| Clone Name | baal31i20 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ010830.1|TSP010830 Triticum sp. mRNA for GRAB2 protein Length = 1295 Score = 105 bits (53), Expect = 6e-20 Identities = 73/80 (91%) Strand = Plus / Plus Query: 66 tgatgccgtcgtcgcggtcgtacgtngatctggagcagctgtgccggggcgagcctccca 125 |||||||||| |||||||||||| | ||||||||| |||||| |||||||||||||| || Sbjct: 1076 tgatgccgtcatcgcggtcgtacctcgatctggaggagctgttccggggcgagcctctca 1135 Query: 126 tggacttctccaacatgtgg 145 |||||| ||||||||||||| Sbjct: 1136 tggactactccaacatgtgg 1155
>ref|XM_309164.2| Anopheles gambiae str. PEST ENSANGP00000018738 (ENSANGG00000016249), partial mRNA Length = 1644 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 98 gagcagctgtgccggggcgagc 119 |||||||||||||||||||||| Sbjct: 898 gagcagctgtgccggggcgagc 919
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 ggcgcgctcgccggcgccgcg 49 ||||||||||||||||||||| Sbjct: 2268583 ggcgcgctcgccggcgccgcg 2268603
>ref|XM_527544.1| PREDICTED: Pan troglodytes RNA-binding motif protein 16 (LOC472167), mRNA Length = 5196 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 28 gggcgcgctcgccggcgccgcgga 51 ||||||||| |||||||||||||| Sbjct: 966 gggcgcgctggccggcgccgcgga 989
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 acgggcgcgctcgccggcgc 45 |||||||||||||||||||| Sbjct: 2101978 acgggcgcgctcgccggcgc 2101959
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 acgggcgcgctcgccggcgc 45 |||||||||||||||||||| Sbjct: 546245 acgggcgcgctcgccggcgc 546226
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 acgggcgcgctcgccggcgc 45 |||||||||||||||||||| Sbjct: 3485682 acgggcgcgctcgccggcgc 3485663 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 gggcgcgctcgccggcgccg 47 |||||||||||||||||||| Sbjct: 1555566 gggcgcgctcgccggcgccg 1555585
>emb|AL591499.7| Human DNA sequence from clone RP11-15G8 on chromosome 6 Contains the 5' end of a novel gene (KIAA1116), a stathmin-like 2 (Superiorcervical ganglia, neural specific 10 superior cervical ganglia, neural specific 10 neuronal growth-associated protein (silencer) (STMN2) (SCG10, SGC10, SCGN10) pseudogene and two CpG islands, complete sequence Length = 111864 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 28 gggcgcgctcgccggcgccgcgga 51 ||||||||| |||||||||||||| Sbjct: 78634 gggcgcgctagccggcgccgcgga 78657
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 24 acacgggcgcgctcgccggcgccg 47 |||| ||||||||||||||||||| Sbjct: 1521485 acaccggcgcgctcgccggcgccg 1521508
>emb|Y19177.1|SAN19177 Streptomyces antibioticus polyketide biosynthetic gene cluster Length = 7482 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 tcgccggcgccgcggacacc 55 |||||||||||||||||||| Sbjct: 3066 tcgccggcgccgcggacacc 3085
>emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genome; segment 1/16 Length = 349315 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 gggcgcgctcgccggcgccg 47 |||||||||||||||||||| Sbjct: 94350 gggcgcgctcgccggcgccg 94331
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 acgggcgcgctcgccggcgc 45 |||||||||||||||||||| Sbjct: 3226790 acgggcgcgctcgccggcgc 3226771 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 gggcgcgctcgccggcgccg 47 |||||||||||||||||||| Sbjct: 1442659 gggcgcgctcgccggcgccg 1442678
>emb|AJ311709.1|CGL311709 Colletotrichum gloeosporioides cat gene for catalase, exons 1-4 Length = 1919 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 cgggcgcgctcgccggcgcc 46 |||||||||||||||||||| Sbjct: 1568 cgggcgcgctcgccggcgcc 1587
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 gcgcgctcgccggcgccgcg 49 |||||||||||||||||||| Sbjct: 822933 gcgcgctcgccggcgccgcg 822952
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 acgggcgcgctcgccggcgc 45 |||||||||||||||||||| Sbjct: 917727 acgggcgcgctcgccggcgc 917746
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 3.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 19 cttcgacacgggcgcgctcgccggcgcc 46 |||||| ||||||||| ||||||||||| Sbjct: 223787 cttcgagacgggcgcggtcgccggcgcc 223760 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,190,635 Number of Sequences: 3902068 Number of extensions: 1190635 Number of successful extensions: 27691 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 26487 Number of HSP's gapped (non-prelim): 1204 length of query: 246 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 224 effective length of database: 17,147,199,772 effective search space: 3840972748928 effective search space used: 3840972748928 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)