ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal30i16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 331 7e-88
2dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 331 7e-88
3dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 323 2e-85
4gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 276 4e-71
5gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 216 3e-53
6gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 216 3e-53
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 216 3e-53
8emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 204 1e-49
9gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 176 3e-41
10gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 121 1e-24
11emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 117 2e-23
12gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 103 3e-19
13gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 101 1e-18
14gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 96 8e-17
15dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 96 8e-17
16emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 96 8e-17
17gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 96 8e-17
18emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 90 5e-15
19ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 86 7e-14
20ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 86 7e-14
21ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
22ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
23ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
24ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
25ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
26ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
27ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 86 7e-14
28gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 86 7e-14
29gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 86 7e-14
30gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 86 7e-14
31dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 86 7e-14
32dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 86 7e-14
33dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 86 7e-14
34dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 86 7e-14
35dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
36dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
37dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
38dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
39dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
40emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 86 7e-14
41dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
42dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
43dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
44dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
45dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
46dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
47dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 7e-14
48emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 84 3e-13
49emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 84 3e-13
50gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 82 1e-12
51dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 82 1e-12
52emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 80 4e-12
53emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 80 4e-12
54dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 80 4e-12
55emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 78 2e-11
56gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 78 2e-11
57emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 78 2e-11
58dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
59dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 78 2e-11
60ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 74 3e-10
61gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 74 3e-10
62gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 74 3e-10
63emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
64emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
65emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
66emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
67emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
68emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
69emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
70emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
71emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 74 3e-10
72gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 74 3e-10
73gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 74 3e-10
74gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 74 3e-10
75dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 72 1e-09
76emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 72 1e-09
77gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 72 1e-09
78dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 72 1e-09
79ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 70 4e-09
80gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 70 4e-09
81gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 70 4e-09
82dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 70 4e-09
83dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 70 4e-09
84dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 70 4e-09
85dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 70 4e-09
86dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
87dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
88dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
89dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
90dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
91dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
92dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
93dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
94dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 4e-09
95gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 70 4e-09
96dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 70 4e-09
97gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 68 2e-08
98gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 68 2e-08
99gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 66 7e-08
100dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 66 7e-08
101gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 66 7e-08
102emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 66 7e-08
103emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 66 7e-08
104dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 66 7e-08
105dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 66 7e-08
106dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 66 7e-08
107dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 66 7e-08
108gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 64 3e-07
109ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 62 1e-06
110ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 62 1e-06
111ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 62 1e-06
112ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 62 1e-06
113ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 62 1e-06
114ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 62 1e-06
115emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 62 1e-06
116emb|X61915.1|PTCABP P.thunbergii cab gene 62 1e-06
117gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 62 1e-06
118gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 62 1e-06
119emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 62 1e-06
120gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 62 1e-06
121gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 62 1e-06
122gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 62 1e-06
123gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 62 1e-06
124gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 62 1e-06
125gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 62 1e-06
126gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 62 1e-06
127gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 62 1e-06
128gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 62 1e-06
129gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 62 1e-06
130gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 62 1e-06
131gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 62 1e-06
132gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 62 1e-06
133gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 62 1e-06
134gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 62 1e-06
135gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 62 1e-06
136gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 62 1e-06
137gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 62 1e-06
138gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 62 1e-06
139gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 62 1e-06
140gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 62 1e-06
141gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 62 1e-06
142gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 62 1e-06
143gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 62 1e-06
144emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
145emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
146emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
147emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
148emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
149emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
150emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
151emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
152emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
153gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 62 1e-06
154gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 62 1e-06
155gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 62 1e-06
156emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 62 1e-06
157emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 62 1e-06
158emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 62 1e-06
159emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 62 1e-06
160emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 62 1e-06
161emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 62 1e-06
162gb|AY109324.1| Zea mays CL187_1 mRNA sequence 62 1e-06
163gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 62 1e-06
164gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 60 4e-06
165gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 60 4e-06
166gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 60 4e-06
167dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 60 4e-06
168emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 60 4e-06
169emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 60 4e-06
170gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 60 4e-06
171gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 60 4e-06
172gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 60 4e-06
173ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 58 2e-05
174ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 58 2e-05
175gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 58 2e-05
176gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 58 2e-05
177emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 58 2e-05
178gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 58 2e-05
179gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 58 2e-05
180gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 58 2e-05
181emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 58 2e-05
182gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 58 2e-05
183gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 58 2e-05
184gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 58 2e-05
185gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 58 2e-05
186gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 58 2e-05
187gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 58 2e-05
188gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 58 2e-05
189emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
190emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
191emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
192emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
193emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
194gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 58 2e-05
195gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 58 2e-05
196emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 58 2e-05
197emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 58 2e-05
198emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 58 2e-05
199gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 58 2e-05
200dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 58 2e-05
201emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 56 6e-05
202emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 56 6e-05
203gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 54 3e-04
204gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 54 3e-04
205gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 54 3e-04
206gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 54 3e-04
207gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 54 3e-04
208gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 54 3e-04
209gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 54 3e-04
210gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 54 3e-04
211gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 54 3e-04
212gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 54 3e-04
213gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 54 3e-04
214gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 54 3e-04
215emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
216emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 54 3e-04
217emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 54 3e-04
218emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 54 3e-04
219emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 52 0.001
220gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 52 0.001
221emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 52 0.001
222gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 52 0.001
223gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 50 0.004
224gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 50 0.004
225gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 50 0.004
226emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 50 0.004
227gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 50 0.004
228dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 50 0.004
229gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 48 0.016
230emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 48 0.016
231gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 48 0.016
232emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 48 0.016
233gb|M64619.1|PEACAB66 Pea cab gene, complete cds 48 0.016
234gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 48 0.016
235gb|DQ226734.1| Boechera divaricarpa isolate SLW-A-E08 mRNA sequence 46 0.062
236gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 46 0.062
237gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 46 0.062
238gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 46 0.062
239ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 44 0.25
240ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 44 0.25
241gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 44 0.25
242gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 44 0.25
243gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 44 0.25
244gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 44 0.25
245gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 44 0.25
246gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 44 0.25
247gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 44 0.25
248gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 44 0.25
249emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 44 0.25
250emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 44 0.25
251emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 44 0.25
252emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 44 0.25
253gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 44 0.25
254emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 42 0.97
255gb|AE005806.1| Caulobacter crescentus CB15 section 132 of 359 of... 42 0.97
256emb|X76632.1|PPCAB P.patens (Hedw.) B.S.G. partial mRNA for chlo... 42 0.97
257emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 42 0.97
258gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 42 0.97
259gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 42 0.97
260emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 42 0.97
261gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 3.8
262emb|BX640437.1| Bordetella bronchiseptica strain RB50, complete ... 40 3.8
263emb|BX640423.1| Bordetella parapertussis strain 12822, complete ... 40 3.8
264emb|BX640413.1| Bordetella pertussis strain Tohama I, complete g... 40 3.8
265emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 3.8
266emb|BX294149.1| Pirellula sp. strain 1 complete genome; segment ... 40 3.8
267gb|CP000249.1| Frankia sp. CcI3, complete genome 40 3.8
268gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 3.8
269dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 40 3.8
270emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 3.8

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  331 bits (167), Expect = 7e-88
 Identities = 222/241 (92%)
 Strand = Plus / Plus

                                                                       
Query: 41  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
           |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 41  atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 100

                                                                       
Query: 101 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
           || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 101 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 160

                                                                       
Query: 161 agcgcgccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctcc 220
           ||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||| 
Sbjct: 161 agcgcgccccagagcatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 220

                                                                       
Query: 221 gagcagaccccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcg 280
           |||||||| || |||||||||||||| |||||||| || ||||||||||||||||| |||
Sbjct: 221 gagcagacgccatcgtacctgaccggagagttcccgggagactacgggtgggacacggcg 280

            
Query: 281 g 281
           |
Sbjct: 281 g 281



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  331 bits (167), Expect = 7e-88
 Identities = 222/241 (92%)
 Strand = Plus / Plus

                                                                       
Query: 41  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
           |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 33  atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 92

                                                                       
Query: 101 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
           ||| |||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 93  gacgtcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 152

                                                                       
Query: 161 agcgcgccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctcc 220
           ||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||| 
Sbjct: 153 agcgcgccccagagcatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 212

                                                                       
Query: 221 gagcagaccccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcg 280
           |||||||| || |||||||||||||| |||||||| || ||||||||||||||||| |||
Sbjct: 213 gagcagacgccatcgtacctgaccggagagttcccgggagactacgggtgggacacggcg 272

            
Query: 281 g 281
           |
Sbjct: 273 g 273



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  323 bits (163), Expect = 2e-85
 Identities = 221/241 (91%)
 Strand = Plus / Plus

                                                                       
Query: 41  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
           |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 52  atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 111

                                                                       
Query: 101 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
           || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 112 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 171

                                                                       
Query: 161 agcgcgccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctcc 220
           ||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||| 
Sbjct: 172 agcgcgccccagagcatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 231

                                                                       
Query: 221 gagcagaccccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcg 280
           |||||||| || |||||||||||||| |||||||| || |||||| |||||||||| |||
Sbjct: 232 gagcagacgccatcgtacctgaccggagagttcccgggagactacaggtgggacacggcg 291

            
Query: 281 g 281
           |
Sbjct: 292 g 292



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score =  276 bits (139), Expect = 4e-71
 Identities = 215/241 (89%)
 Strand = Plus / Plus

                                                                       
Query: 41  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
           ||||||||||||||||||||||| || ||||||||||||||||||||||| || || |||
Sbjct: 48  atggccgcgtcggcgctgcaccaaaccaccagcttcctcggcaccgcccctcgccgggat 107

                                                                       
Query: 101 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
           || ||||||||| |||||||| ||| ||| |||||||||||||||||||| |||||||||
Sbjct: 108 gagctcgtccgccgcgtcggcaactccggtggccgcatcaccatgcgccgcaccgtcaag 167

                                                                       
Query: 161 agcgcgccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctcc 220
           ||||||||||| | ||||||||| || ||||||||| |||||||||||||||||||||| 
Sbjct: 168 agcgcgccccaaaacatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 227

                                                                       
Query: 221 gagcagaccccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcg 280
           || || || || ||||||||||||||  ||||||| || ||||||||||||||||| |||
Sbjct: 228 gaacaaacgccatcgtacctgaccggaaagttcccgggagactacgggtgggacacggcg 287

            
Query: 281 g 281
           |
Sbjct: 288 g 288



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  216 bits (109), Expect = 3e-53
 Identities = 136/145 (93%)
 Strand = Plus / Minus

                                                                         
Query: 41    atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
             |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 79852 atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 79793

                                                                         
Query: 101   gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
             || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 79792 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 79733

                                      
Query: 161   agcgcgccccagagcatctggtacg 185
             |||||||||||||||||||||||||
Sbjct: 79732 agcgcgccccagagcatctggtacg 79708



 Score =  127 bits (64), Expect = 2e-26
 Identities = 92/102 (90%)
 Strand = Plus / Minus

                                                                         
Query: 180   ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
             |||| || ||||||||| |||||||||||||||||||||| |||||||| || |||||||
Sbjct: 79624 ggtatggacctgaccgtcccaagtacctgggcccgttctcggagcagacgccatcgtacc 79565

                                                       
Query: 240   tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
             ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 79564 tgaccggagagttcccgggagactacgggtgggacacggcgg 79523



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  216 bits (109), Expect = 3e-53
 Identities = 136/145 (93%)
 Strand = Plus / Plus

                                                                            
Query: 41       atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
                |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 21807964 atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 21808023

                                                                            
Query: 101      gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
                || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 21808024 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 21808083

                                         
Query: 161      agcgcgccccagagcatctggtacg 185
                |||||||||||||||||||||||||
Sbjct: 21808084 agcgcgccccagagcatctggtacg 21808108



 Score =  127 bits (64), Expect = 2e-26
 Identities = 92/102 (90%)
 Strand = Plus / Plus

                                                                            
Query: 180      ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
                |||| || ||||||||| |||||||||||||||||||||| |||||||| || |||||||
Sbjct: 21808192 ggtatggacctgaccgtcccaagtacctgggcccgttctcggagcagacgccatcgtacc 21808251

                                                          
Query: 240      tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
                ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 21808252 tgaccggagagttcccgggagactacgggtgggacacggcgg 21808293



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  216 bits (109), Expect = 3e-53
 Identities = 136/145 (93%)
 Strand = Plus / Plus

                                                                            
Query: 41       atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 100
                |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 21800993 atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 21801052

                                                                            
Query: 101      gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 160
                || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 21801053 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 21801112

                                         
Query: 161      agcgcgccccagagcatctggtacg 185
                |||||||||||||||||||||||||
Sbjct: 21801113 agcgcgccccagagcatctggtacg 21801137



 Score =  127 bits (64), Expect = 2e-26
 Identities = 92/102 (90%)
 Strand = Plus / Plus

                                                                            
Query: 180      ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
                |||| || ||||||||| |||||||||||||||||||||| |||||||| || |||||||
Sbjct: 21801221 ggtatggacctgaccgtcccaagtacctgggcccgttctcggagcagacgccatcgtacc 21801280

                                                          
Query: 240      tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
                ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 21801281 tgaccggagagttcccgggagactacgggtgggacacggcgg 21801322



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  204 bits (103), Expect = 1e-49
 Identities = 140/153 (91%)
 Strand = Plus / Plus

                                                                       
Query: 127 cggcggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacgg 186
           |||||||||||||||||||||||| |||||||||||||  ||||||||||| ||||||||
Sbjct: 123 cggcggccgcatcaccatgcgccgcaccgtcaagagcgttccccagagcatatggtacgg 182

                                                                       
Query: 187 ncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccgg 246
            ||||| ||  ||||||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 183 ccctgatcgccccaagtatcttggcccgttctccgagcagacgccgtcgtacctgaccgg 242

                                            
Query: 247 ngagttccccggcgactacgggtgggacaccgc 279
            |||||||||||||||||||||||||| |||||
Sbjct: 243 cgagttccccggcgactacgggtgggagaccgc 275



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                   
Query: 41 atggccgcgtcggcgctgcaccagacgaccagcttcctcgg 81
          ||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 46 atggccgcgtcgcggctgcaccagaccaccagcttcctcgg 86



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score =  176 bits (89), Expect = 3e-41
 Identities = 123/135 (91%)
 Strand = Plus / Plus

                                                                       
Query: 142 catgcgccggaccgtcaagagcgcgccccagagcatctggtacggncctgaccgtgccaa 201
           |||||||||||| ||||||||||| ||||||||||||||||| || || |||||| ||||
Sbjct: 159 catgcgccggactgtcaagagcgctccccagagcatctggtatgggccagaccgtcccaa 218

                                                                       
Query: 202 gtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggcga 261
           |||  ||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 219 gtatttgggcccattctccgagcagaccccatcgtacctgaccggagagttccccggcga 278

                          
Query: 262 ctacgggtgggacac 276
           |||||| ||||||||
Sbjct: 279 ctacggatgggacac 293



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score =  121 bits (61), Expect = 1e-24
 Identities = 122/143 (85%)
 Strand = Plus / Plus

                                                                       
Query: 137 atcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncctgaccgt 196
           |||||||||||  | ||||||| |||||| ||  ||||||| ||||| || |||||||| 
Sbjct: 180 atcaccatgcgaagaaccgtcaggagcgcccctgagagcatttggtatggacctgaccgc 239

                                                                       
Query: 197 gccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttcccc 256
            |||||||||||||||| ||||| || ||||| |||||||| || ||||| || || |||
Sbjct: 240 cccaagtacctgggccccttctcggaacagacgccgtcgtatctcaccggcgaatttccc 299

                                  
Query: 257 ggcgactacgggtgggacaccgc 279
           |||||||||||||||||||||||
Sbjct: 300 ggcgactacgggtgggacaccgc 322



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score =  117 bits (59), Expect = 2e-23
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || ||||| | ||||||||||||||| ||||||| |||||| |||||||||
Sbjct: 178 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 237

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || | ||| |||||||||||||||||||| |||||||||||
Sbjct: 238 cttaacggcgagttccccggcgactacggctgggacaccgc 278



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  103 bits (52), Expect = 3e-19
 Identities = 72/79 (91%)
 Strand = Plus / Plus

                                                                       
Query: 198 ccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccg 257
           |||||| |||||| || ||||| |||||||| |||||||||||||| || ||||||||||
Sbjct: 900 ccaagttcctggggcccttctcggagcagacgccgtcgtacctgacgggcgagttccccg 959

                              
Query: 258 gcgactacgggtgggacac 276
           |||||||||||||||||||
Sbjct: 960 gcgactacgggtgggacac 978



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 104 ctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaagagc 163
           ||||||||||  ||||||| || || ||||||| || |||||||||| |||||||||  |
Sbjct: 722 ctcgtccgcaaggtcggcgtctccgacggccgcttctccatgcgccgcaccgtcaaggcc 781

                              
Query: 164 gcgccccagagcatctggt 182
           |  ||||||||||||||||
Sbjct: 782 gtcccccagagcatctggt 800



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  101 bits (51), Expect = 1e-18
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || ||||||| ||||||||| |||||||||||||   || |||| || |||
Sbjct: 202 tggtacggcccggaccgtgtcaagtacctcggcccgttctccggcgaggccccatcatac 261

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| || |||||||||||||||||||||||||||||
Sbjct: 262 ctcaccggcgaattccccggcgactacgggtgggacaccgc 302



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 178 ctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgta 237
           ||||||||| || ||||||| ||||||||| |||||||||||||   || | || || ||
Sbjct: 105 ctggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgaggcaccatcata 164

                                                     
Query: 238 cctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 165 cctcaccggtgagttccccggcgactacggctgggacaccgc 206



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 131 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncct 190
           ||||||||||||||| | || |||||||  || || ||  ||||||| |||||||| |||
Sbjct: 119 ggccgcatcaccatgaggcgtaccgtcagaagtgctccagagagcatatggtacggacct 178

                                                                       
Query: 191 gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
           |||||  | |||||| ||||||| ||||||||||| || || || ||||||||||| || 
Sbjct: 179 gaccgcccaaagtacttgggcccattctccgagcaaactccatcatacctgaccggtgaa 238

                                     
Query: 251 ttccccggcgactacgggtgggacac 276
           ||||| || ||||| |||||||||||
Sbjct: 239 ttccctggagactatgggtgggacac 264



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                       
Query: 155 gtcaagagcgcgccccagagcatctggtacggncctgaccgtgccaagtacctgggcccg 214
           ||||||||||| || || ||||| |||||||| ||||||||| |||||||  |||| || 
Sbjct: 196 gtcaagagcgcccctcaaagcatatggtacggtcctgaccgtcccaagtatttgggtccc 255

                                                                       
Query: 215 ttctccgagcagaccccgtcgtacctgaccggngagttccccggcgactacgggtgggac 274
           ||||| ||||||||||| || ||||| || || |||||||| || |||||||| ||||||
Sbjct: 256 ttctcagagcagaccccatcataccttactggagagttccctggtgactacggttgggac 315

             
Query: 275 ac 276
           ||
Sbjct: 316 ac 317



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 178 ctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgta 237
           ||||||||| || ||||| | ||||||||| |||||||||||||   || | ||||| ||
Sbjct: 541 ctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggcgaggcgccgtccta 600

                                                     
Query: 238 cctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||||||| |||||| ||||||||||||| |||||||||||
Sbjct: 601 cctgaccggcgagttcgccggcgactacggctgggacaccgc 642



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 178 ctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgta 237
           ||||||||| || ||||| | ||||||||||||||| ||   || | || ||||||| ||
Sbjct: 321 ctggtacggcccggaccgggtcaagtacctgggcccctttagcggggagtccccgtccta 380

                                                  
Query: 238 cctgaccggngagttccccggcgactacgggtgggacac 276
           ||||||||| ||||||||||| |||||||||||||||||
Sbjct: 381 cctgaccggcgagttccccggagactacgggtgggacac 419



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 190 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgg 235



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 197 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 256

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 257 gactacgggtgggacacggcgg 278



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 281 gactacgggtgggacacggcgg 302



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 281 gactacgggtgggacacggcgg 302



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 223 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 282

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 283 gactacgggtgggacacggcgg 304



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 228 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 287

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 288 gactacgggtgggacacggcgg 309



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 261 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 320

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 321 gactacgggtgggacacggcgg 342



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || || |||| ||||||||| |||||||||||||   || | || || |||
Sbjct: 186 tggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcaccatcatac 245

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| |||||||||||||||||||| |||||||||||
Sbjct: 246 ctcaccggtgagttccccggcgactacggctgggacaccgc 286



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || || |||| ||||||||| |||||||||||||   || | || || |||
Sbjct: 21  tggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcaccatcatac 80

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| |||||||||||||||||||| |||||||||||
Sbjct: 81  ctcaccggtgagttccccggcgactacggctgggacaccgc 121



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 180 ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
           |||| || ||||| ||| ||||||||||||| || ||||| |||||||  ||||| ||||
Sbjct: 461 ggtatggccctgatcgtcccaagtacctgggtccattctcagagcagattccgtcatacc 520

                                                
Query: 240 tgaccggngagttccccggcgactacgggtgggacac 276
           ||||||| || |||||||| |||||||| ||||||||
Sbjct: 521 tgaccggagaattccccggtgactacggatgggacac 557



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 134 cgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggta 183
           |||| |||||||||||| ||||||||||| || || |||||||| |||||
Sbjct: 335 cgcaccaccatgcgccgtaccgtcaagagtgctcctcagagcatttggta 384



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                            
Query: 200      aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
                ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 22434234 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 22434293

                                      
Query: 260      gactacgggtgggacaccgcgg 281
                ||||||||||||||||| ||||
Sbjct: 22434294 gactacgggtgggacacggcgg 22434315



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                              
Query: 236      tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
                ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 23603733 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgg 23603778



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                                  
Query: 230      ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
                ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 30024533 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 30024582



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                         
Query: 200   aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
             ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 95301 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 95360

                                   
Query: 260   gactacgggtgggacaccgcgg 281
             ||||||||||||||||| ||||
Sbjct: 95361 gactacgggtgggacacggcgg 95382



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                           
Query: 236   tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
             ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 66432 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgg 66477



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 261 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgg 306



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 260 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgg 305



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 690 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgg 735



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 197 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 256

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 257 gactacgggtgggacacggcgg 278



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 281 gactacgggtgggacacggcgg 302



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 281 gactacgggtgggacacggcgg 302



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 286 gactacgggtgggacacggcgg 307



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 222 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 281

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 282 gactacgggtgggacacggcgg 303



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 228 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 287

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||||||||||||||| ||||
Sbjct: 288 gactacgggtgggacacggcgg 309



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 112/136 (82%)
 Strand = Plus / Plus

                                                                       
Query: 141 ccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncctgaccgtgcca 200
           |||||||||| || ||||||||||| || || ||||| ||||| || ||||||||| |||
Sbjct: 273 ccatgcgccgcacagtcaagagcgctcctcaaagcatttggtatggtcctgaccgtccca 332

                                                                       
Query: 201 agtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggcg 260
           ||||  ||||||| ||||| || |||||||| || ||||| || || || ||||| || |
Sbjct: 333 agtatttgggccccttctcagaacagaccccatcataccttacaggagaattccctggtg 392

                           
Query: 261 actacgggtgggacac 276
           |||| || ||||||||
Sbjct: 393 actatggttgggacac 408



to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 115/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 atcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncctgaccgt 196
           |||||||||||  | ||||| | |||||| ||| ||||||| ||||| || |||||||| 
Sbjct: 155 atcaccatgcgaagaaccgtaaggagcgcccccgagagcatttggtatggacctgaccgc 214

                                                                       
Query: 197 gccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttcccc 256
            |||||||||| ||||| ||||| ||   ||| ||||| || || ||||| || || |||
Sbjct: 215 cccaagtacctaggccccttctcggaagggacgccgtcatatctcaccggagaatttccc 274

                               
Query: 257 ggcgactacgggtgggacac 276
           ||||||||||||||||||||
Sbjct: 275 ggcgactacgggtgggacac 294



to top

>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein
           (CipLhcb2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1033

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 111/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 142 catgcgccggaccgtcaagagcgcgccccagagcatctggtacggncctgaccgtgccaa 201
           ||||||||| |||||||| || || || |||||||| ||||| || ||||||||| ||||
Sbjct: 164 catgcgccgcaccgtcaaaagtgctcctcagagcatttggtatggccctgaccgtcccaa 223

                                                                       
Query: 202 gtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggcga 261
           |||| |||| || || || || ||||  || || ||||||||||| || ||||| || ||
Sbjct: 224 gtacttgggtccattttctgaccagattccatcatacctgaccggtgaattccctggtga 283

                          
Query: 262 ctacgggtgggacac 276
           |||||| ||||||||
Sbjct: 284 ctacggatgggacac 298



to top

>dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M27
          Length = 687

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 182 tacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctg 241
           ||||| || ||||| |||||||  |||||||| ||||| ||  | |||||||||||||||
Sbjct: 119 tacggccccgaccgcgccaagtggctgggccccttctcggatgacaccccgtcgtacctg 178

                                              
Query: 242 accggngagttccccggcgactacgggtgggacac 276
           ||||| ||||| || ||||||||||| ||||||||
Sbjct: 179 accggcgagtttccgggcgactacggctgggacac 213



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                       
Query: 236  tacctgaccggngagttccccggcgactacgggtgggacaccg 278
            ||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2125 tacctgaccggcgagttccccggcgactacgggtgggacaccg 2167



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                        
Query: 178  ctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgta 237
            ||||||||| || ||||| | ||||||||| ||||| |||||||   || |||||   ||
Sbjct: 1026 ctggtacggccccgaccgcgtcaagtacctcggccccttctccggcgagcccccgagcta 1085

                                                      
Query: 238  cctgaccggngagttccccggcgactacgggtgggacaccgc 279
            ||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 1086 cctcaccggcgagttccccggcgactacggctgggacaccgc 1127



to top

>dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M26
          Length = 476

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                          
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 247 ccgtcgtacctgaccggcgagttccccggcgactacggctgggacac 293



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 651 tacctcaccggcgagttccccggcgactacgggtgggacaccgcgg 696



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 268 tacctcaccggcgagttccccggcgactacgggtgggacaccgcgg 313



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 91/109 (83%)
 Strand = Plus / Plus

                                                                       
Query: 171 agagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccc 230
           ||||||| ||||| || ||||| ||  |||||||||||||||| || || || ||||| |
Sbjct: 46  agagcatttggtatggacctgatcgccccaagtacctgggccccttttcggaacagacgc 105

                                                            
Query: 231 cgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||||| || ||||| || || ||||| || |||||||||||||||||
Sbjct: 106 cgtcgtatctcaccggagaatttcccggggattacgggtgggacaccgc 154



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           ||||||||||| || ||||| | |||||| |||||||||||||  || |||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                 
Query: 260 gactacgggtgggacaccgcgg 281
           ||||| ||||||||||| ||||
Sbjct: 286 gactatgggtgggacacggcgg 307



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| |||||||||| ||||||||| ||||| |||||||   || | || || |||
Sbjct: 192 tggtacggccctgaccgtgtcaagtacctaggcccattctccggcgaggctccatcatac 251

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || ||||| || |||||||| |||||||||||
Sbjct: 252 ctgaccggtgaattcccaggtgactacggctgggacaccgc 292



to top

>ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll binding AT2G05100
           (LHCB2.1) mRNA, complete cds
          Length = 1068

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 200 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 259

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 260 tcctacctaaccggagaataccccggagactacggctgggacaccgc 306



to top

>gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 1001

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 198 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 257

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 258 tcctacctaaccggagaataccccggagactacggctgggacaccgc 304



to top

>gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 943

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 193 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 252

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 253 tcctacctaaccggagaataccccggagactacggctgggacaccgc 299



to top

>emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS37ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 980

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 178 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 237

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 238 tcctacctaaccggagaataccccggagactacggctgggacaccgc 284



to top

>emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS18ZH11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 912

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 161 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 220

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 221 tcctacctaaccggagaataccccggagactacggctgggacaccgc 267



to top

>emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL79ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 859

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 176 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 235

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 236 tcctacctaaccggagaataccccggagactacggctgggacaccgc 282



to top

>emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL18ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 941

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 176 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 235

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 236 tcctacctaaccggagaataccccggagactacggctgggacaccgc 282



to top

>emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZD09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 964

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 190 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 249

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 250 tcctacctaaccggagaataccccggagactacggctgggacaccgc 296



to top

>emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 914

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 159 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 218

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 219 tcctacctaaccggagaataccccggagactacggctgggacaccgc 265



to top

>emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 917

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 161 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 220

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 221 tcctacctaaccggagaataccccggagactacggctgggacaccgc 267



to top

>emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 922

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 161 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 220

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 221 tcctacctaaccggagaataccccggagactacggctgggacaccgc 267



to top

>emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS22ZD11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 181 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 240

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 241 tcctacctaaccggagaataccccggagactacggctgggacaccgc 287



to top

>gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA, complete cds
          Length = 967

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 188 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 247

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 248 tcctacctaaccggagaataccccggagactacggctgggacaccgc 294



to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           ||||| |||||||| || |||||| |||||||| |||| || ||||| ||| | || |||
Sbjct: 197 agcatttggtacggaccagaccgtcccaagtacttgggaccattctcggagaacacaccg 256

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 257 tcctacctaaccggagaataccccggagactacggctgggacaccgc 303



to top

>gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlorophyll a/b binding
           protein (At2g05100) mRNA, complete cds
          Length = 829

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           |||||||||||||| || |||||| |||||||| | || || ||||| ||| | || |||
Sbjct: 139 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 198

                                                          
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||| || | |||||| |||||||| |||||||||||
Sbjct: 199 tcctacctaaccggagaataccccggagactacggctgggacaccgc 245



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                       
Query: 178 ctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgta 237
           ||||||||| || ||| | | ||||||||| ||||| |||||||   || |||| || ||
Sbjct: 55  ctggtacggccccgacagagtcaagtacctcggccccttctccggcgaggccccctcata 114

                                                     
Query: 238 cctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||| ||||| |||||| ||||||||||||| |||||||||||
Sbjct: 115 cctcaccggcgagttcgccggcgactacggctgggacaccgc 156



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || ||||| | ||||||| ||||||| ||||| |   || ||||||| |||
Sbjct: 389 tggtacggcccagaccgagtcaagtacttgggcccattctctggcgagcccccgtcctac 448

                                                 
Query: 239 ctgaccggngagttccccggcgactacgggtgggacac 276
           || ||||| |||||||| ||||||||||| ||||||||
Sbjct: 449 ctaaccggtgagttcccaggcgactacggctgggacac 486



to top

>gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1105

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 203 tacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggcgac 262
           |||||||| || ||||| | ||| || |||||||||||||  || |||||||| ||||||
Sbjct: 205 tacctggggccattctcggcgcaaacgccgtcgtacctgaggggcgagttcccgggcgac 264

                              
Query: 263 tacgggtgggacaccgcgg 281
           |||||||||||||| ||||
Sbjct: 265 tacgggtgggacacggcgg 283



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 179   tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
             |||||||| || ||||| | ||| ||| ||||||| |||||||   || ||||||| |||
Sbjct: 66212 tggtacggcccagaccgcgtcaaatacttgggcccattctccggtgagcccccgtcctac 66153

                                                   
Query: 239   ctgaccggngagttccccggcgactacgggtgggacac 276
              ||||||| ||||||||||| |||||||| ||||||||
Sbjct: 66152 ttgaccggtgagttccccggtgactacggctgggacac 66115



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 196 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 245



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 234 cgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 203 cgtacctgactggcgagttccccggcgactacggctgggacaccgc 248



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 230   ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
             ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 14478 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 14429



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                              
Query: 236      tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
                ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 10793186 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 10793231



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                               
Query: 230   ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
             ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 20523 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 20572



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                           
Query: 236   tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
             ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 16909 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 16954



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                            
Query: 236    tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
              ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 129804 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 129849



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 254 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 299



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 259 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 304



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 261 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 306



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 277 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 326



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 277 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 326



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 279 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 328



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 259 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 304



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 259 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 304



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 279 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgc 328



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 234  cgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
            |||||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 978  cgtacctgactggcgagttccccggcgactacggctgggacaccgc 1023



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 240 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcgg 285



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 173 agcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccg 232
           ||||||||||| || || |||||| |||||||| | ||||| ||||| ||||| ||||| 
Sbjct: 163 agcatctggtatggtccagaccgtcccaagtacttaggccccttctcagagcaaacccca 222

                                                       
Query: 233 tcgtacctgaccggngagttccccggcgactacgggtgggacac 276
           || ||||| || || || |||||||| || ||||| ||||||||
Sbjct: 223 tcataccttacaggtgaattccccggtgattacggttgggacac 266



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 137 atcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncctgaccgt 196
           |||||||||||  | ||||| | ||| || ||| ||||||| ||||| || || ||||| 
Sbjct: 46  atcaccatgcgtagaaccgtaaggagtgcccccgagagcatttggtatggacccgaccgc 105

                                                                       
Query: 197 gccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttcccc 256
            |||||||||| ||||| ||||| || ||||| || ||||| || || || || || |||
Sbjct: 106 cccaagtacctcggccccttctcggaacagacgccctcgtatctcacgggagaatttccc 165

                               
Query: 257 ggcgactacgggtgggacac 276
           || |||||||||||||||||
Sbjct: 166 ggagactacgggtgggacac 185



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 190 tacctgaccggcgagttccccggtgactacggctgggacaccgc 233



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 297 ccgtcatacctgaccggtgaattccccggtgactacgggtgggacacggcgg 348



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 178 tacctgactggcgagttccccggcgactacggctgggacaccgc 221



to top

>emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyll a/b-binding protein,
            partial
          Length = 2036

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                        
Query: 200  aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
            |||||||| || ||||| ||||  || |||||||| ||||| ||||| ||||| ||||||
Sbjct: 1532 aagtacctaggaccgttttccgtccaaaccccgtcttacctcaccggagagtttcccggc 1591

                                
Query: 260  gactacgggtgggacaccgc 279
            ||||| || |||||||||||
Sbjct: 1592 gactatggttgggacaccgc 1611



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||| ||||||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 290 ccgtcatacctgaccggtgaattccccggtgactacgggtgggacacggcgg 341



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 194 tacctgactggcgagttccccggcgactacggctgggacaccgc 237



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 224 tacctgactggcgagttccccggcgactacggctgggacaccgc 267



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1508

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 642 tacctgactggcgagttccccggcgactacggctgggacaccgc 685



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 852 tacctgactggcgagttccccggcgactacggctgggacaccgc 895



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                        
Query: 182  tacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctg 241
            ||||| || ||||| |||||||  ||||| || ||||||||  | ||||| || ||||| 
Sbjct: 1093 tacggccccgaccgcgccaagtggctgggacccttctccgatgacaccccctcctacctc 1152

                                                  
Query: 242  accggngagttccccggcgactacgggtgggacaccgc 279
            || || ||||||||||| |||||||| |||||||||||
Sbjct: 1153 actggcgagttccccggtgactacggctgggacaccgc 1190



to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 193 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 252

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 253 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 305



to top

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 119/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 131 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncct 190
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 155 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 214

                                                                       
Query: 191 gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
           |||||| |||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 215 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 274

                                        
Query: 251 ttccccggcgactacgggtgggacaccgc 279
           | ||| || |||||||| |||||||||||
Sbjct: 275 taccctggagactacggttgggacaccgc 303



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 179  tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
            ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 3102 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 3043

                                                     
Query: 239  ctgaccggngagttccccggcgactacgggtgggacaccgc 279
            || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 3042 cttaccggtgagttccccggtgactacggatgggacaccgc 3002



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 179  tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
            ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 3141 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 3082

                                                     
Query: 239  ctgaccggngagttccccggcgactacgggtgggacaccgc 279
            || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 3081 cttaccggtgagttccccggtgactacggatgggacaccgc 3041



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 197 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 256

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 257 cttaccggtgagttccccggtgactacggatgggacaccgc 297



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 197 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 256

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 257 cttaccggtgagttccccggtgactacggatgggacaccgc 297



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 236  tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
            |||||||| || |||||||| ||||||||||| |||||||||||||
Sbjct: 1214 tacctgacgggcgagttcccgggcgactacggctgggacaccgcgg 1259



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 180  ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
            |||| || ||||||||  |||||||||| ||||| ||||| ||   ||| ||||| || |
Sbjct: 2417 ggtatggacctgaccgccccaagtacctaggccccttctcggaagggacgccgtcatatc 2476

                                                 
Query: 240  tgaccggngagttccccggcgactacgggtgggacac 276
            | ||||| || || |||||||||||||||||||||||
Sbjct: 2477 tcaccggagaatttcccggcgactacgggtgggacac 2513



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 142 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 201

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 202 cttaccggtgagttccccggtgactacggatgggacaccgc 242



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 197 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 256

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 257 cttaccggtgagttccccggtgactacggatgggacaccgc 297



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 296 tgaccggtgagttccccggtgactacgggtgggacacggcgg 337



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcgg 267



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcgg 267



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcgg 267



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcgg 267



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcgg 267



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcgg 267



to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 133 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 192

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 193 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 245



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                         
Query: 179   tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
             ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 93859 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 93800

                                                      
Query: 239   ctgaccggngagttccccggcgactacgggtgggacaccgc 279
             || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 93799 cttaccggtgagttccccggtgactacggatgggacaccgc 93759



 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 236   tacctgaccggngagttccccggcgactacgggtgggacac 276
             ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 95506 tacctcactggagagttccccggtgattacgggtgggacac 95546



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                         
Query: 179   tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
             ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 80343 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 80402

                                                      
Query: 239   ctgaccggngagttccccggcgactacgggtgggacaccgc 279
             || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 80403 cttaccggtgagttccccggtgactacggatgggacaccgc 80443



 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 236   tacctgaccggngagttccccggcgactacgggtgggacac 276
             ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 78696 tacctcactggagagttccccggtgattacgggtgggacac 78656



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 142 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 201

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 202 cttaccggtgagttccccggtgactacggatgggacaccgc 242



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 142 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 201

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 202 cttaccggtgagttccccggtgactacggatgggacaccgc 242



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 142 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 201

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 202 cttaccggtgagttccccggtgactacggatgggacaccgc 242



to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 133 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 192

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 193 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 245



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 193 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 252

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 253 cttaccggtgagttccccggtgactacggatgggacaccgc 293



to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 193 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 252

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 253 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 305



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 193 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 252

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 253 cttaccggtgagttccccggtgactacggatgggacaccgc 293



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 193 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 252

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 253 cttaccggtgagttccccggtgactacggatgggacaccgc 293



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 193 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 252

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 253 cttaccggtgagttccccggtgactacggatgggacaccgc 293



to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 191 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 250

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 251 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 303



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 272 tgaccggtgagttccccggtgactacgggtgggacacggcgg 313



to top

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 119/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 131 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncct 190
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 100 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 159

                                                                       
Query: 191 gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
           |||||| |||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 160 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 219

                                        
Query: 251 ttccccggcgactacgggtgggacaccgc 279
           | ||| || |||||||| |||||||||||
Sbjct: 220 taccctggagactacggttgggacaccgc 248



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 193 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 252

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 253 cttaccggtgagttccccggtgactacggatgggacaccgc 293



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 193 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 252

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 253 cttaccggtgagttccccggtgactacggatgggacaccgc 293



to top

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 119/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 131 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncct 190
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 149 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 208

                                                                       
Query: 191 gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
           |||||| |||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 209 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 268

                                        
Query: 251 ttccccggcgactacgggtgggacaccgc 279
           | ||| || |||||||| |||||||||||
Sbjct: 269 taccctggagactacggttgggacaccgc 297



to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 174 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 233

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 234 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 286



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 184 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 243

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 244 cttaccggtgagttccccggtgactacggatgggacaccgc 284



to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 182 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 241

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 242 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 294



to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 176 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 235

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 236 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 288



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 174 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 233

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 234 cttaccggtgagttccccggtgactacggatgggacaccgc 274



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 177 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 236

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 237 cttaccggtgagttccccggtgactacggatgggacaccgc 277



to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 181 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 240

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 241 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 293



to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 169 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 228

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 229 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 281



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 742 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 683

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 682 cttaccggtgagttccccggtgactacggatgggacaccgc 642



to top

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 119/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 128 ggcggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggn 187
           |||||||||||||||||| | || |||||||| ||| | ||||| ||||| ||||| || 
Sbjct: 94  ggcggccgcatcaccatgaggcgcaccgtcaaaagcaccccccaaagcatatggtatggc 153

                                                                       
Query: 188 cctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggn 247
           || |||||  | || ||| |||| || ||||| ||||| || || || ||| |||| || 
Sbjct: 154 ccagaccgcccaaaatacttgggaccattctctgagcaaactccatcatacttgactggt 213

                                        
Query: 248 gagttccccggcgactacgggtgggacac 276
           || ||||| || |||||||| ||||||||
Sbjct: 214 gaattccctggtgactacggatgggacac 242



to top

>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds
          Length = 897

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 119/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 131 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggncct 190
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 105 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 164

                                                                       
Query: 191 gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
           |||||| |||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 165 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 224

                                        
Query: 251 ttccccggcgactacgggtgggacaccgc 279
           | ||| || |||||||| |||||||||||
Sbjct: 225 taccctggagactacggttgggacaccgc 253



to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||||||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 183 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 242

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 243 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 295



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           |||||||| || |||||||| ||||||||||| |||||||||||||
Sbjct: 266 tacctgacgggcgagttcccgggcgactacggctgggacaccgcgg 311



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||||||  ||||||| | ||||||| |||| || |||||||   || |||||   |||
Sbjct: 442 tggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccccgagctac 501

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 502 cttaccggtgagttccccggtgactacggatgggacaccgc 542



to top

>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein
          Length = 1067

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 234 cgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||||||| ||| ||||||||||| |||||||| |||||||||||
Sbjct: 177 cgtacctgaacggcgagttccccggtgactacggctgggacaccgc 222



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 240  tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
            ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 1374 tgaccggtgagttccccggtgactacgggtgggacacggcgg 1415



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| ||||||||||| ||||||||||||||||| ||||
Sbjct: 281 tgaccggtgagttccccggtgactacgggtgggacacggcgg 322



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           |||||||| || |||||||| ||||||||||| |||||||||||||
Sbjct: 214 tacctgacgggcgagttcccgggcgactacggctgggacaccgcgg 259



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 236  tacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
            |||||||| || |||||||| ||||||||||| |||||||||||||
Sbjct: 1214 tacctgacgggcgagttcccgggcgactacggctgggacaccgcgg 1259



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| |||||| ||||||||||||| |||||||||||
Sbjct: 238 ccgtcctacctcaccggcgagttctccggcgactacggctgggacaccgc 287



to top

>gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence
          Length = 1047

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                       
Query: 180 ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
           ||||||| || |||||| |||||||| | || || ||||| ||| | || ||||| ||||
Sbjct: 292 ggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccgtcctacc 351

                                                   
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgc 279
           | ||||| || | |||||| |||||||| |||||||||||
Sbjct: 352 taaccggagaataccccggagactacggctgggacaccgc 391



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           |||||||| || |||||||||||||||||||| ||||||||
Sbjct: 197 tacctgactggcgagttccccggcgactacggctgggacac 237



to top

>gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 map ve013, complete
            sequence
          Length = 13145

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                        
Query: 180  ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
            ||||||| || |||||| |||||||| | || || ||||| ||| | || ||||| ||||
Sbjct: 5655 ggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccgtcctacc 5596

                                                    
Query: 240  tgaccggngagttccccggcgactacgggtgggacaccgc 279
            | ||||| || | |||||| |||||||| |||||||||||
Sbjct: 5595 taaccggagaataccccggagactacggctgggacaccgc 5556



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                        
Query: 207  tgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggcgactacg 266
            ||||||| |||||||   ||||||| |||||||||| ||| |||||| | || |||||||
Sbjct: 1227 tgggccctttctccggtgagaccccctcgtacctgaacggtgagttcgctggagactacg 1286

                         
Query: 267  ggtgggacaccgc 279
            | |||||||||||
Sbjct: 1287 gctgggacaccgc 1299



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 200 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggc 259
           |||||| |||| || ||||||||||| || || |||||| |||| || |||||||| || 
Sbjct: 900 aagtacttgggaccattctccgagcaaactccatcgtacttgactggtgagttcccaggt 959

                            
Query: 260 gactacgggtgggacac 276
           || ||||||||||||||
Sbjct: 960 gattacgggtgggacac 976



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 204 tacctgaccggcgagttccccggtgactacggctgggacac 244



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           |||||||| || |||||||||||||||||||| ||||||||
Sbjct: 202 tacctgactggcgagttccccggcgactacggctgggacac 242



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 214 tacctgaccggtgagttccctggcgactatgggtgggacac 254



to top

>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds
          Length = 2544

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                        
Query: 207  tgggcccgttctccgagcagaccccgtcgtacctgaccggngagttccccggcgactacg 266
            ||||||| |||||||   |||||||||| || ||||  || |||||| ||||||||||||
Sbjct: 1818 tgggcccattctccggcgagaccccgtcatatctgaatggcgagttcgccggcgactacg 1877

                         
Query: 267  ggtgggacaccgc 279
            | |||||||||||
Sbjct: 1878 gatgggacaccgc 1890



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgc 314



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 258 taccttaccggagagttccccggagactacggatgggacaccgc 301



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 163 taccttaccggagagttccccggagactacggatgggacaccgc 206



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 198 tacctgactggcgagttccccggtgactacggctgggacaccgc 241



to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 236  tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
            ||||||||||| ||| | |||||||||||||| |||||||||||
Sbjct: 4430 tacctgaccggtgagctgcccggcgactacggctgggacaccgc 4473



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 236  tacctgaccggngagttccccggcgactacgggtgggacac 276
            ||||||||||| ||| | |||||||||||||| ||||||||
Sbjct: 987  tacctgaccggtgagctgcccggcgactacggctgggacac 1027



 Score = 44.1 bits (22), Expect = 0.25
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 254  cccggcgactacgggtgggacaccgc 279
            |||||||||||||| |||||||||||
Sbjct: 5744 cccggcgactacggctgggacaccgc 5769



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || |||||||||||||||||||| |||||| ||||
Sbjct: 247 tacctgactggcgagttccccggcgactacggctgggactccgc 290



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 205 taccttaccggagagttccccggagactacggatgggacaccgc 248



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgc 314



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 224 tacctgactggcgagttccccggtgactacggctgggacaccgc 181



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 196 tacctgactggcgagttccccggtgactacggctgggacaccgc 239



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 205 taccttaccggagagttccccggagactacggatgggacaccgc 248



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 258 taccttaccggagagttccccggagactacggatgggacaccgc 301



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgc 314



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgc 314



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgc 314



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 19  tacctcaccggagagttccccggagactacggatgggacaccgc 62



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 219 taccttaccggtgagttccccggtgactacggatgggacaccgc 176



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 240 taccttaccggagagttccccggagactacggatgggacaccgc 283



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 255 taccttaccggagagttccccggagactacggatgggacaccgc 298



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 229 taccttaccggtgagttccccggtgactacggatgggacaccgc 272



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 234 taccttaccggtgagttccccggtgactacggatgggacaccgc 277



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 151 taccttaccggagagttccccggagactacggatgggacaccgc 194



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 236   tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
             ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 21943 taccttaccggagagttccccggagactacggatgggacaccgc 21986



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 236   tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
             ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 16710 taccttaccggagagttccccggagactacggatgggacaccgc 16667



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 422 taccttaccggagagttccccggagactacggatgggacaccgc 465



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| |||||||| |||||||||||
Sbjct: 411 taccttaccggagagttccccggagactacggatgggacaccgc 454



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||||||| ||||| || ||||| || ||||||||||||||||| ||||
Sbjct: 236 ccgtcgtacctaaccggtgaattcccgggtgactacgggtgggacacggcgg 287



to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%), Gaps = 3/101 (2%)
 Strand = Plus / Plus

                                                                       
Query: 182 tacggncctgaccgtgccaagtacctgggcccgttctccgagcag---accccgtcgtac 238
           ||||| |||||||| ||||||| ||||||||| ||||||||| |    |||||   ||||
Sbjct: 145 tacggccctgaccgcgccaagttcctgggccccttctccgagaacgacacccctgagtac 204

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || || || ||||||||||| |||||||| ||||| |||||
Sbjct: 205 ctcactggcgagttccccggtgactacggctgggataccgc 245



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 182 tacctgactggcgagttccccggtgactacggctgggacaccgc 225



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| |||||||| |  |||||| |||| || |||||||   || |||||   |||
Sbjct: 37  tggtacggccctgaccgcgttaagtacttggggccattctccggtgagtccccgagctac 96

                                                 
Query: 239 ctgaccggngagttccccggcgactacgggtgggacac 276
            ||||||| ||||||||||| |||||||| ||||||||
Sbjct: 97  ttgaccggtgagttccccggtgactacggctgggacac 134



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                        
Query: 179  tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
            |||||||| || |||||||  |||||| | ||||| |||||||   || | ||||| |||
Sbjct: 1464 tggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctccgtcctac 1523

                                                  
Query: 239  ctgaccggngagttccccggcgactacgggtgggacac 276
             |||| || ||||||||||| |||||||| ||||||||
Sbjct: 1524 ttgactggagagttccccggtgactacggttgggacac 1561



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 249 agttccccggcgactacgggtgggacaccgc 279
           ||||||||||||||||||| |||||||||||
Sbjct: 205 agttccccggcgactacggctgggacaccgc 235



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 223 tgaccggtgagttcccaggtgactacgggtgggacacggcgg 264



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 267



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacagcgg 267



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 215 tgaccggtgagttcccgggtgactacgggtgggacacwgcgg 256



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacactgcgg 267



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacactgcgg 267



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 267



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 267



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 267



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 267



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 267



to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccccagagcatctggtacggncctgaccgtgccaagtacctgggcccgttctccgagcag 226
           ||||| ||||||| ||| || || |||||| |||||||| |||| || ||||| ||| | 
Sbjct: 164 ccccaaagcatcttgtatggaccagaccgtcccaagtacttgggaccattctcggagaac 223

                                                                
Query: 227 accccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           || ||||| ||| | || || || | |||||| |||||||| |||||||||||
Sbjct: 224 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgc 276



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| |||||||||| ||||||| ||||||| |||||||   |  ||||    |||
Sbjct: 381 tggtacggtcctgaccgtgtcaagtacttgggcccattctccggtgaagccccaagctac 440

                                                    
Query: 239 ctgaccggngagttccccggcgactacgggtgggacaccgc 279
            ||||||| |||||||| || ||||| || |||||||||||
Sbjct: 441 ttgaccggtgagttccctggtgactatggttgggacaccgc 481



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 260 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 301



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgcgg 281
           ||||||| |||||||| || ||||||||||||||||| ||||
Sbjct: 257 tgaccggtgagttcccgggtgactacgggtgggacacggcgg 298



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| ||||| ||||||||||| |||||||| ||||||||
Sbjct: 671 taccttaccggagagttccccggagactacggatgggacac 631



to top

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 240 tgaccggngagttccccggcgactacgggtgggacac 276
           ||||||| |||||||| ||||||||||| ||||||||
Sbjct: 203 tgaccggtgagttccctggcgactacggttgggacac 239



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| ||||| || |||||||| |||||||||||||||||
Sbjct: 223 tacctcaccggtgatttccccggtgactacgggtgggacac 263



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||||||||| | ||||||||| |||||||| ||||||||
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacac 73



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||||||||| ||||| || |||||||||||
Sbjct: 33  taccttaccggagagttccccggtgactatggatgggacaccgc 76



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| |||||  |||||||||| |||||||| |||||||||||
Sbjct: 277 taccttaccggacagttccccggagactacggatgggacaccgc 320



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| || || ||||||||||| |||||||| |||||||||||
Sbjct: 244 tacctcacaggagagttccccggtgactacggatgggacaccgc 287



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||| || ||||||||||| ||||| ||||||||||||||
Sbjct: 204 tgactggtgagttccccggtgactatgggtgggacaccgc 243



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 240 tgaccggngagttccccggcgactacgggtgggacaccgc 279
           |||| || ||||||||||| ||||| ||||||||||||||
Sbjct: 409 tgactggtgagttccccggtgactatgggtgggacaccgc 448



to top

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/44 (90%), Gaps = 1/44 (2%)
 Strand = Plus / Plus

                                                       
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 216 tacctgaccggtgaattccc-ggtgactacgggtgggacaccgc 258



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || |||||||  |||||| | ||||| |||||||   || | || || |||
Sbjct: 148 tggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctccatcctac 207

                                                 
Query: 239 ctgaccggngagttccccggcgactacgggtgggacac 276
            |||| || ||||||||||| |||||||| ||||||||
Sbjct: 208 ttgactggagagttccccggtgactacggttgggacac 245



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                       
Query: 180 ggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacc 239
           |||| || ||||||||  | |||||| |||| || ||||| || || | ||| || ||||
Sbjct: 689 ggtatggccctgaccgcccaaagtacttgggtccattctctgaccaaatcccatcatacc 748

                                             
Query: 240 tgaccggngagttccccggcgactacgggtggga 273
           ||||||| || ||||| || ||||||||||||||
Sbjct: 749 tgaccggtgaattccctggggactacgggtggga 782



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || |||||||  |||||||||||||| ||||| |   || | || || |||
Sbjct: 198 tggtacggcccagaccgtgtgaagtacctgggcccattctcgggtgaggctccttcttac 257

                                                 
Query: 239 ctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||| || ||||| |||||||||||
Sbjct: 258 ctgacgggggaattcccaggtgactatgggtgggacac 295



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           ||||| || |||||||||| ||||||| ||||||| ||||| |   || ||||    |||
Sbjct: 214 tggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtccccaagctac 273

                                                 
Query: 239 ctgaccggngagttccccggcgactacgggtgggacac 276
            |||| || |||||||| || |||||||||||||||||
Sbjct: 274 ttgactggtgagttccctggtgactacgggtgggacac 311



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                       
Query: 179 tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
           |||||||| || |||||||  |||||| | ||||| |||||||   || | || || |||
Sbjct: 866 tggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctccatcctac 925

                                                 
Query: 239 ctgaccggngagttccccggcgactacgggtgggacac 276
            |||| || ||||||||||| |||||||| ||||||||
Sbjct: 926 ttgacaggagagttccccggtgactacggttgggacac 963



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                        
Query: 179  tggtacggncctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtac 238
            |||||||| || |||||||  |||||| | ||||| |||||||   || | || || |||
Sbjct: 1167 tggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctccatcctac 1226

                                                  
Query: 239  ctgaccggngagttccccggcgactacgggtgggacac 276
             |||| || ||||||||||| |||||||| ||||||||
Sbjct: 1227 ttgactggagagttccccggtgactacggttgggacac 1264



to top

>gb|DQ226734.1| Boechera divaricarpa isolate SLW-A-E08 mRNA sequence
          Length = 399

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 230 ccgtcgtacctgaccggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||| ||||| || || ||||||||||| || |||||||||||
Sbjct: 373 ccgtcttacctcaccggagaatttcccggcgactatggttgggacaccgc 324



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 240 tgaccggngagttccccggcgactacgggtggga 273
           ||||||| |||||||| || ||||||||||||||
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtggga 259



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 255 ccggcgactacgggtgggacaccgcgg 281
           |||||||||||||||||||||| ||||
Sbjct: 1   ccggcgactacgggtgggacacggcgg 27



to top

>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds
          Length = 1240

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 242 accggngagttccccggcgactacgggtgggacaccgc 279
           ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 399 accggcgagttccccggtgactacggctgggataccgc 436



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 264 tacctcactggagagttccccggtgattacgggtgggacac 304



to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                        
Query: 191  gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
            |||||| |||||||| |||| || ||||| ||| | || ||||| ||| | || || || 
Sbjct: 1923 gaccgtcccaagtacttgggaccattctcggagaacacaccgtcttacttaactggagaa 1864

                                         
Query: 251  ttccccggcgactacgggtgggacaccgc 279
            | |||||| |||||||| |||||||||||
Sbjct: 1863 taccccggagactacggctgggacaccgc 1835



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| |||||||| ||||||||
Sbjct: 33  tacctcacaggagagttccccggagactacggatgggacac 73



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 202 tacctcactggagagttccccggtgattacgggtgggacac 242



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 264 tacctcactggagagttccccggtgattacgggtgggacac 304



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 264 tacctcactggagagttccccggtgattacgggtgggacac 304



to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                         
Query: 191   gaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggngag 250
             |||||| |||||||| |||| || ||||| ||| | || ||||| ||| | || || || 
Sbjct: 81646 gaccgtcccaagtacttgggaccattctcggagaacacaccgtcttacttaactggagaa 81587

                                          
Query: 251   ttccccggcgactacgggtgggacaccgc 279
             | |||||| |||||||| |||||||||||
Sbjct: 81586 taccccggagactacggctgggacaccgc 81558



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 264 tacctcactggagagttccccggtgattacgggtgggacac 304



to top

>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence
          Length = 917

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 119/152 (78%)
 Strand = Plus / Plus

                                                                       
Query: 128 ggcggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggn 187
           ||||||||| | | ||||||||| |||||||||    | || |||||||||||||| || 
Sbjct: 146 ggcggccgcgttatcatgcgccgtaccgtcaagtctacccctcagagcatctggtatgga 205

                                                                       
Query: 188 cctgaccgtgccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggn 247
           || |||||| |||| ||||| || || ||||| ||  | || || || ||||| || || 
Sbjct: 206 ccagaccgtcccaaatacctaggaccattctcggaaaacacaccatcatacctaactgga 265

                                           
Query: 248 gagttccccggcgactacgggtgggacaccgc 279
           || | ||| || |||||||| |||||||||||
Sbjct: 266 gaataccctggagactacggctgggacaccgc 297



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 236 tacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||| || || ||||||||||| || ||||||||||||||
Sbjct: 264 tacctcactggagagttccccggtgattacgggtgggacac 304



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 228 ccccgtcgtacctgaccggngagttccccggcgactacgggtgggacac 276
           ||||||||||| |||| || |||||||| || ||||| || ||||||||
Sbjct: 211 ccccgtcgtacttgactggagagttcccaggtgactatggttgggacac 259



to top

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 127 cggcggccgcatcaccatgcgc 148
           ||||||||||||||||||||||
Sbjct: 128 cggcggccgcatcaccatgcgc 149


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,129,082
Number of Sequences: 3902068
Number of extensions: 1129082
Number of successful extensions: 23396
Number of sequences better than 10.0: 270
Number of HSP's better than 10.0 without gapping: 270
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 22733
Number of HSP's gapped (non-prelim): 653
length of query: 294
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 272
effective length of database: 17,147,199,772
effective search space: 4664038337984
effective search space used: 4664038337984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top