctggaggaggttggtggtctggaagagctggagaaggagcttgcgagaatcaacc 29132003

                   
Query: 602      gga 604
                |||
Sbjct: 29132004 gga 29132006



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 41       tcacctccatggccatcgcctcc 63
                |||||||||||||||||||||||
Sbjct: 31291591 tcacctccatggccatcgcctcc 31291569



to top

>gb|AY077687.1| Sandersonia aurantiaca beta carotene hydroxylase mRNA, partial cds
          Length = 381

 Score =  272 bits (137), Expect = 1e-69
 Identities = 316/376 (84%)
 Strand = Plus / Plus

                                                                       
Query: 161 tggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcacatgc 220
           ||||||||||||||   |||||||||  |||||||||||||||||| |||||||| ||||
Sbjct: 2   tggagttctgggcgagatgggcgcaccgggcgctgtggcacgcgtcgctgtggcatatgc 61

                                                                       
Query: 221 acgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgccatca 280
           ||||||||||||||||| || | || || || ||||||||||||||||||||||||||||
Sbjct: 62  acgagtcgcaccaccgggcgagggagggnccgttcgagctcaacgacgtcttcgccatca 121

                                                                       
Query: 281 tcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctcgtcc 340
             |||||||| || || ||||| |||||  | || || |||||||| ||||||||| | |
Sbjct: 122 cgaacgccgtccctgcgatcgcgctcctatcgtatggattcttccatcgcggcctccttc 181

                                                                       
Query: 341 ccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggcatacatgttcg 400
           | || ||||||||||| || || || ||||||||||| ||||||||||| ||||||||||
Sbjct: 182 ctggactctgcttcggagctgggctggggattacgctgttcgggatggcgtacatgttcg 241

                                                                       
Query: 401 tccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgacgtgccctact 460
           |||||||||| ||||| ||| |  | ||||| || || ||||||||| ||||||||||||
Sbjct: 242 tccacgacgggctggtgcacaggaggttcccggtggggcccatcgccaacgtgccctact 301

                                                                       
Query: 461 tccggcgagtggctgccgctcacaagatacaccacatggacaagttcgagggcgtaccgt 520
           ||| | |||| || || |||||  |||| ||||||||||||||||| || || || || |
Sbjct: 302 tccagagagtcgcggcggctcatcagatccaccacatggacaagtttgaaggggtgcctt 361

                           
Query: 521 atgggctcttcctggg 536
           ||||||| ||| ||||
Sbjct: 362 atgggctgttcatggg 377



to top

>gb|AY579207.1| Crocus sativus beta carotene hydroxylase (BCH2Cs) mRNA, complete
           cds
          Length = 891

 Score =  226 bits (114), Expect = 7e-56
 Identities = 280/334 (83%), Gaps = 1/334 (0%)
 Strand = Plus / Plus

                                                                       
Query: 253 ttcgagctcaa-cgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctcgc 311
           ||||||||||| ||||||||||||||| |||||||| || || ||||||||||| || ||
Sbjct: 526 ttcgagctcaaacgacgtcttcgccataatcaacgcggtccccgccatcgccctgcttgc 585

                                                                       
Query: 312 ctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttgggat 371
           || ||||||||||||||| || ||| |||| |||||||| |||||||| || || || ||
Sbjct: 586 cttcggcttcttccaccgaggtctcctcccaggcctctgtttcggcgccggactcggaat 645

                                                                       
Query: 372 tacgcttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgcttccc 431
            ||||| || || || || ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 646 cacgctgtttggtatcgcgtacatgttcgtccacgacggccttgtccaccggcggttccc 705

                                                                       
Query: 432 cgtcggccccatcgccgacgtgccctacttccggcgagtggctgccgctcacaagataca 491
            || || |||||||||||| |||||||||||| ||| || ||||| || ||| |||| ||
Sbjct: 706 tgtggggcccatcgccgacttgccctacttccagcgcgtcgctgctgcccaccagatcca 765

                                                                       
Query: 492 ccacatggacaagttcgagggcgtaccgtatgggctcttcctgggacccaaggagctgga 551
           ||||  ||| |||||| | || || ||||||||||| ||| |||| ||||||||  ||||
Sbjct: 766 ccactcggagaagttccaaggggttccgtatgggctgttcatgggccccaaggaattgga 825

                                             
Query: 552 ggacgttggtggcctcgacgagctggagcaggag 585
           ||| ||||||||| | || ||||||||| |||||
Sbjct: 826 ggaggttggtggcttagaagagctggagaaggag 859



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 41  tcacctccatggccatcgcctccgtgtactaccgcttcgcctggcaaatggagggcggcg 100
           |||||| |||||||  |||| |||| |||||||| ||||| |||||||||||||| || |
Sbjct: 309 tcaccttcatggccgccgccgccgtctactaccgtttcgcttggcaaatggagggaggag 368

                               
Query: 101 aggtgccgatgaccgagatg 120
           | ||||| ||||| ||||||
Sbjct: 369 atgtgccaatgacggagatg 388



to top

>gb|AF499108.1| Vitis vinifera beta-carotene hydroxylase (bch1) gene, complete cds
          Length = 900

 Score =  135 bits (68), Expect = 2e-28
 Identities = 239/296 (80%)
 Strand = Plus / Plus

                                                                       
Query: 157 gggatggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcac 216
           ||||||||||| ||||||| |||||| ||||| ||||| ||||| || || |||||||| 
Sbjct: 436 gggatggagttttgggcgcggtgggctcacaaagcgctctggcatgcttcactgtggcat 495

                                                                       
Query: 217 atgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgcc 276
           ||||||||||| ||||| || ||  | || || || |||||||||||||| || || |||
Sbjct: 496 atgcacgagtctcaccatcgacccagagaaggtcctttcgagctcaacgatgtgtttgcc 555

                                                                       
Query: 277 atcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctc 336
           |||||||| ||||| ||||| ||  | || ||| |||| ||| ||||| ||   ||||||
Sbjct: 556 atcatcaatgccgtcccggcaatatctctgctctcctatggcctcttcaacaaaggcctc 615

                                                                       
Query: 337 gtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggcatacatg 396
           ||||| || ||||| ||||| || || || || || ||  | || || ||||| ||||||
Sbjct: 616 gtcccaggtctctgtttcggagctggactaggaataacagtgtttggcatggcctacatg 675

                                                                   
Query: 397 ttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgacgt 452
           || |||||||||||||| |||||||| || ||||| ||||| ||||||||| ||||
Sbjct: 676 tttgtccacgacggccttgtccaccgtcgattccctgtcggacccatcgccaacgt 731



to top

>emb|AJ278882.1|NPS278882 Narcissus pseudonarcissus mRNA for beta-carotene hydroxylase
          Length = 1218

 Score =  117 bits (59), Expect = 5e-23
 Identities = 212/263 (80%)
 Strand = Plus / Plus

                                                                       
Query: 196 tggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttc 255
           ||||| || ||| ||||||||||||| |||||||| |||   || || ||||| || || 
Sbjct: 617 tggcatgcatccttgtggcacatgcatgagtcgcatcacaaaccacgtgacggtccattt 676

                                                                       
Query: 256 gagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctcgcctac 315
           ||||||||||| || |||||| |||| |||||||| ||||| ||| | || ||   ||||
Sbjct: 677 gagctcaacgatgttttcgccgtcattaacgccgttccggcgatctctcttctatactac 736

                                                                       
Query: 316 ggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttgggattacg 375
           ||||||||| ||||||| || || |||||||||||||| || || || ||||| || || 
Sbjct: 737 ggcttcttcaaccgcggactagttcccggcctctgctttggtgccggtcttggaatcaca 796

                                                                       
Query: 376 cttttcgggatggcatacatgttcgtccacgacggcctggtccaccgccgcttccccgtc 435
           || | ||||||||| ||||||||||| ||||||||  |||| ||||| || ||||| || 
Sbjct: 797 ctctacgggatggcgtacatgttcgttcacgacggattggttcaccggcgattcccagtg 856

                                  
Query: 436 ggccccatcgccgacgtgcccta 458
           || ||||| ||||| || |||||
Sbjct: 857 ggacccattgccgatgttcccta 879



to top

>gb|AY860819.1| Chlamydomonas reinhardtii putative chloroplast carotene beta
           hydroxylase precursor (CHYB) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1770

 Score =  101 bits (51), Expect = 3e-18
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 349 tgcttcggcgcgggccttgggattacgcttttcgggatggcatacatgttcgtccacgac 408
           |||||||||||||| || || || ||||| ||||| || || ||||||||| ||||||||
Sbjct: 755 tgcttcggcgcgggtctgggcatcacgctgttcggcatcgcctacatgttcttccacgac 814

                                                  
Query: 409 ggcctggtccaccgccgcttccccgtcggccccatcgcc 447
           |||||||| ||||||||||||||||| || |||||||||
Sbjct: 815 ggcctggtgcaccgccgcttccccgtggggcccatcgcc 853



 Score = 40.1 bits (20), Expect = 9.2
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                       
Query: 237 gccgcgcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggc 296
           |||||||  ||| ||||| |||||||||||| ||| |||| ||  ||||||| |||| ||
Sbjct: 643 gccgcgcaccggcccctttgagctcaacgacatctacgccgtcgccaacgccctgcccgc 702

                                       
Query: 297 catcgccctcctcgcctacggcttcttc 324
            || || ||   ||||||||||||||||
Sbjct: 703 aatggcgctgtgcgcctacggcttcttc 730



 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 67  tactaccgcttcgcctggca 86
           ||||||||||||||||||||
Sbjct: 464 tactaccgcttcgcctggca 483



to top

>gb|AF315289.1|AF315289 Citrus unshiu beta-carotene hydroxylase (CHX2) mRNA, complete cds
          Length = 1239

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 264/338 (78%)
 Strand = Plus / Plus

                                                                       
Query: 211 tggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtc 270
           ||||| ||||||||||| ||||| || ||  | || || || || ||||| ||||| || 
Sbjct: 650 tggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagctaaacgatgtg 709

                                                                       
Query: 271 ttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgc 330
           || ||||| |||||||| || || ||||| ||||| ||| | |  ||||||||||||   
Sbjct: 710 tttgccataatcaacgcagttccagccatagcccttctctcttttggcttcttccacaaa 769

                                                                       
Query: 331 ggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggca 390
           ||||| || || || |||||||| || || || ||||| |||||| | || |||||||| 
Sbjct: 770 ggccttgtacctggtctctgctttggtgctggacttggcattacggtgtttgggatggcc 829

                                                                       
Query: 391 tacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgac 450
           ||||||||||||||||| || || || |||    | ||||| || || ||||| ||||||
Sbjct: 830 tacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtcccattgccgac 889

                                                                       
Query: 451 gtgccctacttccggcgagtggctgccgctcacaagatacaccacatggacaagttcgag 510
           ||||| || |||||| |||| ||||| |||||| || | ||||||  ||| || ||| | 
Sbjct: 890 gtgccttatttccggagagtcgctgcggctcaccagcttcaccactcggataaattccac 949

                                                 
Query: 511 ggcgtaccgtatgggctcttcctgggacccaaggagct 548
           || || || ||||||||||| || ||||| ||||||||
Sbjct: 950 ggtgttccatatgggctctttctcggacctaaggagct 987



to top

>gb|AY533828.1| Citrus sinensis beta-carotene hydroxylase mRNA, partial cds
          Length = 414

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 263/338 (77%)
 Strand = Plus / Plus

                                                                       
Query: 211 tggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtc 270
           ||||| ||||||||||| ||||| || ||  | || || || || ||||| ||||| || 
Sbjct: 40  tggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagctaaacgatgtg 99

                                                                       
Query: 271 ttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgc 330
           || ||||| |||||||| || || ||||| ||||| ||| | |  ||||||||||||   
Sbjct: 100 tttgccataatcaacgcagttccagccatagcccttctctcttttggcttcttccacaaa 159

                                                                       
Query: 331 ggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggca 390
           ||||| || || || ||||| || || || || ||||| |||||| | || |||||||| 
Sbjct: 160 ggccttgtacctggtctctgttttggtgctggacttggcattacggtgtttgggatggcc 219

                                                                       
Query: 391 tacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgac 450
           ||||||||||||||||| || || || |||    | ||||| || || ||||| ||||||
Sbjct: 220 tacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtcccattgccgac 279

                                                                       
Query: 451 gtgccctacttccggcgagtggctgccgctcacaagatacaccacatggacaagttcgag 510
           ||||| || |||||| |||| ||||| |||||| || | ||||||  ||| || ||| | 
Sbjct: 280 gtgccttatttccggagagtcgctgcggctcaccagcttcaccactcggataaattccac 339

                                                 
Query: 511 ggcgtaccgtatgggctcttcctgggacccaaggagct 548
           || || || ||||||||||| || ||||| ||||||||
Sbjct: 340 ggtgttccatatgggctctttctcggacctaaggagct 377



to top

>gb|AF296158.2|AF296158 Citrus unshiu beta-carotene hydroxylase (CHX1) mRNA, complete cds
          Length = 1239

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 263/338 (77%)
 Strand = Plus / Plus

                                                                       
Query: 211 tggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtc 270
           ||||| ||||||||||| ||||| || ||  | || || || || ||||| ||||| || 
Sbjct: 650 tggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagctaaacgatgtg 709

                                                                       
Query: 271 ttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgc 330
           || ||||| |||||||| || || ||||| ||||| ||| | |  ||||||||||||   
Sbjct: 710 tttgccataatcaacgcagttccagccatagcccttctctcttttggcttcttccacaaa 769

                                                                       
Query: 331 ggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggca 390
           ||||| || || || ||||| || || || || ||||| |||||| | || |||||||| 
Sbjct: 770 ggccttgtacctggtctctgttttggtgctggacttggcattacggtgtttgggatggcc 829

                                                                       
Query: 391 tacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgac 450
           ||||||||||||||||| || || || |||    | ||||| || || ||||| ||||||
Sbjct: 830 tacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtcccattgccgac 889

                                                                       
Query: 451 gtgccctacttccggcgagtggctgccgctcacaagatacaccacatggacaagttcgag 510
           ||||| || |||||| |||| ||||| |||||| || | ||||||  ||| || ||| | 
Sbjct: 890 gtgccttatttccggagagtcgctgcggctcaccagcttcaccactcggataaattccac 949

                                                 
Query: 511 ggcgtaccgtatgggctcttcctgggacccaaggagct 548
           || || || ||||||||||| || ||||| ||||||||
Sbjct: 950 ggtgttccatatgggctctttctcggacctaaggagct 987



to top

>dbj|AB114669.1| Citrus limon CitHYb mRNA for beta-ring hydroxylase, partial cds
          Length = 527

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 311/402 (77%)
 Strand = Plus / Plus

                                                                       
Query: 82  tggcaaatggagggcggcgaggtgccgatgaccgagatgctgggcacgttcgcgctctcc 141
           |||||||||||||| || ||||||||  | || || ||| | ||||| || || ||||| 
Sbjct: 73  tggcaaatggagggtggagaggtgcctttaactgaaatgtttggcacatttgctctctct 132

                                                                       
Query: 142 gtcggcgcggcggtcgggatggagttctgggcgcagtgggcgcacaaggcgctgtggcac 201
           || ||||| || || || |||||||| ||||| |  ||||| || || || |||||||| 
Sbjct: 133 gttggcgctgccgtgggcatggagttttgggcacgatgggctcataaagctctgtggcat 192

                                                                       
Query: 202 gcgtccctgtggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctc 261
           || ||  | ||||| ||||||||||| ||||| || ||  | || || || || ||||| 
Sbjct: 193 gcttctttatggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagcta 252

                                                                       
Query: 262 aacgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttc 321
           ||||| || || ||||| |||||||| || || ||||| ||||| ||| | |  ||||||
Sbjct: 253 aacgatgtgtttgccataatcaacgcagttccagccatagcccttctctcttttggcttc 312

                                                                       
Query: 322 ttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttc 381
           ||||||   ||||| || || || ||||| || || || || ||||| |||||| | || 
Sbjct: 313 ttccacaaaggccttgtacctggtctctgttttggtgctggacttggcattacggtgttt 372

                                                                       
Query: 382 gggatggcatacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggcccc 441
           |||||||| ||||||||||||||||| || || || |||    | ||||| || || |||
Sbjct: 373 gggatggcctacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtccc 432

                                                     
Query: 442 atcgccgacgtgccctacttccggcgagtggctgccgctcac 483
           || ||||||||||| || |||||| |||| ||||| ||||||
Sbjct: 433 attgccgacgtgccttatttccggagagtcgctgctgctcac 474



to top

>dbj|AB114653.1| Citrus unshiu CitHYb mRNA for beta-ring hydroxylase, partial cds
          Length = 527

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 214/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 211 tggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtc 270
           ||||| ||||||||||| ||||| || ||  | || || || || ||||| ||||| || 
Sbjct: 202 tggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagctaaacgatgtg 261

                                                                       
Query: 271 ttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgc 330
           || ||||| |||||||| || || ||||| ||||| ||| | |  ||||||||||||   
Sbjct: 262 tttgccataatcaacgcagttccagccatagcccttctctcttttggcttcttccacaaa 321

                                                                       
Query: 331 ggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggca 390
           ||||| || || || |||||||| || || || ||||| |||||| | || |||||||| 
Sbjct: 322 ggccttgtacctggtctctgctttggtgctggacttggcattacggtgtttgggatggcc 381

                                                                       
Query: 391 tacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgac 450
           ||||||||||||||||| || || || |||    | ||||| || || ||||| ||||||
Sbjct: 382 tacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtcccattgccgac 441

                                            
Query: 451 gtgccctacttccggcgagtggctgccgctcac 483
           ||||| || |||||| |||| ||||| ||||||
Sbjct: 442 gtgccttatttccggagagtcgctgcggctcac 474



to top

>gb|AY559054.1| Cymodocea nodosa clone Cy16 microsatellite sequence
          Length = 313

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcacatg 219
           |||||||| ||| ||  ||||| ||||| ||| ||||||||||  || ||||||||||||
Sbjct: 172 atggagttttggtcgaggtgggtgcacagggctctgtggcacggctctctgtggcacatg 231

                                                                  
Query: 220 cacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcg 274
           ||| |||||||||||  |||  | || || || ||||||||||||||||| ||||
Sbjct: 232 cacaagtcgcaccacaagcccagagaaggaccgttcgagctcaacgacgtgttcg 286



to top

>emb|Y09722.1|CABCH2 C.annuum mRNA for beta-carotene hydroxylase 2, partial
          Length = 1044

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 190/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcacatg 219
           |||||||| |||||   |||||| || || ||||| |||||||| ||  | |||||||||
Sbjct: 490 atggagttttgggctaggtgggcacataaagcgctatggcacgcctctttatggcacatg 549

                                                                       
Query: 220 cacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtcttcgccatc 279
           |||||||| ||||||   ||  | || || || |||||||| ||||| || || ||||| 
Sbjct: 550 cacgagtcacaccacaaaccaagagaaggacctttcgagctgaacgatgtttttgccata 609

                                                                       
Query: 280 atcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgcggcctcgtc 339
           ||||| || || || || || |||||||| | ||| || ||||||||    |||||| | 
Sbjct: 610 atcaatgctgttccagctatagccctccttgactatggtttcttccataaaggcctcatt 669

                                                                       
Query: 340 cccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggcatacatgttc 399
           |||||||||||||||||||| ||  | ||||| ||  | || ||||||||||||||||||
Sbjct: 670 cccggcctctgcttcggcgctgggttagggatcacagtatttgggatggcatacatgttc 729

             
Query: 400 gt 401
           ||
Sbjct: 730 gt 731



to top

>dbj|AB114661.1| Citrus sinensis CitHYb mRNA for beta-ring hydroxylase, partial cds
          Length = 527

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 213/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 211 tggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtc 270
           ||||| ||||||||||| ||||| || ||  | || || || || ||||| ||||| || 
Sbjct: 202 tggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagctaaacgatgtg 261

                                                                       
Query: 271 ttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgc 330
           || ||||| |||||||| || || ||||| ||||| ||| | |  ||||||||||||   
Sbjct: 262 tttgccataatcaacgcagttccagccatagcccttctctcttttggcttcttccacaaa 321

                                                                       
Query: 331 ggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggca 390
           ||||| || || || ||||| || || || || ||||| |||||| | || |||||||| 
Sbjct: 322 ggccttgtacctggtctctgttttggtgctggacttggcattacggtgtttgggatggcc 381

                                                                       
Query: 391 tacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgac 450
           ||||||||||||||||| || || || |||    | ||||| || || ||||| ||||||
Sbjct: 382 tacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtcccattgccgac 441

                                            
Query: 451 gtgccctacttccggcgagtggctgccgctcac 483
           ||||| || |||||| |||| ||||| ||||||
Sbjct: 442 gtgccttatttccggagagtcgctgcggctcac 474



to top

>gb|AY575953.1| Glycine max beta-carotene hydroxylase mRNA, complete cds
          Length = 1164

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 167/212 (78%)
 Strand = Plus / Plus

                                                                       
Query: 196 tggcacgcgtccctgtggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttc 255
           ||||| || ||| ||||||||||||||||||| ||||| || ||  | || || || |||
Sbjct: 603 tggcatgcttccttgtggcacatgcacgagtcacaccatcgaccaagagagggaccgttc 662

                                                                       
Query: 256 gagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctcgcctac 315
           |||||||||||||| ||||| || || ||||| || || || ||||| || ||| | |||
Sbjct: 663 gagctcaacgacgttttcgcgataattaacgctgtccctgcgatcgctcttctctcatac 722

                                                                       
Query: 316 ggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttgggattacg 375
           ||  | ||||||   || || ||||| || ||||| || || || |||||||| || |||
Sbjct: 723 ggtattttccacaagggtctggtccctgggctctgttttggtgcaggccttggaatcacg 782

                                           
Query: 376 cttttcgggatggcatacatgttcgtccacga 407
            | || |||||||| |||||||| ||||||||
Sbjct: 783 gtatttgggatggcctacatgtttgtccacga 814



to top

>gb|DQ192194.1| Daucus carota subsp. sativus putative beta-ring carotene
           hydroxylase (CHXB2) mRNA, complete cds
          Length = 1137

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 180/230 (78%)
 Strand = Plus / Plus

                                                                       
Query: 178 tgggcgcacaaggcgctgtggcacgcgtccctgtggcacatgcacgagtcgcaccaccgg 237
           ||||||||||| ||||| |||||||  ||  ||||||||||||||||||| |||||    
Sbjct: 616 tgggcgcacaaagcgctatggcacgattcgttgtggcacatgcacgagtcacaccataaa 675

                                                                       
Query: 238 ccgcgcgacgggcccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggcc 297
           ||  | || ||  | |||||||| ||||| || ||||| || || ||||| || || |||
Sbjct: 676 ccaagagaaggagcattcgagctgaacgatgttttcgctataataaacgcggttccagcc 735

                                                                       
Query: 298 atcgccctcctcgcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggc 357
           || || || |||||||| || |||||||||   |||||| | || || || || ||||| 
Sbjct: 736 atagcgcttctcgcctatggtttcttccacaaaggcctctttcctggtctttgtttcggt 795

                                                             
Query: 358 gcgggccttgggattacgcttttcgggatggcatacatgttcgtccacga 407
           || || ||||| || ||| | ||||||||||| |||||||| ||||||||
Sbjct: 796 gctggacttggaatcacggtgttcgggatggcctacatgtttgtccacga 845



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 62  ccgtgtactaccgcttcgcctggcaaatggagggcggcgaggt 104
           |||| |||| ||| ||||| ||||||||||||||||| |||||
Sbjct: 500 ccgtatactcccggttcgcttggcaaatggagggcggagaggt 542



to top

>dbj|AB027187.1| Gentiana lutea GenCHYB mRNA for beta-carotene hydroxylase, complete
           cds
          Length = 1519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 125/158 (79%)
 Strand = Plus / Plus

                                                                       
Query: 250 cccttcgagctcaacgacgtcttcgccatcatcaacgccgtgccggccatcgccctcctc 309
           ||||||||||| || ||| | || ||||| ||||| || || || || || || ||||||
Sbjct: 714 cccttcgagctaaatgacatatttgccattatcaatgcagtcccagcaatagcactcctc 773

                                                                       
Query: 310 gcctacggcttcttccaccgcggcctcgtccccggcctctgcttcggcgcgggccttggg 369
            |||| || |||||||||   |||||  |||| ||||| || || || || |||||||| 
Sbjct: 774 tcctatggtttcttccacaaaggccttatccctggcctttgttttggtgcaggccttgga 833

                                                 
Query: 370 attacgcttttcgggatggcatacatgttcgtccacga 407
           |||||| | || || ||||| |||||||||||||||||
Sbjct: 834 attacggtgtttggaatggcgtacatgttcgtccacga 871



to top

>gb|DQ002893.1| Citrus maxima beta carotene hydoxylase mRNA, complete cds
          Length = 936

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 260/338 (76%)
 Strand = Plus / Plus

                                                                       
Query: 211 tggcacatgcacgagtcgcaccaccggccgcgcgacgggcccttcgagctcaacgacgtc 270
           ||||| ||||||||||| ||||| || ||  | || || || || ||||| ||||| || 
Sbjct: 520 tggcatatgcacgagtctcaccatcgaccaagagagggtccttttgagctaaacgatgtg 579

                                                                       
Query: 271 ttcgccatcatcaacgccgtgccggccatcgccctcctcgcctacggcttcttccaccgc 330
           || ||||| |||||||| || || ||||| ||||| ||| |    ||||||||||||   
Sbjct: 580 tttgccataatcaacgcagttccagccatagcccttctctctgttggcttcttccacaaa 639

                                                                       
Query: 331 ggcctcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggca 390
           ||||| || || || ||||| || || || || ||||| |||||| | || |||||||| 
Sbjct: 640 ggccttgtacctggtctctgttttggtgctggacttggcattacggtgtttgggatggcc 699

                                                                       
Query: 391 tacatgttcgtccacgacggcctggtccaccgccgcttccccgtcggccccatcgccgac 450
           ||||||||||||||||| || || || |||    | ||||| || || ||||| |||| |
Sbjct: 700 tacatgttcgtccacgatggtctcgttcacaaaaggttccctgtgggtcccattgccggc 759

                                                                       
Query: 451 gtgccctacttccggcgagtggctgccgctcacaagatacaccacatggacaagttcgag 510
           ||||| || |||||| |||| ||||| |||||| || | ||||||  ||| || ||| | 
Sbjct: 760 gtgccttatttccggagagtcgctgctgctcaccagcttcaccactcggataaattccac 819

                                                 
Query: 511 ggcgtaccgtatgggctcttcctgggacccaaggagct 548
           || || || |||||||| || || ||||| ||||||||
Sbjct: 820 ggtgttccatatgggctgtttctaggacctaaggagct 857



to top

>ref|XM_473890.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 939

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 41  tcacctccatggccatcgcctcc 63
           |||||||||||||||||||||||
Sbjct: 110 tcacctccatggccatcgcctcc 132



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 342     cggcctctgcttcggcgcgggcc 364
               |||||||||||||||||||||||
Sbjct: 3650775 cggcctctgcttcggcgcgggcc 3650797



to top

>emb|AL662950.2|OSJN00152 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0008M17,
              complete sequence
          Length = 133279

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 41     tcacctccatggccatcgcctcc 63
              |||||||||||||||||||||||
Sbjct: 113193 tcacctccatggccatcgcctcc 113171



to top

>emb|Y14809.1|LEY14809 Lycopersicon esculentum mRNA for beta-carotene hydroxylase (CrtR-b1
           gene)
          Length = 1125

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggagttctgggcgcagtgggcgcacaaggcgctgtggcacgcgtccctgtggcacatg 219
           |||||||| ||||||   ||||| ||||| || |||||||| || || || |||||||||
Sbjct: 488 atggagttttgggcgagatgggcacacaaagcactgtggcatgcttcactatggcacatg 547

                          
Query: 220 cacgagtcgcaccac 234
           || ||||| ||||||
Sbjct: 548 catgagtcacaccac 562



to top

>dbj|AK106295.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-101-B10, full
           insert sequence
          Length = 1601

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 41  tcacctccatggccatcgcctcc 63
           |||||||||||||||||||||||
Sbjct: 262 tcacctccatggccatcgcctcc 284



to top

>emb|Y14810.2|LEY14810 Lycopersicon esculentum partial mRNA for beta-carotene hydroxylase
           (CrtR-b2 gene)
          Length = 1163

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 211 tggcacatgcacgagtcgcacca 233
           |||||||||||||||||||||||
Sbjct: 532 tggcacatgcacgagtcgcacca 554



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 335 tcgtccccggcctctgcttcggcgcgggccttgggattacgcttttcgggatggcataca 394
           ||||||| |||||||| |||||||| ||  | ||||| ||  | || |||||||| ||||
Sbjct: 656 tcgtccctggcctctgtttcggcgctggattggggatcacagtatttgggatggcttaca 715

                                 
Query: 395 tgttcgtccacgacggcctggt 416
           ||||||| ||||| || |||||
Sbjct: 716 tgttcgttcacgatggactggt 737



to top

>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29
          Length = 303450

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 252    cttcgagctcaacgacgtcttcgccat 278
              ||||| |||||||||||||||||||||
Sbjct: 131203 cttcgtgctcaacgacgtcttcgccat 131177



to top

>gb|DQ192195.1| Daucus carota subsp. sativus beta-ring carotene hydroxylase (CHXB3)
           gene, partial sequence
          Length = 581

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 379 ttcgggatggcatacatgttcgtccacgacg 409
           |||||||||||||||||||| || |||||||
Sbjct: 551 ttcgggatggcatacatgtttgtacacgacg 581



to top

>dbj|AB205042.1| Chrysanthemum x morifolium CHYB mRNA for beta-carotene hydroxylase,
           complete cds
          Length = 1227

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 256 gagctcaacgacgtcttcgccatcatcaacgccgtgcc 293
           |||||||||||||| || || ||||| |||||||||||
Sbjct: 650 gagctcaacgacgtgtttgcaatcataaacgccgtgcc 687



to top

>dbj|AB258438.1| Diospyros kaki DK-Hyb mRNA for beta-ring hydroxylase, partial cds
          Length = 284

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 382 gggatggcatacatgttcgtccacga 407
           |||||||| |||||||||||||||||
Sbjct: 110 gggatggcctacatgttcgtccacga 135



to top

>gb|AC123713.13| Mus musculus chromosome 7, clone RP23-391D20, complete sequence
          Length = 183590

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 534    gggacccaaggagctggaggacgtt 558
              |||||||||||||||||||| ||||
Sbjct: 149562 gggacccaaggagctggaggtcgtt 149538



to top

>ref|XM_512028.1| PREDICTED: Pan troglodytes similar to KIAA0802 (LOC455296), mRNA
          Length = 6133

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 568  gacgagctggagcaggagctc 588
            |||||||||||||||||||||
Sbjct: 1537 gacgagctggagcaggagctc 1557



to top

>gb|AC137110.11| Mus musculus chromosome 7, clone RP23-399P8, complete sequence
          Length = 199827

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 534    gggacccaaggagctggaggacgtt 558
              |||||||||||||||||||| ||||
Sbjct: 169529 gggacccaaggagctggaggtcgtt 169553



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 99      cgaggtgccgatgaccgagatgctg 123
               ||||||||||||| |||||||||||
Sbjct: 5616610 cgaggtgccgatggccgagatgctg 5616586



to top

>ref|NM_015210.1| Homo sapiens KIAA0802 (KIAA0802), mRNA
          Length = 5392

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 568 gacgagctggagcaggagctc 588
           |||||||||||||||||||||
Sbjct: 653 gacgagctggagcaggagctc 673



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 88      atggagggcggcgaggtgccg 108
               |||||||||||||||||||||
Sbjct: 2756745 atggagggcggcgaggtgccg 2756765



to top

>dbj|AK131528.1| Homo sapiens cDNA FLJ16757 fis, clone BRACE3026993
          Length = 5392

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 568 gacgagctggagcaggagctc 588
           |||||||||||||||||||||
Sbjct: 653 gacgagctggagcaggagctc 673



to top

>dbj|AK090691.1| Homo sapiens cDNA FLJ33372 fis, clone BRACE2005981
          Length = 3517

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 568 gacgagctggagcaggagctc 588
           |||||||||||||||||||||
Sbjct: 725 gacgagctggagcaggagctc 745



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 274     gccatcatcaacgccgtgccg 294
               |||||||||||||||||||||
Sbjct: 4762751 gccatcatcaacgccgtgccg 4762731



to top

>ref|NM_136618.3| Drosophila melanogaster CG8055-RA (CG8055), mRNA
          Length = 1265

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 565 ctcgacgagctggagcaggag 585
           |||||||||||||||||||||
Sbjct: 603 ctcgacgagctggagcaggag 623



to top

>gb|AC008186.5|AC008186 Drosophila melanogaster, chromosome 2R, region 45A-46A, BAC clone
             BACR10M14, complete sequence
          Length = 189757

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 565   ctcgacgagctggagcaggag 585
             |||||||||||||||||||||
Sbjct: 70572 ctcgacgagctggagcaggag 70552



to top

>dbj|AB018345.2| Homo sapiens mRNA for KIAA0802 protein, partial cds
          Length = 6009

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 568 gacgagctggagcaggagctc 588
           |||||||||||||||||||||
Sbjct: 693 gacgagctggagcaggagctc 713



to top

>gb|AY069131.1| Drosophila melanogaster GH13992 full insert cDNA
          Length = 1269

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 565 ctcgacgagctggagcaggag 585
           |||||||||||||||||||||
Sbjct: 590 ctcgacgagctggagcaggag 610



to top

>gb|AE003834.3| Drosophila melanogaster chromosome 2R, section 16 of 73 of the complete
             sequence
          Length = 243313

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 565   ctcgacgagctggagcaggag 585
             |||||||||||||||||||||
Sbjct: 77414 ctcgacgagctggagcaggag 77394



to top

>dbj|AP000864.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-674N23, complete
              sequence
          Length = 171200

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 568    gacgagctggagcaggagctc 588
              |||||||||||||||||||||
Sbjct: 151011 gacgagctggagcaggagctc 151031



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    cggcgcggcggtcgggatgg 163
              ||||||||||||||||||||
Sbjct: 101112 cggcgcggcggtcgggatgg 101093



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 273     cgccatcatcaacgccgtgc 292
               ||||||||||||||||||||
Sbjct: 1922832 cgccatcatcaacgccgtgc 1922813



to top

>gb|AY598782.1| Simian adenovirus 3 strain ATCC VR-1449, complete genome
          Length = 34246

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    tggccgccgtcatgtccagc 33
             ||||||||||||||||||||
Sbjct: 12712 tggccgccgtcatgtccagc 12693



to top

>ref|XM_367779.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
            (MG07690.4) partial mRNA
          Length = 2583

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 570  cgagctggagcaggagctcg 589
            ||||||||||||||||||||
Sbjct: 2305 cgagctggagcaggagctcg 2286



to top

>gb|AE009182.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 208
            of 256 of the complete sequence
          Length = 10270

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 285  cgccgtgccggccatcgccc 304
            ||||||||||||||||||||
Sbjct: 1101 cgccgtgccggccatcgccc 1120



to top

>ref|NM_010709.1| Mus musculus ligatin (Lgtn), mRNA
          Length = 2094

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 605 agcatctgagctgtggacatggcg 582



to top

>ref|XM_653669.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1157.2), mRNA
          Length = 1446

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 577 gagcaggagctcgccagaat 596
           ||||||||||||||||||||
Sbjct: 355 gagcaggagctcgccagaat 374



to top

>gb|AC109262.13| Mus musculus chromosome 1, clone RP23-31H15, complete sequence
          Length = 241579

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 610    agcatctgagctctggacatggcg 633
              |||||||||||| |||||||||||
Sbjct: 117681 agcatctgagctgtggacatggcg 117658



to top

>ref|XM_988475.1| PREDICTED: Mus musculus gene model 24, (NCBI) (Gm24), mRNA
          Length = 1958

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  catctgagctctggacatgg 631
            ||||||||||||||||||||
Sbjct: 1044 catctgagctctggacatgg 1025



to top

>ref|XM_906408.2| PREDICTED: Mus musculus gene model 24, (NCBI) (Gm24), mRNA
          Length = 1956

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  catctgagctctggacatgg 631
            ||||||||||||||||||||
Sbjct: 1044 catctgagctctggacatgg 1025



to top

>ref|XM_111442.5| PREDICTED: Mus musculus gene model 24, (NCBI) (Gm24), mRNA
          Length = 1956

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  catctgagctctggacatgg 631
            ||||||||||||||||||||
Sbjct: 1044 catctgagctctggacatgg 1025



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 566     tcgacgagctggagcaggagctcg 589
               ||||||||| ||||||||||||||
Sbjct: 1889392 tcgacgagcgggagcaggagctcg 1889369



to top

>gb|BC023709.1| Mus musculus ligatin, mRNA (cDNA clone IMAGE:5346162), containing
           frame-shift errors
          Length = 2495

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 639 agcatctgagctgtggacatggcg 616



to top

>gb|BC025036.1| Mus musculus ligatin, mRNA (cDNA clone MGC:36900 IMAGE:4935223),
           complete cds
          Length = 1958

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 589 agcatctgagctgtggacatggcg 566



to top

>emb|BX901957.4| Zebrafish DNA sequence from clone CH211-150G5 in linkage group 15,
             complete sequence
          Length = 175019

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 12    ggtggccgccgtcatgtccagcct 35
             ||||| ||||||||||||||||||
Sbjct: 97476 ggtggtcgccgtcatgtccagcct 97499



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 101     aggtgccgatgaccgagatg 120
               ||||||||||||||||||||
Sbjct: 3628863 aggtgccgatgaccgagatg 3628882



 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 570    cgagctggagcaggagctcgccag 593
              |||||||| |||||||||||||||
Sbjct: 113677 cgagctggtgcaggagctcgccag 113654



to top

>emb|AL121776.19|HSJ1050K3 Human DNA sequence from clone RP5-1050K3 on chromosome 20 Contains part
             of the EYA2 gene for eyes absent homolog 2 (Drosophila), a
             glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
             pseudogene and an RPL27A (ribosomal protein L27A)
             pseudogene, complete sequence
          Length = 143981

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tcacctccatggccatcgcc 60
             ||||||||||||||||||||
Sbjct: 43992 tcacctccatggccatcgcc 43973



to top

>emb|BX640452.1| Bordetella bronchiseptica strain RB50, complete genome; segment 16/16
          Length = 123385

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 279   catcaacgccgtgccggccatcgc 302
             |||||||||| |||||||||||||
Sbjct: 82069 catcaacgccctgccggccatcgc 82046



to top

>emb|BX640436.1| Bordetella parapertussis strain 12822, complete genome; segment 14/14
          Length = 255260

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 279    catcaacgccgtgccggccatcgc 302
              |||||||||| |||||||||||||
Sbjct: 217897 catcaacgccctgccggccatcgc 217874



to top

>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29
          Length = 296500

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    tggtggccgccgtcatgtcc 30
             ||||||||||||||||||||
Sbjct: 46927 tggtggccgccgtcatgtcc 46946



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
              genes for H2b histone family member A, two H2a, two H4 and
              an H2b histone family member, a serine/threonine protein
              kinase pseudogene, a novel pseudogene, a novel gene
              (4930500C15Rik), the gene for a novel KRAB box and C2H2
              Zinc Finger containing protein, a ribosomal protein L21
              (RPL21) pseudogene, a TU mitochondrial translation
              elongation factor (tufa) pseudogene, the 5' end of the gene
              for a novel protein similar to nuclear envelope pore
              membrane protein POM121 and four CpG islands, complete
              sequence
          Length = 182817

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 612    catctgagctctggacatgg 631
              ||||||||||||||||||||
Sbjct: 182391 catctgagctctggacatgg 182372



to top

>emb|AL606968.9| Mouse DNA sequence from clone RP23-287K23 on chromosome 13 Contains
            part of the gene for a novel protein similar to a nuclear
            envelope pore membrane protein POM121, complete sequence
          Length = 3994

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  catctgagctctggacatgg 631
            ||||||||||||||||||||
Sbjct: 1574 catctgagctctggacatgg 1555



to top

>gb|AC160633.3| Mus musculus chromosome 8, clone RP23-407P24, complete sequence
          Length = 203628

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 535    ggacccaaggagctggagga 554
              ||||||||||||||||||||
Sbjct: 189600 ggacccaaggagctggagga 189581



to top

>gb|AE005941.1| Caulobacter crescentus CB15 section 267 of 359 of the complete genome
          Length = 11811

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 281  tcaacgccgtgccggccatcgccc 304
            |||||||||||| |||||||||||
Sbjct: 4936 tcaacgccgtgctggccatcgccc 4913



to top

>dbj|AK133022.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4930555F05 product:hypothetical protein,
            full insert sequence
          Length = 1945

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  catctgagctctggacatgg 631
            ||||||||||||||||||||
Sbjct: 1033 catctgagctctggacatgg 1014



to top

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 285     cgccgtgccggccatcgccc 304
               ||||||||||||||||||||
Sbjct: 2304454 cgccgtgccggccatcgccc 2304473



to top

>dbj|AK139052.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730006G16 product:ligatin, full
           insert sequence
          Length = 1976

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 633 agcatctgagctgtggacatggcg 610



to top

>dbj|AK161269.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4922504I18 product:ligatin, full insert
           sequence
          Length = 1963

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 616 agcatctgagctgtggacatggcg 593



to top

>ref|NM_175486.1| Mus musculus RIKEN cDNA 6430571L13 gene (6430571L13Rik), mRNA
          Length = 2558

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 568 gacgagctggagcaggagct 587
           ||||||||||||||||||||
Sbjct: 728 gacgagctggagcaggagct 747



to top

>dbj|AK171115.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630225E24
           product:ligatin, full insert sequence
          Length = 1952

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 611 agcatctgagctgtggacatggcg 588



to top

>dbj|AK168120.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730058L12 product:ligatin, full insert sequence
          Length = 1946

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 599 agcatctgagctgtggacatggcg 576



to top

>dbj|AK166085.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730037B09 product:ligatin, full insert
           sequence
          Length = 1989

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 645 agcatctgagctgtggacatggcg 622



to top

>dbj|AK167980.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730044O07 product:ligatin, full insert sequence
          Length = 1971

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 629 agcatctgagctgtggacatggcg 606



to top

>gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, complete sequence
          Length = 174380

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 535   ggacccaaggagctggagga 554
             ||||||||||||||||||||
Sbjct: 84421 ggacccaaggagctggagga 84402



to top

>dbj|AK170448.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630103O13
           product:ligatin, full insert sequence
          Length = 1988

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 645 agcatctgagctgtggacatggcg 622



to top

>dbj|AK170252.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630038B08
           product:ligatin, full insert sequence
          Length = 2026

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 660 agcatctgagctgtggacatggcg 637



to top

>dbj|AK043338.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730086M16 product:similar to
           G20 PROTEIN [Homo sapiens], full insert sequence
          Length = 1263

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 568 gacgagctggagcaggagct 587
           ||||||||||||||||||||
Sbjct: 767 gacgagctggagcaggagct 786



to top

>dbj|AK085251.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched
           library, clone:D630001B03 product:similar to G20 PROTEIN
           [Homo sapiens], full insert sequence
          Length = 1226

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 568 gacgagctggagcaggagct 587
           ||||||||||||||||||||
Sbjct: 758 gacgagctggagcaggagct 777



to top

>dbj|AK047005.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930010L13 product:ligatin, full
           insert sequence
          Length = 3281

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 628 agcatctgagctgtggacatggcg 605



to top

>dbj|AK036154.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:9630042D03 product:ligatin, full
           insert sequence
          Length = 3435

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 629 agcatctgagctgtggacatggcg 606



to top

>dbj|AK032501.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
           enriched library, clone:6430571L13 product:similar to
           G20 PROTEIN [Homo sapiens], full insert sequence
          Length = 1510

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 568 gacgagctggagcaggagct 587
           ||||||||||||||||||||
Sbjct: 734 gacgagctggagcaggagct 753



to top

>dbj|AK032358.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
           enriched library, clone:6430526F17 product:similar to
           G20 PROTEIN [Homo sapiens], full insert sequence
          Length = 2558

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 568 gacgagctggagcaggagct 587
           ||||||||||||||||||||
Sbjct: 728 gacgagctggagcaggagct 747



to top

>dbj|AK046539.1| Mus musculus adult male adrenal gland cDNA, RIKEN full-length
           enriched library, clone:B330020B16 product:ligatin, full
           insert sequence
          Length = 1986

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 645 agcatctgagctgtggacatggcg 622



to top

>dbj|AK083638.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030057O03 product:ligatin, full
           insert sequence
          Length = 1988

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 593 agcatctgagctgtggacatggcg 570



to top

>dbj|AK034115.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330157N06 product:ligatin, full
           insert sequence
          Length = 2094

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 605 agcatctgagctgtggacatggcg 582



to top

>dbj|AK082748.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:C330002F15 product:ligatin, full insert sequence
          Length = 2015

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 648 agcatctgagctgtggacatggcg 625



to top

>dbj|AK078472.1| Mus musculus 12 days embryo female mullerian duct includes
           surrounding region cDNA, RIKEN full-length enriched
           library, clone:6820404L22 product:ligatin, full insert
           sequence
          Length = 1210

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 547 agcatctgagctgtggacatggcg 524



to top

>gb|AF327876.1|AF327876 Chlamydomonas reinhardtii PF6 protein gene, promoter and complete cds
          Length = 11462

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   ccaccgcggcctcgtccccg 343
             ||||||||||||||||||||
Sbjct: 10465 ccaccgcggcctcgtccccg 10446



to top

>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome
          Length = 3309401

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 269     tcttcgccatcatcaacgcc 288
               ||||||||||||||||||||
Sbjct: 1987809 tcttcgccatcatcaacgcc 1987828



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 246     cgggcccttcgagctcaacgacgtcttc 273
               |||||||| ||||||||||||| |||||
Sbjct: 1719809 cgggccctacgagctcaacgacttcttc 1719782



to top

>gb|AY631367.1| Sterna albostriata NADH dehydrogenase subunit 2 (ND2) gene, partial
           cds; mitochondrial
          Length = 1036

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 41  tcacctccatggccatcgcctccg 64
           |||||||||| |||||||||||||
Sbjct: 456 tcacctccatagccatcgcctccg 479



to top

>gb|AY631361.1| Chlidonias niger NADH dehydrogenase subunit 2 (ND2) gene, partial
           cds; mitochondrial
          Length = 1031

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 41  tcacctccatggccatcgcctccg 64
           |||||||||| |||||||||||||
Sbjct: 461 tcacctccatagccatcgcctccg 484



to top

>gb|AY631360.1| Chlidonias leucopterus NADH dehydrogenase subunit 2 (ND2) gene,
           complete cds; mitochondrial
          Length = 1041

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 41  tcacctccatggccatcgcctccg 64
           |||||||||| |||||||||||||
Sbjct: 461 tcacctccatagccatcgcctccg 484



to top

>gb|AY631357.1| Anous stolidus NADH dehydrogenase subunit 2 (ND2) gene, complete
           cds; mitochondrial
          Length = 1041

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  acctccatggccatcgcctc 62
           ||||||||||||||||||||
Sbjct: 463 acctccatggccatcgcctc 482



to top

>emb|AL808022.4| Mouse DNA sequence from clone RP23-263N6 on chromosome X, complete
             sequence
          Length = 132367

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 535   ggacccaaggagctggagga 554
             ||||||||||||||||||||
Sbjct: 53826 ggacccaaggagctggagga 53845



to top

>gb|AC116892.10| Mus musculus chromosome 8, clone RP24-529J16, complete sequence
          Length = 176340

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 535  ggacccaaggagctggagga 554
            ||||||||||||||||||||
Sbjct: 8713 ggacccaaggagctggagga 8694



to top

>gb|AC005509.1|AC005509 Homo sapiens chromosome 4 clone B200N5 map 4q25, complete sequence
          Length = 143391

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 573   gctggagcaggagctcgcca 592
             ||||||||||||||||||||
Sbjct: 30713 gctggagcaggagctcgcca 30694



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 91      gagggcggcgaggtgccgat 110
               ||||||||||||||||||||
Sbjct: 2555168 gagggcggcgaggtgccgat 2555187



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 105     gccgatgaccgagatgctgg 124
               ||||||||||||||||||||
Sbjct: 1582913 gccgatgaccgagatgctgg 1582894



to top

>gb|U58337.1|MMU58337 Mus musculus ligatin (Lgtn) mRNA, partial cds
          Length = 1698

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 610 agcatctgagctctggacatggcg 633
           |||||||||||| |||||||||||
Sbjct: 518 agcatctgagctgtggacatggcg 495



to top

>emb|AL672070.12| Mouse DNA sequence from clone RP23-115A1 on chromosome 9, complete
              sequence
          Length = 197912

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 568    gacgagctggagcaggagct 587
              ||||||||||||||||||||
Sbjct: 157792 gacgagctggagcaggagct 157811



to top

>emb|AL606756.17| Mouse DNA sequence from clone RP23-265O19 on chromosome 3, complete
              sequence
          Length = 193976

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 535    ggacccaaggagctggagga 554
              ||||||||||||||||||||
Sbjct: 105104 ggacccaaggagctggagga 105123


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,508,116
Number of Sequences: 3902068
Number of extensions: 4508116
Number of successful extensions: 186369
Number of sequences better than 10.0: 122
Number of HSP's better than 10.0 without gapping: 123
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 184505
Number of HSP's gapped (non-prelim): 1840
length of query: 676
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 653
effective length of database: 17,143,297,704
effective search space: 11194573400712
effective search space used: 11194573400712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top