>gb|AF523077.1| Acacia lycopodiifolia trnK gene, partial sequence; and maturase-like
            protein gene, partial cds; chloroplast genes for
            chloroplast products
          Length = 2034

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 203  tgtatcaagctttttcacatgattt 227
            ||||||||||||||||| |||||||
Sbjct: 1846 tgtatcaagctttttcatatgattt 1822

>gb|AF523076.1| Acacia adoxa chloroplast trnK gene, intron sequence; and
            maturase-like sequence
          Length = 2443

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 203  tgtatcaagctttttcacatgattt 227
            ||||||||||||||||| |||||||
Sbjct: 1832 tgtatcaagctttttcatatgattt 1808

>gb|DQ371879.1| Acacia lycopodifolia voucher CANB 615616 trnK gene, partial sequence;
            chloroplast
          Length = 1981

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 203  tgtatcaagctttttcacatgattt 227
            ||||||||||||||||| |||||||
Sbjct: 1793 tgtatcaagctttttcatatgattt 1769


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,465,221
Number of Sequences: 3902068
Number of extensions: 1465221
Number of successful extensions: 26329
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26326
Number of HSP's gapped (non-prelim): 3
length of query: 230
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 208
effective length of database: 17,147,199,772
effective search space: 3566617552576
effective search space used: 3566617552576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)