ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal31p04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|M55449.1|BLYRCABG Hordeum vulgare subsp. vulgare ribulose 1,5-bisphosphate carboxylase activase (RcaB) gene, complete cds; and ribulose 1,5-bisphosphate carboxylase activase (RcaA) gene, alternatively spliced, complete cds Length = 8766 Score = 214 bits (108), Expect = 5e-53 Identities = 137/146 (93%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 6661 tacaacaagagggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 6720 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 ||||||||||||||||||||||||||| | |||||||||||||||| ||||||||| Sbjct: 6721 ctctacgctcctctgatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 6779 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 |||||||||||||||||||||||||| Sbjct: 6780 tgacgaccgtatcggtgtctgcaagg 6805 Score = 129 bits (65), Expect = 2e-27 Identities = 96/107 (89%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||||||||||||||| ||||||||| |||||||||| ||||| ||||||||| Sbjct: 3534 tacaacaaggaggagaacccccgcgtgcccatcatcgtcaccggcaacgacttctcgacg 3593 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || |||||||| ||||||||||| || | |||||||||||||||| Sbjct: 3594 ctgtacgctcccctgatccgtgacgggcgcatggagaagttctactg 3640
>gb|M55447.1|BLYRCAA2 Hordeum vulgare rubisco activase (RcaA2) mRNA, complete cds Length = 1709 Score = 214 bits (108), Expect = 5e-53 Identities = 137/146 (93%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 919 tacaacaagagggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 978 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 ||||||||||||||||||||||||||| | |||||||||||||||| ||||||||| Sbjct: 979 ctctacgctcctctgatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 1037 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 |||||||||||||||||||||||||| Sbjct: 1038 tgacgaccgtatcggtgtctgcaagg 1063
>gb|M55446.1|BLYRCAA1 Hordeum vulgare rubisco activase (RcaA1) mRNA, 3' end Length = 1394 Score = 214 bits (108), Expect = 5e-53 Identities = 137/146 (93%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 664 tacaacaagagggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 723 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 ||||||||||||||||||||||||||| | |||||||||||||||| ||||||||| Sbjct: 724 ctctacgctcctctgatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 782 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 |||||||||||||||||||||||||| Sbjct: 783 tgacgaccgtatcggtgtctgcaagg 808
>gb|BC029790.1| Homo sapiens, clone IMAGE:5192697, mRNA Length = 1643 Score = 182 bits (92), Expect = 2e-43 Identities = 133/146 (91%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| Sbjct: 839 tacaacaaggaggagaacccacgtgtgcccatcgtcgtcactggtaacgatttctcgacg 898 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 | ||||| |||||||||||||||||| | |||||||||||||||| ||||||||| Sbjct: 899 ttgtacgcccctctgatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 957 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||||||||||||||||||| Sbjct: 958 cgacgaccgtatcggtgtctgcaagg 983
>gb|AY206372.1| Triticum aestivum ribulose-1,5-bisphosphate carboxylase activase precursor RNA, partial cds; nuclear gene for chloroplast product Length = 850 Score = 159 bits (80), Expect = 3e-36 Identities = 121/134 (90%), Gaps = 1/134 (0%) Strand = Plus / Plus Query: 13 gagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacgctctacgctcct 72 |||||||| |||||||||||||||||||| |||||||||||||||||| | ||||| ||| Sbjct: 1 gagaacccacgtgtgcccatcgtcgtcactggtaacgatttctcgacgttgtacgcccct 60 Query: 73 ctgatccgtgatggtnggntggagaagttctactgtttttcccacccgtgacgaccgtat 132 ||||||||||||||| | |||||||||||||||| ||||||||| ||||||||||| Sbjct: 61 ctgatccgtgatggtcgtatggagaagttctactg-ggctcccacccgcgacgaccgtat 119 Query: 133 cggtgtctgcaagg 146 |||||||||||||| Sbjct: 120 cggtgtctgcaagg 133
>gb|M55448.1|BLYRCAB Hordeum vulgare rubisco activase (RcaB) mRNA, complete cds Length = 1656 Score = 129 bits (65), Expect = 2e-27 Identities = 96/107 (89%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||||||||||||||| ||||||||| |||||||||| ||||| ||||||||| Sbjct: 965 tacaacaaggaggagaacccccgcgtgcccatcatcgtcaccggcaacgacttctcgacg 1024 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || |||||||| ||||||||||| || | |||||||||||||||| Sbjct: 1025 ctgtacgctcccctgatccgtgacgggcgcatggagaagttctactg 1071
>gb|AY312574.1| Deschampsia antarctica Rubisco activase beta form precursor (RCA2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1646 Score = 127 bits (64), Expect = 1e-26 Identities = 126/146 (86%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||||||||||||||| |||||| |||||||||| ||||| ||||||||| Sbjct: 850 tacaacaaggaggagaacccccgtgtccccatcatcgtcaccggcaacgacttctcgacg 909 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| ||| | |||||||||||||||| |||||||| Sbjct: 910 ctgtacgcgcccctcatccgtgacggtcgtatggagaagttctactg-ggcgcccacccg 968 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 || ||||||||||| |||||||||| Sbjct: 969 cgaggaccgtatcggcgtctgcaagg 994
>emb|Z21794.1|MDRBSCACA M.domestica ribulose-1,5-bisphosphate carboxylase/oxygenase activase mRNA Length = 1853 Score = 113 bits (57), Expect = 1e-22 Identities = 94/107 (87%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||||||||||||||| || ||| | |||||||||||||||||||| || Sbjct: 893 tacaacaaggaggagaacccccgtgtcccaatcattgtcaccggtaacgatttctcaaca 952 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | ||||||||||| |||||||| ||| | |||||||||||||||| Sbjct: 953 ttgtacgctcctctcatccgtgacggtcgtatggagaagttctactg 999
>gb|AC137064.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0003C04 map S10003, complete sequence Length = 119238 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 108905 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 108846 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 108845 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 108787 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 108786 cgacgaccgtgtcggcgtctgcaagg 108761
>gb|AC133008.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0026K20 map S10559, complete sequence Length = 115996 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 30782 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 30723 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 30722 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 30664 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 30663 cgacgaccgtgtcggcgtctgcaagg 30638
>gb|U74321.1|OSU74321 Oryza sativa ribulose-1,5-bisphosphate carboxylase/oxygenase activase (rca) mRNA, complete cds Length = 1675 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 812 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 871 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 872 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 930 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 931 cgacgaccgtgtcggcgtctgcaagg 956
>dbj|AB110180.1| Oryza sativa (japonica cultivar-group) mRNA for ribulose-bisphosphate carboxylase activase large isoform precursor protein, complete cds, clone: 13YPR038 Length = 1558 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 807 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 866 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 867 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 925 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 926 cgacgaccgtgtcggcgtctgcaagg 951
>gb|AF349638.1|AF349638 Oryza sativa ribulose-1,5-bisphosphate carboxylase activase mRNA, partial cds; nuclear gene for chloroplast product Length = 651 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 61 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 120 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 121 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 179 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 180 cgacgaccgtgtcggcgtctgcaagg 205
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 28304044 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 28303985 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 28303984 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 28303926 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 28303925 cgacgaccgtgtcggcgtctgcaagg 28303900
>dbj|AK119513.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-F01, full insert sequence Length = 1721 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 855 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 914 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 915 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 973 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 974 cgacgaccgtgtcggcgtctgcaagg 999
>dbj|AK104332.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F04, full insert sequence Length = 1682 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 806 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 865 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 866 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 924 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 925 cgacgaccgtgtcggcgtctgcaagg 950
>dbj|AK064986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001C24, full insert sequence Length = 1680 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 844 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 903 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 904 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 962 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 963 cgacgaccgtgtcggcgtctgcaagg 988
>dbj|AK060847.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E04, full insert sequence Length = 1691 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 843 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 902 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 903 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 961 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 962 cgacgaccgtgtcggcgtctgcaagg 987
>dbj|AK060841.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-D05, full insert sequence Length = 1470 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 627 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 686 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 687 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 745 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 746 cgacgaccgtgtcggcgtctgcaagg 771
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 28286493 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 28286434 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 28286433 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 28286375 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 28286374 cgacgaccgtgtcggcgtctgcaagg 28286349
>dbj|AB034748.1| Oryza sativa OsrcaA2 mRNA for RuBisCO activase small isoform precursor, complete cds Length = 1706 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 848 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 907 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 908 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 966 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 967 cgacgaccgtgtcggcgtctgcaagg 992
>dbj|AB034698.1| Oryza sativa OsrcaA1 mRNA for RuBisCO activase large isoform precursor, complete cds Length = 1623 Score = 111 bits (56), Expect = 6e-22 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| ||||||||||| |||||| |||||||||| ||||| ||||| ||| Sbjct: 842 tacaacaaggaggacaacccccgtgtccccatcatcgtcaccggcaacgacttctccacg 901 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || |||||||| || | |||||||||||||||| ||||||||| Sbjct: 902 ctgtacgcgccgctcatccgtgacgggcgtatggagaagttctactg-ggctcccacccg 960 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||||||||| |||| |||||||||| Sbjct: 961 cgacgaccgtgtcggcgtctgcaagg 986
>gb|AF338238.1|AF338238 Zantedeschia aethiopica rubisco activase (rca2) mRNA, partial cds Length = 1436 Score = 105 bits (53), Expect = 4e-20 Identities = 93/107 (86%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| ||||||||||||| ||||||||| |||||||||| ||||| ||||| || Sbjct: 501 tacaacaagcaggagaacccccgcgtgcccatcatcgtcaccggcaacgacttctccacc 560 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || |||||||| ||| | |||||||||||||||| Sbjct: 561 ctctacgcccccctcatccgtgacggtcgtatggagaagttctactg 607
>gb|AF338237.1|AF338237 Zantedeschia aethiopica rubisco activase (rca1) mRNA, partial cds Length = 1597 Score = 105 bits (53), Expect = 4e-20 Identities = 93/107 (86%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| ||||||||||||| ||||||||| |||||||||| ||||| ||||| || Sbjct: 695 tacaacaagcaggagaacccccgcgtgcccatcatcgtcaccggcaacgacttctccacc 754 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || |||||||| ||| | |||||||||||||||| Sbjct: 755 ctctacgcccccctcatccgtgacggtcgtatggagaagttctactg 801
>gb|AF126870.2|AF126870 Vigna radiata rubisco activase (Rca) mRNA, complete cds; nuclear gene for chloroplast product Length = 1671 Score = 105 bits (53), Expect = 4e-20 Identities = 93/107 (86%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| |||||||||||||| | ||||||||||| |||||||| ||| Sbjct: 886 tacaacaaggaagagaacgcccgtgtgcccatcattgtcaccggtaatgatttctcaacg 945 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || || |||||||| || |||||||| | |||||||||||||||| Sbjct: 946 ctgtatgctcctctcattcgtgatgggcgtatggagaagttctactg 992
>gb|AF041068.1|AF041068 Phaseolus vulgaris rubisco activase (Rca1) mRNA, complete cds Length = 1627 Score = 105 bits (53), Expect = 4e-20 Identities = 93/107 (86%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| || ||| |||||||||||||| | ||||| |||||||||||||| || Sbjct: 882 tacaacaaggaagataacgcccgtgtgcccatcattgtcactggtaacgatttctcaaca 941 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || || |||||||| |||||||||||| | |||||||||||||||| Sbjct: 942 ctttatgctcctctcatccgtgatggtcgtatggagaagttctactg 988
>gb|AF305876.2| Zea mays ribulose 1,5-bisphosphate carboxylase/oxygenase activase precursor, mRNA, partial cds Length = 1336 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| |||||||| ||||||||| |||||||||| ||||| ||||| ||| Sbjct: 421 tacaacaaggaggacaacccccgcgtgcccatcatcgtcaccggcaacgacttctccacg 480 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || ||||| || || | |||||||||||||||| Sbjct: 481 ctctacgcgccgctcatccgcgacggccgcatggagaagttctactg 527
>gb|AF084478.3| Zea mays ribulose-1,5-bisphosphate carboxylase/oxygenase activase precursor (rca1) mRNA, complete cds Length = 1424 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| |||||||| ||||||||| |||||||||| ||||| ||||| ||| Sbjct: 816 tacaacaaggaggacaacccccgcgtgcccatcatcgtcaccggcaacgacttctccacg 875 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || ||||| || || | |||||||||||||||| Sbjct: 876 ctctacgcgccgctcatccgcgacggccgcatggagaagttctactg 922
>gb|AF338240.1|AF338240 Zantedeschia aethiopica rubisco activase (rca4) mRNA, partial cds Length = 1674 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| | ||||||||||| ||||||||| |||||||||| ||||| ||||| || Sbjct: 802 tacaacaagcaagagaacccccgcgtgcccatcatcgtcaccggcaacgacttctccacc 861 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || |||||||| ||| | |||||||||||||||| Sbjct: 862 ctctacgcccccctcatccgtgacggtcgtatggagaagttctactg 908
>gb|AF338239.1|AF338239 Zantedeschia aethiopica rubisco activase (rca3) mRNA, partial cds Length = 1494 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| | ||||||||||| ||||||||| |||||||||| ||||| ||||| || Sbjct: 665 tacaacaagcaagagaacccccgcgtgcccatcatcgtcaccggcaacgacttctccacc 724 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || |||||||| ||| | |||||||||||||||| Sbjct: 725 ctctacgcccccctcatccgtgacggtcgtatggagaagttctactg 771
>gb|AF329935.1|AF329935 Gossypium hirsutum ribulose-1,5-bisphosphate carboxylase/oxygenase activase 2 mRNA, partial cds Length = 1462 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||||||||||| |||||| ||||||| |||||||||||||| || Sbjct: 692 tacaacaaggaagagaacccccgtgtccccatcatcgtcactggtaacgatttctccaca 751 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || || |||||||| |||||||| ||| | ||||||| || ||||| Sbjct: 752 ctgtatgctcctctcatccgtgacggtcgtatggagaaattttactg 798 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Plus Query: 122 gacgaccgtatcggtgtctgcaa 144 ||||||||||||||||| ||||| Sbjct: 812 gacgaccgtatcggtgtttgcaa 834
>gb|AF329934.1|AF329934 Gossypium hirsutum ribulose-1,5-bisphosphate carboxylase/oxygenase activase 1 mRNA, complete cds Length = 1559 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||||| ||||| || ||| | |||||||||||||||||||||||| Sbjct: 877 tacaacaaggaagagaaccctcgtgttccgatcattgtcaccggtaacgatttctcgacg 936 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| ||| | |||||||||| ||||| Sbjct: 937 ctgtacgcgccgctcatccgtgacggtcgtatggagaagttttactg 983
>gb|AF251264.1|AF251264 Triticum aestivum ribulose bisphosphate carboxylase activase B (RcaB) mRNA, complete cds; nuclear gene for chloroplast product Length = 1525 Score = 97.6 bits (49), Expect = 9e-18 Identities = 92/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||||||||| || ||||||||| |||||||||| ||||| ||||||||| Sbjct: 815 tacaacaaggaggagaacccacgcgtgcccatcatcgtcaccggcaacgacttctcgacg 874 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||||||||||||||| Sbjct: 875 ctgtacgcgcccctcatccgggacggccgcatggagaagttctactg 921
>ref|NM_179989.1| Arabidopsis thaliana RCA (RUBISCO ACTIVASE) AT2G39730 (RCA) transcript variant AT2G39730.2 mRNA, complete cds Length = 1815 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 982 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 1041 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 1042 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1100 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1101 tgaagaccgtatcggtgtctgcaagg 1126
>ref|NM_179990.1| Arabidopsis thaliana RCA (RUBISCO ACTIVASE) AT2G39730 (RCA) transcript variant AT2G39730.3 mRNA, complete cds Length = 1928 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 982 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 1041 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 1042 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1100 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1101 tgaagaccgtatcggtgtctgcaagg 1126
>ref|NM_129531.2| Arabidopsis thaliana RCA (RUBISCO ACTIVASE) AT2G39730 (RCA) transcript variant AT2G39730.1 mRNA, complete cds Length = 1833 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 1011 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 1070 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 1071 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1129 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1130 tgaagaccgtatcggtgtctgcaagg 1155
>gb|BT000710.1| Arabidopsis thaliana clone RAFL09-90-K08 (R19890) unknown protein (At2g39730) mRNA, complete cds Length = 1697 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 893 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 952 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 953 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1011 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1012 tgaagaccgtatcggtgtctgcaagg 1037
>gb|AY117142.1| Chenopodium quinoa rubisco activase (rca) mRNA, complete cds Length = 1809 Score = 95.6 bits (48), Expect = 3e-17 Identities = 116/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| | |||||| ||||||| ||||| ||||||| |||||||| ||||| || Sbjct: 932 tacaacaagcaagagaacgcccgtgttcccattatcgtcactggtaacgacttctccacc 991 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 | |||||||| || |||||||||||| | |||||||||||||||| ||||||||| Sbjct: 992 ttgtacgctccccttatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 1050 Query: 121 tgacgaccgtatcggtgt 138 ||| |||||||||||||| Sbjct: 1051 tgaggaccgtatcggtgt 1068
>gb|BT000613.1| Arabidopsis thaliana Rubsico activase (At2g39730/T5I7.3) mRNA, complete cds Length = 1425 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 808 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 867 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 868 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 926 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 927 tgaagaccgtatcggtgtctgcaagg 952
>gb|AC003000.3| Arabidopsis thaliana chromosome 2 clone T5I7 map CIC10A06, complete sequence Length = 92624 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 14306 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 14247 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 14246 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 14188 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 14187 tgaagaccgtatcggtgtctgcaagg 14162
>gb|AY056108.1| Arabidopsis thaliana At2g39730/T5I7.3_ mRNA, complete cds Length = 1674 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 896 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 955 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 956 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1014 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1015 tgaagaccgtatcggtgtctgcaagg 1040
>gb|AY052703.1| Arabidopsis thaliana At2g39730/T5I7.3 mRNA, complete cds Length = 1693 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 885 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 944 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 945 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1003 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1004 tgaagaccgtatcggtgtctgcaagg 1029
>gb|AY052290.1| Arabidopsis thaliana At2g39730/T5I7.3 mRNA, complete cds Length = 1655 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 893 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 952 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 953 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1011 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1012 tgaagaccgtatcggtgtctgcaagg 1037
>gb|AF325049.2|AF325049 Arabidopsis thaliana At2g39730 (At2g39730/T5I7.3) mRNA, complete cds Length = 1674 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 896 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 955 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 956 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1014 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1015 tgaagaccgtatcggtgtctgcaagg 1040
>gb|AY088487.1| Arabidopsis thaliana clone 7114 mRNA, complete sequence Length = 1787 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 1011 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 1070 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 1071 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 1129 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 1130 tgaagaccgtatcggtgtctgcaagg 1155
>gb|M86720.1|ATHRBCOALP Arabidopisis thaliana ribulose bisphosphate carboxylase/oxygenase activase (rca) gene, complete cds Length = 3974 Score = 95.6 bits (48), Expect = 3e-17 Identities = 122/146 (83%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 2977 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 3036 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||||||||| ||||||||||| | |||||||||||||||| || ||||| Sbjct: 3037 ctatacgctcctctcatccgtgatggacgtatggagaagttctactg-ggccccgacccg 3095 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 ||| |||||||||||||||||||||| Sbjct: 3096 tgaagaccgtatcggtgtctgcaagg 3121
>gb|DQ233255.1| Gossypium hirsutum ribulose-1,5-bisphosphate carboxylase/oxygenase activase alpha 2 mRNA, complete cds Length = 1433 Score = 89.7 bits (45), Expect = 2e-15 Identities = 91/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||||||||||| ||||| ||||||| |||||||||||||| || Sbjct: 691 tacaacaaggaagagaacccccgtgtccccattatcgtcactggtaacgatttctccaca 750 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || || |||||||| |||||||| ||| | ||||||| || ||||| Sbjct: 751 ctgtatgctcctctcatccgtgacggtcgtatggagaaattttactg 797
>gb|AY312576.1| Larrea tridentata Rubisco activase beta form precursor (RCA2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1694 Score = 89.7 bits (45), Expect = 2e-15 Identities = 91/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||||| |||||||| ||| | ||||| |||||||| |||||||| Sbjct: 877 tacaacaaggaagagaaccctcgtgtgcctatcattgtcactggtaacgacttctcgaca 936 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | ||||||||||| |||||||||||| | |||| || |||||||| Sbjct: 937 ttgtacgctcctcttatccgtgatggtcgtatggaaaaattctactg 983
>gb|AY130300.1| Medicago sativa rubisco activase (Rca) mRNA, partial cds Length = 1063 Score = 89.7 bits (45), Expect = 2e-15 Identities = 91/107 (85%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| || || | |||||||||||| | ||||||||||| |||||||| || Sbjct: 315 tacaacaaggaagacaatgctcgtgtgcccatcattgtcaccggtaatgatttctcaaca 374 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || || |||||||| |||||||||||| | |||||||||||||||| Sbjct: 375 ctttatgctcctctcatccgtgatggtcgtatggagaagttctactg 421
>gb|AF114155.1|AF114155 Artemisia annua ribulose-1,5-bisphosphate carboxylase/oxygenase activase pseudogene, partial sequence Length = 472 Score = 89.7 bits (45), Expect = 2e-15 Identities = 88/103 (85%) Strand = Plus / Plus Query: 5 acaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacgctct 64 ||||||||||||||||||||||||||||| ||||||| || ||||||||||| | || | Sbjct: 311 acaaggaggagaacccccgtgtgcccatcatcgtcacaggaaacgatttctcagcactat 370 Query: 65 acgctcctctgatccgtgatggtnggntggagaagttctactg 107 | ||||| || ||||| |||||| | |||| ||||||||||| Sbjct: 371 atgctccccttatccgcgatggtcgtatggaaaagttctactg 413
>gb|S45033.1| rubisco activase, ribulosebisphosphate carboxylase/oxygenase activase {alternatively spliced} [spinach, Genomic, 3691 nt] Length = 3691 Score = 85.7 bits (43), Expect = 3e-14 Identities = 117/141 (82%), Gaps = 1/141 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| |||| || ||||||| |||||| | || || |||||||||||||| || Sbjct: 2674 tacaacaagcaggacaatgcccgtgtccccatcattgttactggtaacgatttctccacc 2733 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 | |||||||| || |||||||||||| | |||||||||||||||| ||||||||| Sbjct: 2734 ttgtacgctccccttatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 2792 Query: 121 tgacgaccgtatcggtgtctg 141 ||| |||||||| |||||||| Sbjct: 2793 tgaggaccgtattggtgtctg 2813
>gb|J03610.1|SPIRBCO Spinach rubisco activase mRNA, complete cds Length = 1832 Score = 85.7 bits (43), Expect = 3e-14 Identities = 117/141 (82%), Gaps = 1/141 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| |||| || ||||||| |||||| | || || |||||||||||||| || Sbjct: 1046 tacaacaagcaggacaatgcccgtgtccccatcattgttactggtaacgatttctccacc 1105 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 | |||||||| || |||||||||||| | |||||||||||||||| ||||||||| Sbjct: 1106 ttgtacgctccccttatccgtgatggtcgtatggagaagttctactg-ggctcccacccg 1164 Query: 121 tgacgaccgtatcggtgtctg 141 ||| |||||||| |||||||| Sbjct: 1165 tgaggaccgtattggtgtctg 1185
>gb|AY312573.1| Deschampsia antarctica Rubisco activase alpha form precursor (RCA1) mRNA, complete cds; nuclear gene for chloroplast product Length = 1616 Score = 81.8 bits (41), Expect = 5e-13 Identities = 120/146 (82%), Gaps = 1/146 (0%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||||||||||||||| ||||| | |||||||| ||||| || |||||| Sbjct: 860 tacaacaaggaggagaacccccgtgttcccattatngtcaccggcaacgacttttcgacg 919 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttcccacccg 120 || ||||| || || || | ||| ||| | |||||||||| ||||| |||||||| Sbjct: 920 ctgtacgccccccttattcctgacggtcgtatggagaagttttactg-ggcgcccacccg 978 Query: 121 tgacgaccgtatcggtgtctgcaagg 146 || ||||||||||| |||||||||| Sbjct: 979 cgaggaccgtatcggcgtctgcaagg 1004
>gb|DQ124098.1| Coffea arabica clone MN-SSH2-F02 mRNA sequence Length = 253 Score = 81.8 bits (41), Expect = 5e-13 Identities = 90/107 (84%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||| || |||||||||||||||||| || | ||||||||||| |||||||| || Sbjct: 2 tacaacaaagaagagaacccccgtgtgcccgtcattgtcaccggtaatgatttctccacc 61 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | || ||||| || |||||||||||| | ||||||| |||||||| Sbjct: 62 ttgtatgctccccttatccgtgatggtcgtatggagaaattctactg 108
>gb|DQ430611.1| Sorghum bicolor voucher PI267539 locus S10003 genomic sequence Length = 633 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 376 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 435 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 436 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 482
>gb|DQ430610.1| Sorghum bicolor voucher PI267408 locus S10003 genomic sequence Length = 635 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 484
>gb|DQ430608.1| Sorghum bicolor voucher PI152702 locus S10003 genomic sequence Length = 639 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 382 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 441 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 442 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 488
>gb|DQ430606.1| Sorghum bicolor voucher NSL77217 locus S10003 genomic sequence Length = 635 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 484
>gb|DQ430604.1| Sorghum bicolor voucher NSL56174 locus S10003 genomic sequence Length = 627 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| ||||||||||||||||||||||| ||||| ||||| ||| Sbjct: 370 tacagcaaggtggacaacccgcgtgtgcccatcgtcgtcaccggcaacgacttctccacg 429 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 430 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 476
>gb|DQ430603.1| Sorghum bicolor voucher NSL56003 locus S10003 genomic sequence Length = 635 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 484
>gb|DQ430602.1| Sorghum bicolor voucher NSL55243 locus S10003 genomic sequence Length = 635 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 484
>gb|DQ430601.1| Sorghum bicolor voucher NSL51365 locus S10003 genomic sequence Length = 635 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 484
>gb|DQ430600.1| Sorghum bicolor voucher NSL51030 locus S10003 genomic sequence Length = 637 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 380 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 439 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || |||||||| || | |||| ||||||||||| Sbjct: 440 ctgtacgcgccgctcatccgtgacgggcgcatggacaagttctactg 486
>gb|AF052424.1|AF052424 Datisca glomerata rubisco activase precursor, gene, partial cds Length = 1216 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| ||||| || ||||| || ||| ||||||| ||||| || |||||||| Sbjct: 720 tacaacaaggaagagaatccacgtgtaccgatcatcgtcacaggtaatgacttctcgaca 779 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | ||||||||||| || ||||||||| | ||||||| |||||||| Sbjct: 780 ttgtacgctcctctcattcgtgatggtcgtatggagaaattctactg 826
>gb|AF047352.1|AF047352 Datisca glomerata rubisco activase precursor, mRNA, complete cds Length = 1634 Score = 73.8 bits (37), Expect = 1e-10 Identities = 89/107 (83%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| ||||| || ||||| || ||| ||||||| ||||| || |||||||| Sbjct: 893 tacaacaaggaagagaatccacgtgtaccgatcatcgtcacaggtaatgacttctcgaca 952 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | ||||||||||| || ||||||||| | ||||||| |||||||| Sbjct: 953 ttgtacgctcctctcattcgtgatggtcgtatggagaaattctactg 999
>gb|DQ430613.1| Sorghum propinquum locus S10003 genomic sequence Length = 619 Score = 71.9 bits (36), Expect = 5e-10 Identities = 60/68 (88%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| ||||||||||||||||||||||| ||||| ||||| ||| Sbjct: 362 tacagcaaggtggacaacccgcgtgtgcccatcgtcgtcaccggcaacgacttctccacg 421 Query: 61 ctctacgc 68 || ||||| Sbjct: 422 ctgtacgc 429
>gb|AY110044.1| Zea mays CL1146_1 mRNA sequence Length = 1750 Score = 67.9 bits (34), Expect = 8e-09 Identities = 87/107 (81%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||||||||||||| || | ||||||||| |||||||||| ||||| ||||| ||| Sbjct: 816 tacaacaaggaggacaannnnngcgtgcccatcatcgtcaccggcaacgacttctccacg 875 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 |||||||| || || ||||| || || | |||||||||||||||| Sbjct: 876 ctctacgcgccgctcatccgcgacggccgcatggagaagttctactg 922
>gb|AY312575.1| Larrea tridentata Rubisco activase alpha form precursor (RCA1) mRNA, complete cds; nuclear gene for chloroplast product Length = 1724 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||||| ||||| |||||| | ||||| |||||||| ||||| || Sbjct: 877 tacaacaaggaagagaaccctcgtgttcccatcattgtcactggtaacgacttctcaaca 936 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | || || ||||| ||||||||||| | ||||||| |||||||| Sbjct: 937 ttgtatgcccctcttatccgtgatggccgtatggagaaattctactg 983
>gb|DQ430612.1| Sorghum bicolor voucher PI585454 locus S10003 genomic sequence Length = 637 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 380 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 439 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 440 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 486
>gb|DQ430609.1| Sorghum bicolor voucher PI221607 locus S10003 genomic sequence Length = 635 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 484
>gb|DQ430607.1| Sorghum bicolor voucher NSL92371 locus S10003 genomic sequence Length = 633 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 376 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 435 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 436 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 482
>gb|DQ430605.1| Sorghum bicolor voucher NSL77034 locus S10003 genomic sequence Length = 633 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 376 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 435 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 436 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 482
>gb|DQ430599.1| Sorghum bicolor voucher NSL50875 locus S10003 genomic sequence Length = 635 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 378 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 437 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 438 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 484
>gb|DQ430598.1| Sorghum bicolor voucher BTx623 locus S10003 genomic sequence Length = 639 Score = 65.9 bits (33), Expect = 3e-08 Identities = 88/107 (82%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 |||| ||||| ||| ||||| |||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 382 tacagcaaggtggacaacccgcgtgtgcccatcatcgtcaccggcaacgacttctccacg 441 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 || ||||| || || ||||| || || | |||| ||||||||||| Sbjct: 442 ctgtacgcgccgctcatccgcgacgggcgcatggacaagttctactg 488
>emb|Z14979.1|NTRCAJQ11 N.tabacum Rca gene for ribulose bisphosphate carboxyase activase (pJQ11) Length = 883 Score = 61.9 bits (31), Expect = 5e-07 Identities = 62/73 (84%) Strand = Plus / Plus Query: 35 tcgtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntgg 94 ||||||| |||||||||||||| || | || ||||| || |||||||||||| | ||| Sbjct: 147 tcgtcactggtaacgatttctccacattgtatgctccacttatccgtgatggtcgtatgg 206 Query: 95 agaagttctactg 107 ||||||||||||| Sbjct: 207 agaagttctactg 219
>gb|U35111.1|NTU35111 Nicotiana tabacum rubisco activase precursor (Rca) mRNA, complete cds Length = 1674 Score = 61.9 bits (31), Expect = 5e-07 Identities = 62/73 (84%) Strand = Plus / Plus Query: 35 tcgtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntgg 94 ||||||| |||||||||||||| || | || ||||| || |||||||||||| | ||| Sbjct: 907 tcgtcactggtaacgatttctccacattgtatgctccacttatccgtgatggtcgtatgg 966 Query: 95 agaagttctactg 107 ||||||||||||| Sbjct: 967 agaagttctactg 979
>gb|AF173678.1|AF173678 Beta vulgaris clone RAC109UNI ribulose bisphosphate carboxylase activase (Rca) gene, partial sequence Length = 648 Score = 58.0 bits (29), Expect = 8e-06 Identities = 87/107 (81%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||| |||| || | ||||| |||||| |||| || |||||||| ||||| || Sbjct: 81 tacaacaagcaggacaatgctcgtgtacccatcatcgttactggtaacgacttctctacc 140 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactg 107 | || |||||||| |||||||||||| | ||||||| |||||||| Sbjct: 141 ttgtatgctcctctcatccgtgatggtcgtatggagaaattctactg 187
>gb|AF037361.1|AF037361 Lycopersicon pennellii rubisco activase mRNA, complete cds Length = 1656 Score = 58.0 bits (29), Expect = 8e-06 Identities = 60/71 (84%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| |||||||| ||||| || | || |||||||| |||||||||||| | ||||| Sbjct: 890 gtcactggtaacgacttctccacattgtatgctcctcttatccgtgatggtcgtatggag 949 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 950 aagttctactg 960
>emb|Z14981.1|NTRCATA1 N.tabacum Rca mRNA for ribulosebisphosphate carboxylase activase (pTA1.1) Length = 1011 Score = 52.0 bits (26), Expect = 5e-04 Identities = 57/68 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| |||||||| ||||| || | || |||||||| |||||||||||| | ||||| Sbjct: 235 gtcactggtaacgacttctccacattgtatgctcctcttatccgtgatggtcgtatggag 294 Query: 97 aagttcta 104 |||||||| Sbjct: 295 aagttcta 302
>emb|Z14980.1|NTRCAJQ4 N.tabacum Rca gene for ribulose bisphosphate carboxylase activase (pJQ4) Length = 1655 Score = 52.0 bits (26), Expect = 5e-04 Identities = 57/68 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| |||||||| ||||| || | || |||||||| |||||||||||| | ||||| Sbjct: 879 gtcactggtaacgacttctccacattgtatgctcctcttatccgtgatggtcgtatggag 938 Query: 97 aagttcta 104 |||||||| Sbjct: 939 aagttcta 946
>ref|NM_105969.1| Arabidopsis thaliana ATP binding / ATPase AT1G73110 mRNA, complete cds Length = 1437 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| || ||||||||||| || || || ||||| ||||||||||| || | ||||| Sbjct: 899 gtcacagggaacgatttctctacactgtatgctccactgatccgtgaaggaagaatggag 958 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 959 aagttctactg 969
>gb|BT012795.1| Lycopersicon esculentum clone 113794R, mRNA sequence Length = 1519 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| |||||||||||||| || | || || ||||| |||||||||||| | ||||| Sbjct: 926 gtcactggtaacgatttctccacattgtatgcacctcttatccgtgatggtcgtatggag 985 Query: 97 aagttctactg 107 || |||||||| Sbjct: 986 aaattctactg 996
>gb|AY078044.1| Arabidopsis thaliana At1g73110/F3N23_39 mRNA, complete cds Length = 1299 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| || ||||||||||| || || || ||||| ||||||||||| || | ||||| Sbjct: 865 gtcacagggaacgatttctctacactgtatgctccactgatccgtgaaggaagaatggag 924 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 925 aagttctactg 935
>gb|AF361834.1| Arabidopsis thaliana At1g73110/F3N23_39 mRNA, complete cds Length = 1437 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| || ||||||||||| || || || ||||| ||||||||||| || | ||||| Sbjct: 899 gtcacagggaacgatttctctacactgtatgctccactgatccgtgaaggaagaatggag 958 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 959 aagttctactg 969
>emb|BX815704.1|CNS0AARM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS85ZG11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1496 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| || ||||||||||| || || || ||||| ||||||||||| || | ||||| Sbjct: 873 gtcacagggaacgatttctctacactgtatgctccactgatccgtgaaggaagaatggag 932 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 933 aagttctactg 943
>dbj|AK118942.1| Arabidopsis thaliana At1g73110 mRNA for unknown protein, complete cds, clone: RAFL21-28-D21 Length = 1447 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Plus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| || ||||||||||| || || || ||||| ||||||||||| || | ||||| Sbjct: 886 gtcacagggaacgatttctctacactgtatgctccactgatccgtgaaggaagaatggag 945 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 946 aagttctactg 956
>emb|X14212.1|ATRCA Arabidopsis thaliana mRNA for rubisco activase Length = 1652 Score = 50.1 bits (25), Expect = 0.002 Identities = 114/142 (80%), Gaps = 3/142 (2%) Strand = Plus / Plus Query: 1 tacaacaaggaggagaacccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacg 60 ||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||| || Sbjct: 877 tacaacaaggaagagaacgcacgtgtccccatcatttgcactggtaacgatttctccacc 936 Query: 61 ctctacgctcctctgatccgtgatggtnggntggagaagttctactgtttttccc-accc 119 | |||| |||||| |||| |||||| | |||||||||||| || | ||| |||| Sbjct: 937 ttatacggtcctctcatccttgatggacgtatggagaagttct--tgactggcccgaccc 994 Query: 120 gtgacgaccgtatcggtgtctg 141 |||| ||||||||||||||||| Sbjct: 995 gtgaagaccgtatcggtgtctg 1016
>gb|AC008017.2|AC008017 Arabidopsis thaliana chromosome I BAC F3N23 genomic sequence, complete sequence Length = 116944 Score = 50.1 bits (25), Expect = 0.002 Identities = 59/71 (83%) Strand = Plus / Minus Query: 37 gtcaccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggag 96 ||||| || ||||||||||| || || || ||||| ||||||||||| || | ||||| Sbjct: 97686 gtcacagggaacgatttctctacactgtatgctccactgatccgtgaaggaagaatggag 97627 Query: 97 aagttctactg 107 ||||||||||| Sbjct: 97626 aagttctactg 97616
>emb|BX813694.1|CNS0ADV2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB33ZF10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1426 Score = 48.1 bits (24), Expect = 0.007 Identities = 52/62 (83%) Strand = Plus / Plus Query: 46 aacgatttctcgacgctctacgctcctctgatccgtgatggtnggntggagaagttctac 105 ||||||||||| || || || ||||| ||||||||||| || | |||||||||||||| Sbjct: 936 aacgatttctctacactgtatgctccactgatccgtgaaggaagaatggagaagttctac 995 Query: 106 tg 107 || Sbjct: 996 tg 997
>emb|Y10657.1|CLRCAGENE C.littorale rca gene Length = 2513 Score = 46.1 bits (23), Expect = 0.029 Identities = 100/125 (80%), Gaps = 1/125 (0%) Strand = Plus / Plus Query: 19 ccccgtgtgcccatcgtcgtcaccggtaacgatttctcgacgctctacgctcctctgatc 78 |||||||| ||||| ||| ||| |||||||||||||| || || ||||| || || ||| Sbjct: 1724 ccccgtgttcccattgtctgcacgggtaacgatttctccaccctgtacgcccccctcatc 1783 Query: 79 cgtgatggtnggntggagaagttctactgtttttcccacccgtgacgaccgtatcggtgt 138 ||||| || | ||||||||| |||||| ||||||||||| ||||| ||||| || Sbjct: 1784 cgtgacggccgcatggagaagtactactggaac-cccacccgtgaggaccgcatcggcgt 1842 Query: 139 ctgca 143 ||||| Sbjct: 1843 ctgca 1847
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 cgtgacgaccgtatcggtgt 138 |||||||||||||||||||| Sbjct: 3056327 cgtgacgaccgtatcggtgt 3056308
>emb|AL844583.6| Mouse DNA sequence from clone RP23-240F13 on chromosome X, complete sequence Length = 176870 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 ttctactgtttttcccaccc 119 |||||||||||||||||||| Sbjct: 129672 ttctactgtttttcccaccc 129653
>ref|XM_809726.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053508061.50) partial mRNA Length = 10371 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 30 catcgtcgtcaccggtaac 48 ||||||||||||||||||| Sbjct: 5145 catcgtcgtcaccggtaac 5163
>ref|XM_813754.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053510643.10) partial mRNA Length = 10476 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 30 catcgtcgtcaccggtaac 48 ||||||||||||||||||| Sbjct: 5226 catcgtcgtcaccggtaac 5244
>ref|XM_799742.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053510637.9) partial mRNA Length = 6191 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 30 catcgtcgtcaccggtaac 48 ||||||||||||||||||| Sbjct: 5229 catcgtcgtcaccggtaac 5247
>emb|BX897743.8| Zebrafish DNA sequence from clone CH211-164N21 in linkage group 10, complete sequence Length = 112314 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 99 gttctactgtttttcccac 117 ||||||||||||||||||| Sbjct: 21118 gttctactgtttttcccac 21136
>gb|AC154619.2| Mus musculus BAC clone RP23-322I21 from 16, complete sequence Length = 191616 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 93 ggagaagttctactgtttt 111 ||||||||||||||||||| Sbjct: 38955 ggagaagttctactgtttt 38937
>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome Length = 2905187 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 95 agaagttctactgtttttcccac 117 |||||||||| |||||||||||| Sbjct: 1277738 agaagttctaatgtttttcccac 1277716 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 683,944 Number of Sequences: 3902068 Number of extensions: 683944 Number of successful extensions: 42053 Number of sequences better than 10.0: 98 Number of HSP's better than 10.0 without gapping: 98 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 41865 Number of HSP's gapped (non-prelim): 180 length of query: 146 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 125 effective length of database: 17,151,101,840 effective search space: 2143887730000 effective search space used: 2143887730000 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
