ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal30h15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY106321.1| Zea mays PCO088178 mRNA sequence 335 1e-88
2ref|NM_190383.1| Oryza sativa (japonica cultivar-group), predic... 329 7e-87
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
4dbj|AP003230.4| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
5gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 48 0.036
6gb|AC122147.1| Oryza sativa (japonica cultivar-group) chromosome... 48 0.036
7dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.036
8gb|AC153944.3| Mus musculus 10 BAC RP24-292A13 (Roswell Park Can... 48 0.036
9gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 48 0.036
10ref|XM_324096.1| Neurospora crassa OR74A predicted protein (NCU0... 46 0.14
11ref|XM_955282.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.14
12emb|Z94055.1|HS24M15 Human DNA sequence from clone RP1-24M15 on ... 46 0.14
13emb|AL512594.7| Human DNA sequence from clone RP11-549A6 on chro... 46 0.14
14emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone... 46 0.14
15emb|CR513786.5| Zebrafish DNA sequence from clone CH211-92F19 in... 46 0.14
16gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosom... 46 0.14
17emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on ch... 46 0.14
18gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complet... 46 0.14
19gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21... 44 0.56
20gb|AC115932.11| Mus musculus chromosome 1, clone RP24-538F21, co... 44 0.56
21gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 44 0.56
22gb|AC154385.2| Mus musculus BAC clone RP23-23O22 from chromosome... 44 0.56
23gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosom... 44 0.56
24gb|AC134243.3| Mus musculus BAC clone RP24-90E15 from chromosome... 44 0.56
25gb|AC117229.3| Mus musculus BAC clone RP23-380M1 from chromosome... 44 0.56
26gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, com... 44 0.56
27gb|AC080112.15| Homo sapiens chromosome 17, clone CTD-2267D19, c... 44 0.56
28gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, com... 44 0.56
29gb|AC164004.3| Mus musculus chromosome 5, clone RP23-58C20, comp... 44 0.56
30emb|AL713994.15| Mouse DNA sequence from clone RP23-378H5 on chr... 44 0.56
31gb|AC011558.6| Homo sapiens chromosome 19 clone LLNLR-291F12, co... 44 0.56
32gb|AC079223.11| Mus musculus chromosome 1, clone RP22-318M10, co... 44 0.56
33gb|AC155654.16| Mus musculus 6 BAC RP24-192P21 (Roswell Park Can... 44 0.56
34gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome... 44 0.56
35gb|AC127372.3| Mus musculus BAC clone RP23-37F11 from chromosome... 44 0.56
36emb|AL928798.20| Mouse DNA sequence from clone RP23-7A19 on chro... 44 0.56
37gb|AC153915.5| Mus musculus 10 BAC RP23-329D23 (Roswell Park Can... 44 0.56
38gb|AC140277.3| Mus musculus BAC clone RP23-336O18 from 5, comple... 44 0.56
39gb|AC147085.3| Mus musculus BAC clone RP23-356J12 from 8, comple... 44 0.56
40emb|CT009732.8| Mouse DNA sequence from clone RP23-72O20 on chro... 44 0.56
41gb|AC158559.7| Mus musculus chromosome 1, clone RP24-300L5, comp... 44 0.56
42gb|AC102343.8| Mus musculus chromosome 3, clone RP23-254H18, com... 42 2.2
43gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, comp... 42 2.2
44gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 2.2
45gb|AC163676.4| Mus musculus BAC clone RP24-81A22 from chromosome... 42 2.2
46gb|AC131593.16| Mus musculus chromosome 3, clone RP24-566M9, com... 42 2.2
47gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, co... 42 2.2
48gb|AC101559.20| Mus musculus chromosome 5, clone RP23-194K16, co... 42 2.2
49gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cance... 42 2.2
50gb|AC165238.5| Mus musculus chromosome 3, clone RP23-466A3, comp... 42 2.2
51gb|BC039276.1| Mus musculus pleckstrin homology domain containin... 42 2.2
52gb|AC138548.8| Mus musculus chromosome 3, clone RP24-210N9, comp... 42 2.2
53ref|XM_382069.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 42 2.2
54gb|AC127248.3| Mus musculus BAC clone RP24-442E2 from chromosome... 42 2.2
55ref|XM_567746.1| Cryptococcus neoformans var. neoformans JEC21 h... 42 2.2
56gb|AC124400.4| Mus musculus BAC clone RP24-357O21 from chromosom... 42 2.2
57gb|AC122879.3| Mus musculus BAC clone RP23-76C10 from 1, complet... 42 2.2
58gb|AC164704.4| Mus musculus BAC clone RP23-238D20 from chromosom... 42 2.2
59gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosom... 42 2.2
60emb|AL590302.6| Human DNA sequence from clone RP11-252P19 on chr... 42 2.2
61emb|AL445650.9| Human DNA sequence from clone RP11-152K20 on chr... 42 2.2
62gb|BC040216.1| Mus musculus dynein heavy chain-related, mRNA (cD... 42 2.2
63emb|AL805940.7| Mouse DNA sequence from clone RP24-286B19 on chr... 42 2.2
64gb|BC016134.1| Mus musculus pleckstrin homology domain containin... 42 2.2
65gb|AC010117.6| Drosophila melanogaster 3L BAC RP98-21J2 (Roswell... 42 2.2
66gb|AC009840.7| Drosophila melanogaster 3L BAC RP98-2B14 (Roswell... 42 2.2
67gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Canc... 42 2.2
68dbj|AK154634.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 2.2
69emb|AL512584.13| Mouse DNA sequence from clone RP23-232D1 on chr... 42 2.2
70gb|AC125310.5| Mus musculus BAC clone RP24-548E5 from chromosome... 42 2.2
71gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 42 2.2
72dbj|AK033666.1| Mus musculus adult male cecum cDNA, RIKEN full-l... 42 2.2
73gb|AC158651.12| Mus musculus BAC RP24-68I7 (Roswell Park Cancer... 42 2.2
74gb|AC132660.7| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cance... 42 2.2
75gb|AC138229.16| Mus musculus chromosome 1, clone RP23-399N18, co... 42 2.2
76gb|AF089023.1|AF089023 Euphagus carolinus cytochrome b (cytb) ge... 42 2.2
77gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, co... 42 2.2
78gb|AE003591.4| Drosophila melanogaster chromosome 3L, section 72... 42 2.2
79emb|CT486006.6| Mouse DNA sequence from clone RP23-433C10 on chr... 42 2.2
80emb|AL732497.15| Mouse DNA sequence from clone RP23-130H14 on ch... 42 2.2
81emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on ch... 42 2.2
82gb|AC144774.3| Mus musculus BAC clone RP24-128I18 from 6, comple... 42 2.2
83gb|AC122486.4| Mus musculus BAC clone RP24-380B9 from 12, comple... 42 2.2
84ref|NM_175175.3| Mus musculus pleckstrin homology domain contain... 42 2.2
85gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosom... 42 2.2
86gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome... 42 2.2
87emb|AL627105.13| Mouse DNA sequence from clone RP23-383D12 on ch... 42 2.2
88emb|AL928738.8| Mouse DNA sequence from clone RP23-76M15 on chro... 42 2.2
89gb|AC153581.18| Mus musculus 6 BAC RP23-111F17 (Roswell Park Can... 40 8.8
90ref|NM_115487.3| Arabidopsis thaliana unknown protein AT3G56290 ... 40 8.8
91gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 8.8
92ref|XM_512314.1| PREDICTED: Pan troglodytes similar to general t... 40 8.8
93ref|XM_471715.1| Oryza sativa (japonica cultivar-group), predic... 40 8.8
94gb|AY665795.1| Cynomys ludovicianus clone A115 microsatellite se... 40 8.8
95gb|AF030453.1| Homo sapiens chromosome 7 clone PAC 76h2 map 7q22... 40 8.8
96gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 40 8.8
97gb|BT020716.1| Bos taurus general transcription factor IIF, poly... 40 8.8
98gb|AC003676.1| Homo sapiens chromosome 2, P1 clone 777H5 (LBNL H... 40 8.8
99gb|AC113585.4| Trypanosoma brucei chromosome 5 clone RPCI93-27M3... 40 8.8
100gb|AC094749.8| Rattus norvegicus 1 BAC CH230-5H10 (Children's Ho... 40 8.8
101gb|AC121292.9| Mus musculus chromosome 1, clone RP23-172B15, com... 40 8.8
102ref|XM_594493.2| PREDICTED: Bos taurus calcium channel, voltage-... 40 8.8
103ref|XM_601826.2| PREDICTED: Bos taurus similar to type IV alpha ... 40 8.8
104ref|XM_363197.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 8.8
105ref|XM_323481.1| Neurospora crassa OR74A hypothetical protein ( ... 40 8.8
106ref|XM_953179.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.8
107ref|XM_956205.1| Neurospora crassa OR74A hypothetical protein ( ... 40 8.8
108ref|XM_327863.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.8
109ref|NM_000721.2| Homo sapiens calcium channel, voltage-dependent... 40 8.8
110gb|AC131343.4| Oryza sativa (japonica cultivar-group) chromosome... 40 8.8
111gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosom... 40 8.8
112gb|AC158932.5| Mus musculus chromosome 3, clone RP24-338G13, com... 40 8.8
113gb|AC162894.4| Mus musculus chromosome 3, clone RP23-326A24, com... 40 8.8
114gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, compl... 40 8.8
115gb|AC164091.3| Mus musculus BAC clone RP23-97M20 from chromosome... 40 8.8
116gb|AC164701.4| Mus musculus BAC clone RP24-108J12 from chromosom... 40 8.8
117gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome... 40 8.8
118gb|AC116593.4| Mus musculus BAC clone RP24-91C7 from chromosome ... 40 8.8
119gb|AC005088.3| Homo sapiens BAC clone CTA-313A17 from 7, complet... 40 8.8
120gb|AC093734.3| Homo sapiens BAC clone RP11-16P10 from 7, complet... 40 8.8
121gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, comp... 40 8.8
122gb|DQ483781.1| Gymnogyps californianus clone 204F microsatellite... 40 8.8
123ref|XM_533935.2| PREDICTED: Canis familiaris similar to Transcri... 40 8.8
124ref|XM_820621.1| Trypanosoma brucei TREU927 clone RPCI93-27M3 50... 40 8.8
125gb|AC125528.4| Mus musculus BAC clone RP23-365I9 from chromosome... 40 8.8
126gb|AC122488.3| Mus musculus BAC clone RP24-383B2 from chromosome... 40 8.8
127gb|AC125404.4| Mus musculus BAC clone RP23-10A1 from 12, complet... 40 8.8
128gb|AC073886.4| Homo sapiens BAC clone RP11-101N13 from 7, comple... 40 8.8
129gb|AC011899.5| Homo sapiens BAC clone RP11-452C13 from 7, comple... 40 8.8
130gb|AC005998.3| Homo sapiens PAC clone RP4-622E21 from 7, complet... 40 8.8
131gb|AC113524.9| Mus musculus chromosome 6, clone RP23-120I17, com... 40 8.8
132gb|AC165343.3| Mus musculus BAC clone RP23-476C24 from chromosom... 40 8.8
133gb|AC133425.3| Rattus norvegicus 7 BAC CH230-333I12 (Children's ... 40 8.8
134emb|Z99495.1|HS441J1 Human DNA sequence from clone RP3-441J1 on ... 40 8.8
135ref|XM_794857.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 8.8
136emb|AL590998.7| Human DNA sequence from clone RP4-677A15 on chro... 40 8.8
137emb|AL359928.11| Human DNA sequence from clone RP11-80D19 on chr... 40 8.8
138emb|AL157768.6| Human DNA sequence from clone RP11-481A22 on chr... 40 8.8
139gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121... 40 8.8
140emb|AL078590.28|HSA557H15 Human DNA sequence from clone RP11-557... 40 8.8
141emb|AL031650.22|HS1018D12 Human DNA sequence from clone RP5-1018... 40 8.8
142gb|AC068909.31| Mus musculus BAC Clone 407f20 RPCI-23, complete ... 40 8.8
143gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 40 8.8
144emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmi... 40 8.8
145emb|AL606482.14| Mouse DNA sequence from clone RP23-360H16 on ch... 40 8.8
146gb|AC094105.3| Homo sapiens chromosome 5 clone RP11-468D11, comp... 40 8.8
147emb|AL450406.17| Mouse DNA sequence from clone RP23-262J21 on ch... 40 8.8
148gb|BC045562.1| Homo sapiens cDNA clone IMAGE:4815142 40 8.8
149gb|BC040199.1| Homo sapiens cDNA clone IMAGE:4816860 40 8.8
150gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig co... 40 8.8
151gb|AC112673.7| Homo sapiens chromosome 8, clone RP11-212F11, com... 40 8.8
152gb|AY081675.1| Arabidopsis thaliana putative protein (At3g56290)... 40 8.8
153gb|AC009093.10| Homo sapiens chromosome 16 clone RP11-426C22, co... 40 8.8
154gb|AC011405.6| Homo sapiens chromosome 5 clone CTB-46B19, comple... 40 8.8
155gb|AY062503.1| Arabidopsis thaliana putative protein (At3g56290;... 40 8.8
156gb|AC157498.2| Pan troglodytes BAC clone CH251-412M6 from chromo... 40 8.8
157gb|AC154751.2| Mus musculus BAC clone RP24-399L21 from chromosom... 40 8.8
158gb|AY958432.1| Homo sapiens methionine sulfoxide reductase gene,... 40 8.8
159gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, r... 40 8.8
160gb|AC010409.6|AC010409 Homo sapiens chromosome 5 clone CTD-2158P... 40 8.8
161gb|AF212996.1|AF212996 Neurospora crassa heat shock protein 80 g... 40 8.8
162dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
163dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
164dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
165dbj|AB197319.1| Uncultured bacterium C23O gene for catechol 2,3-... 40 8.8
166gb|AC104599.4| Homo sapiens BAC clone RP11-652K9 from 2, complet... 40 8.8
167gb|AC079895.7| Homo sapiens BAC clone RP11-749M12 from 2, comple... 40 8.8
168gb|AC113618.5| Homo sapiens BAC clone RP11-1367O10 from 2, compl... 40 8.8
169gb|AC154838.2| Mus musculus BAC clone RP23-64F2 from chromosome ... 40 8.8
170gb|AC156835.2| Mus musculus BAC clone RP23-322L4 from chromosome... 40 8.8
171gb|AC154245.2| Mus musculus BAC clone RP24-326A24 from chromosom... 40 8.8
172gb|AC155820.2| Mus musculus BAC clone RP23-360J10 from chromosom... 40 8.8
173gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, com... 40 8.8
174ref|NM_001015527.1| Bos taurus general transcription factor IIF,... 40 8.8
175gb|AC134312.3| Homo sapiens chromosome 16 clone RP11-863P13, com... 40 8.8
176dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 8.8
177gb|AC127455.4| Homo sapiens chromosome 16 clone CTD-3057O21, com... 40 8.8
178gb|AC092758.3| Papio anubis clone RP41-22J16, complete sequence 40 8.8
179gb|AC010629.8| Homo sapiens chromosome 5 clone CTD-2213L16, comp... 40 8.8
180dbj|AP002869.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
181dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
182emb|BX323545.11| Mouse DNA sequence from clone RP23-358N13 on ch... 40 8.8
183dbj|AK120056.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.8
184gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E su... 40 8.8
185gb|AC002479.1|AC002479 Human BAC clone GS1-9G13 from 5p15.2, com... 40 8.8
186dbj|AK108051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.8
187dbj|AK105168.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.8
188gb|AC154040.7| Mus musculus 10 BAC RP23-348E15 (Roswell Park Can... 40 8.8
189gb|AF151527.1|AF151527 Hyphantria cunea serpin gene, complete cds 40 8.8
190gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36... 40 8.8
191gb|AC005666.1|AC005666 Homo sapiens chromosome 17, clone hRPK.11... 40 8.8
192gb|AC005734.1|AC005734 Drosophila melanogaster DNA sequence (P1s... 40 8.8
193gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.8
194emb|AL731609.2|OSJN00259 Oryza sativa genomic DNA, chromosome 4,... 40 8.8
195emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chr... 40 8.8
196gb|AC125520.3| Mus musculus BAC clone RP24-281J17 from 8, comple... 40 8.8
197gb|AC127255.4| Mus musculus BAC clone RP24-291I7 from 5, complet... 40 8.8
198gb|AC068908.21| Mus musculus BAC Clone 389o18 RPCI-23, complete ... 40 8.8
199gb|AC136837.1| Homo sapiens chromosome 16 clone RP11-483N11, com... 40 8.8
200gb|AC161461.5| Mus musculus BAC clone RP23-104L7 from chromosome... 40 8.8
201dbj|AB209499.1| Homo sapiens mRNA for calcium channel, voltage-d... 40 8.8
202gb|AC167020.3| Mus musculus BAC clone RP23-201I6 from chromosome... 40 8.8
203emb|AL732615.15| Mouse DNA sequence from clone RP23-190O8 on chr... 40 8.8
204emb|AL928553.8| Mouse DNA sequence from clone RP23-312N5 on chro... 40 8.8
205emb|AL953913.5| Mouse DNA sequence from clone RP23-390H16 on chr... 40 8.8
206gb|L27745.1|HUMVOCC Homo sapiens voltage-operated calcium channe... 40 8.8
207emb|AL672100.7| Mouse DNA sequence from clone RP23-125A1 on chro... 40 8.8
208emb|AL837521.6| Mouse DNA sequence from clone RP23-28I8 on chrom... 40 8.8
209gb|L29385.1|HUMHVDCA Homo sapiens (clone pcDNA-alpha1E-3) voltag... 40 8.8
210gb|L29384.1|HUMHVDC Homo sapiens (clone pcDNA-alpha1E-1) voltage... 40 8.8

>gb|AY106321.1| Zea mays PCO088178 mRNA sequence
          Length = 748

 Score =  335 bits (169), Expect = 1e-88
 Identities = 265/297 (89%)
 Strand = Plus / Plus

                                                                       
Query: 149 caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 208
           |||||||||||| || || | |||||||||||||||||||||||||||||||||||||||
Sbjct: 148 caagcagtccctcttcggaagcatcaccgaggcgctggacttctcgcaggtccggtcgga 207

                                                                       
Query: 209 gaaggacgcggagctgctgtacgaggccagggattccatcaaagatgaagggaggatgac 268
           ||||||||| ||||||||||||||||||||||| |||| || || || ||||||||||||
Sbjct: 208 gaaggacgccgagctgctgtacgaggccagggagtccaccagaggtggagggaggatgac 267

                                                                       
Query: 269 aagggaacagtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaa 328
            ||||| ||||| | ||| ||| || |||||||||||||||||||| |||||||||||||
Sbjct: 268 gagggagcagtacggagcacttaggcggaagattggtggcacctaccaggatttcttcaa 327

                                                                       
Query: 329 gtcatatgttgaagttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaa 388
           ||||||||||||||| || ||  ||||||||||||| |||||||| ||||||||||||||
Sbjct: 328 gtcatatgttgaagtcgacgggcaatacgtggaggagggttgggtcgacaagacctgcaa 387

                                                                    
Query: 389 agtttgcaagaaagacacaagaggggagccaaggcaagttgacaatctaggaagata 445
             | |||||||| |||||||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 388 gatctgcaagaaggacacaaggggggagccgaggcaggttgacaagctaggaagata 444



to top

>ref|NM_190383.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 513

 Score =  329 bits (166), Expect = 7e-87
 Identities = 265/298 (88%)
 Strand = Plus / Plus

                                                                       
Query: 149 caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 208
           |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 150 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 209

                                                                       
Query: 209 gaaggacgcggagctgctgtacgaggccagggattccatcaaagatgaagggaggatgac 268
           ||||||||||||||| ||||| || ||||| ||  |||  || |||| ||| ||||||||
Sbjct: 210 gaaggacgcggagcttctgtatgaagccagagaggccacaaaggatggaggaaggatgac 269

                                                                       
Query: 269 aagggaacagtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaa 328
           || ||| ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 270 aaaggagcagtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaa 329

                                                                       
Query: 329 gtcatatgttgaagttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaa 388
           ||||||||| || ||||| || |||||||| ||||||||||||||||| |||||||||||
Sbjct: 330 gtcatatgtggatgttgacggggaatacgtagaggaaggttgggtggataagacctgcaa 389

                                                                     
Query: 389 agtttgcaagaaagacacaagaggggagccaaggcaagttgacaatctaggaagatat 446
           |||||||||||| ||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 390 agtttgcaagaaggacactagaggggaacccaggcaggtcgacaagctaggaagatat 447



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  127 bits (64), Expect = 5e-26
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                            
Query: 341      agttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaaagtttgcaagaa 400
                |||||| || |||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 35169399 agttgacggggaatacgtagaggaaggttgggtggataagacctgcaaagtttgcaagaa 35169458

                                                                            
Query: 401      agacacaagaggggagccaaggcaagttgacaatctaggaagatatatgcatgtggcgtg 460
                 ||||| |||||||| || ||||| || ||||| ||||||||||||   ||||| || ||
Sbjct: 35169459 ggacactagaggggaacccaggcaggtcgacaagctaggaagatatgcacatgtcgcatg 35169518

                                                                            
Query: 461      cgcagagaactcgaaaccaacaaacttcttttccaaactcttcggcagatgaacttcttt 520
                |   |||||| | ||||| || ||| ||||  ||||| | |||| ||||||||||||  |
Sbjct: 35169519 cttggagaacccaaaaccgaccaacatcttcgccaaattgttcgccagatgaacttcaat 35169578

                            
Query: 521      tgtaccatcaaa 532
                ||||| ||||||
Sbjct: 35169579 tgtacaatcaaa 35169590



 Score =  123 bits (62), Expect = 8e-25
 Identities = 83/90 (92%)
 Strand = Plus / Plus

                                                                            
Query: 149      caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 208
                |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 35168960 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 35169019

                                              
Query: 209      gaaggacgcggagctgctgtacgaggccag 238
                ||||||||||||||| ||||| || |||||
Sbjct: 35169020 gaaggacgcggagcttctgtatgaagccag 35169049



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                            
Query: 277      agtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaagtcatatg 336
                |||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 35169222 agtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaagtcatatg 35169281

                 
Query: 337      t 337
                |
Sbjct: 35169282 t 35169282



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 123      gaggaggagggggagaagaaggtg 146
                |||||||||| |||||||||||||
Sbjct: 12717053 gaggaggaggaggagaagaaggtg 12717030



to top

>dbj|AP003230.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0031D02
          Length = 183692

 Score =  127 bits (64), Expect = 5e-26
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                         
Query: 341   agttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaaagtttgcaagaa 400
             |||||| || |||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 48483 agttgacggggaatacgtagaggaaggttgggtggataagacctgcaaagtttgcaagaa 48542

                                                                         
Query: 401   agacacaagaggggagccaaggcaagttgacaatctaggaagatatatgcatgtggcgtg 460
              ||||| |||||||| || ||||| || ||||| ||||||||||||   ||||| || ||
Sbjct: 48543 ggacactagaggggaacccaggcaggtcgacaagctaggaagatatgcacatgtcgcatg 48602

                                                                         
Query: 461   cgcagagaactcgaaaccaacaaacttcttttccaaactcttcggcagatgaacttcttt 520
             |   |||||| | ||||| || ||| ||||  ||||| | |||| ||||||||||||  |
Sbjct: 48603 cttggagaacccaaaaccgaccaacatcttcgccaaattgttcgccagatgaacttcaat 48662

                         
Query: 521   tgtaccatcaaa 532
             ||||| ||||||
Sbjct: 48663 tgtacaatcaaa 48674



 Score =  123 bits (62), Expect = 8e-25
 Identities = 83/90 (92%)
 Strand = Plus / Plus

                                                                         
Query: 149   caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 208
             |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 48044 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 48103

                                           
Query: 209   gaaggacgcggagctgctgtacgaggccag 238
             ||||||||||||||| ||||| || |||||
Sbjct: 48104 gaaggacgcggagcttctgtatgaagccag 48133



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                         
Query: 277   agtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaagtcatatg 336
             |||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 48306 agtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaagtcatatg 48365

              
Query: 337   t 337
             |
Sbjct: 48366 t 48366



to top

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
               Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 119     agatgaggaggagggggagaagaa 142
               ||||||||||||||||||||||||
Sbjct: 1900619 agatgaggaggagggggagaagaa 1900642



to top

>gb|AC122147.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0072F04,
              complete sequence
          Length = 137724

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 119    agatgaggaggagggggagaagaa 142
              ||||||||||||||||||||||||
Sbjct: 119072 agatgaggaggagggggagaagaa 119095



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 119     agatgaggaggagggggagaagaa 142
               ||||||||||||||||||||||||
Sbjct: 1900619 agatgaggaggagggggagaagaa 1900642



to top

>gb|AC153944.3| Mus musculus 10 BAC RP24-292A13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 139203

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 123    gaggaggagggggagaagaaggtg 146
              ||||||||||||||||||||||||
Sbjct: 103982 gaggaggagggggagaagaaggtg 104005



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 119     agatgaggaggagggggagaagaa 142
               ||||||||||||||||||||||||
Sbjct: 1900570 agatgaggaggagggggagaagaa 1900593



to top

>ref|XM_324096.1| Neurospora crassa OR74A predicted protein (NCU04740.1) partial mRNA
          Length = 1305

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 478 caacaaacttcttttccaaactcttcggcag 508
           |||||||||||| ||||| ||||||||||||
Sbjct: 736 caacaaacttctcttccatactcttcggcag 706



to top

>ref|XM_955282.1| Neurospora crassa OR74A hypothetical protein (NCU04740.1) partial
           mRNA
          Length = 1305

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 478 caacaaacttcttttccaaactcttcggcag 508
           |||||||||||| ||||| ||||||||||||
Sbjct: 736 caacaaacttctcttccatactcttcggcag 706



to top

>emb|Z94055.1|HS24M15 Human DNA sequence from clone RP1-24M15 on chromosome 1q24-25 Contains
             part of the TNR gene fortenascin R (restrictin, janusin),
             complete sequence
          Length = 134539

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 611   catgtgaaatattttttgatgag 633
             |||||||||||||||||||||||
Sbjct: 78481 catgtgaaatattttttgatgag 78503



to top

>emb|AL512594.7| Human DNA sequence from clone RP11-549A6 on chromosome 9 Contains a
             pseudogene similar to part of a GTPase-activating protein,
             complete sequence
          Length = 166192

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 132   ggggagaagaaggtgcccaagcagtccctgt 162
             |||||||||||||||  ||||||||||||||
Sbjct: 84304 ggggagaagaaggtgagcaagcagtccctgt 84334



to top

>emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone B8I24
          Length = 83591

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 478   caacaaacttcttttccaaactcttcggcag 508
             |||||||||||| ||||| ||||||||||||
Sbjct: 73326 caacaaacttctcttccatactcttcggcag 73296



to top

>emb|CR513786.5| Zebrafish DNA sequence from clone CH211-92F19 in linkage group 14,
             complete sequence
          Length = 97391

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 113   gaaagcagatgaggaggagggggagaagaag 143
             ||||| |||||||||||||| ||||||||||
Sbjct: 47517 gaaaggagatgaggaggaggaggagaagaag 47547



to top

>gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosome 12, complete
             sequence
          Length = 222209

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 88    ctactaggtcagtcagggcttat 110
             |||||||||||||||||||||||
Sbjct: 53257 ctactaggtcagtcagggcttat 53235



to top

>emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on chromosome 12, complete
             sequence
          Length = 205332

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 117   gcagatgaggaggagggggagaagaag 143
             ||||| |||||||||||||||||||||
Sbjct: 76157 gcagaagaggaggagggggagaagaag 76131



to top

>gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complete sequence
          Length = 217949

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 88    ctactaggtcagtcagggcttat 110
             |||||||||||||||||||||||
Sbjct: 54501 ctactaggtcagtcagggcttat 54523



to top

>gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21.1, complete sequence
          Length = 138999

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 65076 gaggaggagggggagaagaagg 65097



to top

>gb|AC115932.11| Mus musculus chromosome 1, clone RP24-538F21, complete sequence
          Length = 205378

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 185435 gaggaggagggggagaagaagg 185456



to top

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 20      ccctacccagagctcctcattt 41
               ||||||||||||||||||||||
Sbjct: 3767647 ccctacccagagctcctcattt 3767626



to top

>gb|AC154385.2| Mus musculus BAC clone RP23-23O22 from chromosome 17, complete sequence
          Length = 221564

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 114   aaagcagatgaggaggagggggagaagaag 143
             |||| ||| |||||||||||||||||||||
Sbjct: 40692 aaagaagaggaggaggagggggagaagaag 40721



to top

>gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosome 9, complete sequence
          Length = 217074

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 134156 gaggaggagggggagaagaagg 134177



to top

>gb|AC134243.3| Mus musculus BAC clone RP24-90E15 from chromosome 17, complete sequence
          Length = 193151

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 114    aaagcagatgaggaggagggggagaagaag 143
              |||| ||| |||||||||||||||||||||
Sbjct: 154826 aaagaagaggaggaggagggggagaagaag 154855



to top

>gb|AC117229.3| Mus musculus BAC clone RP23-380M1 from chromosome 2, complete sequence
          Length = 187221

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 473    gaaaccaacaaacttcttttcc 494
              ||||||||||||||||||||||
Sbjct: 102019 gaaaccaacaaacttcttttcc 101998



to top

>gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, complete sequence
          Length = 165614

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 135673 gaggaggagggggagaagaagg 135652



to top

>gb|AC080112.15| Homo sapiens chromosome 17, clone CTD-2267D19, complete sequence
          Length = 175014

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 49001 gaggaggagggggagaagaagg 49022



to top

>gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, complete sequence
          Length = 166234

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 29745 gaggaggagggggagaagaagg 29724



to top

>gb|AC164004.3| Mus musculus chromosome 5, clone RP23-58C20, complete sequence
          Length = 198872

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 60381 gaggaggagggggagaagaagg 60360



to top

>emb|AL713994.15| Mouse DNA sequence from clone RP23-378H5 on chromosome 11 Contains the 5'
              end of the Arf-1 gene for ADP-ribosylation factor 1, the
              Wnt3a gene for wingless-related MMTV integration site 3A,
              the Wnt9a gene for wingless-type MMTV integration site 9A,
              two novel genes, the 5' end of a novel gene and five CpG
              islands, complete sequence
          Length = 225396

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 165058 gaggaggagggggagaagaagg 165079



to top

>gb|AC011558.6| Homo sapiens chromosome 19 clone LLNLR-291F12, complete sequence
          Length = 43128

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 25611 gaggaggagggggagaagaagg 25632



to top

>gb|AC079223.11| Mus musculus chromosome 1, clone RP22-318M10, complete sequence
          Length = 137729

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 15619 gaggaggagggggagaagaagg 15640



to top

>gb|AC155654.16| Mus musculus 6 BAC RP24-192P21 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 147486

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 119   agatgaggaggagggggagaagaagg 144
             |||||||||||||| |||||||||||
Sbjct: 67325 agatgaggaggaggaggagaagaagg 67300



to top

>gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome 17, complete sequence
          Length = 206868

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 119   agatgaggaggagggggagaag 140
             ||||||||||||||||||||||
Sbjct: 92128 agatgaggaggagggggagaag 92149



to top

>gb|AC127372.3| Mus musculus BAC clone RP23-37F11 from chromosome 8, complete sequence
          Length = 175472

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 151562 gaggaggagggggagaagaagg 151541



to top

>emb|AL928798.20| Mouse DNA sequence from clone RP23-7A19 on chromosome 2, complete
             sequence
          Length = 192734

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 473   gaaaccaacaaacttcttttcc 494
             ||||||||||||||||||||||
Sbjct: 23522 gaaaccaacaaacttcttttcc 23543



to top

>gb|AC153915.5| Mus musculus 10 BAC RP23-329D23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207169

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 119    agatgaggaggagggggagaagaagg 144
              |||||||||||||| |||||||||||
Sbjct: 206253 agatgaggaggaggaggagaagaagg 206278



to top

>gb|AC140277.3| Mus musculus BAC clone RP23-336O18 from 5, complete sequence
          Length = 198919

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 190064 gaggaggagggggagaagaagg 190043



to top

>gb|AC147085.3| Mus musculus BAC clone RP23-356J12 from 8, complete sequence
          Length = 209306

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 123    gaggaggagggggagaagaagg 144
              ||||||||||||||||||||||
Sbjct: 149430 gaggaggagggggagaagaagg 149451



to top

>emb|CT009732.8| Mouse DNA sequence from clone RP23-72O20 on chromosome 9, complete
             sequence
          Length = 239257

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 54184 gaggaggagggggagaagaagg 54205



to top

>gb|AC158559.7| Mus musculus chromosome 1, clone RP24-300L5, complete sequence
          Length = 169324

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 123   gaggaggagggggagaagaagg 144
             ||||||||||||||||||||||
Sbjct: 36709 gaggaggagggggagaagaagg 36730



to top

>gb|AC102343.8| Mus musculus chromosome 3, clone RP23-254H18, complete sequence
          Length = 220876

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 163036 gaggaggagggggagaagaag 163016



to top

>gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, complete sequence
          Length = 172348

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 123  gaggaggagggggagaagaag 143
            |||||||||||||||||||||
Sbjct: 3711 gaggaggagggggagaagaag 3731



to top

>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 120    gatgaggaggagggggagaagaagg 144
              |||||||||||||||||||| ||||
Sbjct: 795846 gatgaggaggagggggagaacaagg 795870



to top

>gb|AC163676.4| Mus musculus BAC clone RP24-81A22 from chromosome 3, complete sequence
          Length = 223760

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 130120 gaggaggagggggagaagaag 130100



to top

>gb|AC131593.16| Mus musculus chromosome 3, clone RP24-566M9, complete sequence
          Length = 143352

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 24762 gaggaggagggggagaagaag 24742



to top

>gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, complete sequence
          Length = 154129

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 113   gaaagcagatgaggaggaggg 133
             |||||||||||||||||||||
Sbjct: 59222 gaaagcagatgaggaggaggg 59242



to top

>gb|AC101559.20| Mus musculus chromosome 5, clone RP23-194K16, complete sequence
          Length = 252554

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 194083 gaggaggagggggagaagaag 194063



to top

>gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 178502

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 162568 gaggaggagggggagaagaag 162548



to top

>gb|AC165238.5| Mus musculus chromosome 3, clone RP23-466A3, complete sequence
          Length = 180939

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 143072 gaggaggagggggagaagaag 143092



to top

>gb|BC039276.1| Mus musculus pleckstrin homology domain containing, family F (with
           FYVE domain) member 2, mRNA (cDNA clone MGC:36376
           IMAGE:4987735), complete cds
          Length = 2892

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 240 gattccatcaaagatgaaggg 260
           |||||||||||||||||||||
Sbjct: 454 gattccatcaaagatgaaggg 474



to top

>gb|AC138548.8| Mus musculus chromosome 3, clone RP24-210N9, complete sequence
          Length = 155964

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 54402 gaggaggagggggagaagaag 54422



to top

>ref|XM_382069.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG01893.1) partial mRNA
          Length = 2478

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                        
Query: 117 gcagatgaggaggaggg-ggagaagaagg 144
           ||||||||||||||||| |||||||||||
Sbjct: 607 gcagatgaggaggagggtggagaagaagg 635



to top

>gb|AC127248.3| Mus musculus BAC clone RP24-442E2 from chromosome 5, complete sequence
          Length = 176488

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 115265 gaggaggagggggagaagaag 115285



to top

>ref|XM_567746.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNK02720) partial mRNA
          Length = 4178

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 120  gatgaggaggagggggagaagaagg 144
            |||||||||||||||||||| ||||
Sbjct: 1533 gatgaggaggagggggagaacaagg 1557



to top

>gb|AC124400.4| Mus musculus BAC clone RP24-357O21 from chromosome 14, complete
             sequence
          Length = 191219

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   gattccatcaaagatgaaggg 260
             |||||||||||||||||||||
Sbjct: 90762 gattccatcaaagatgaaggg 90782



to top

>gb|AC122879.3| Mus musculus BAC clone RP23-76C10 from 1, complete sequence
          Length = 250884

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 234680 gaggaggagggggagaagaag 234660



to top

>gb|AC164704.4| Mus musculus BAC clone RP23-238D20 from chromosome 6, complete sequence
          Length = 189119

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 7      ctctcgctctttcccctaccc 27
              |||||||||||||||||||||
Sbjct: 131699 ctctcgctctttcccctaccc 131719



to top

>gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosome 9, complete sequence
          Length = 191274

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 106050 gaggaggagggggagaagaag 106070



to top

>emb|AL590302.6| Human DNA sequence from clone RP11-252P19 on chromosome 6 Contains 2
            novel genes and 3 CpG islands, complete sequence
          Length = 105898

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 120  gatgaggaggagggggagaagaagg 144
            ||||||||||||| |||||||||||
Sbjct: 6972 gatgaggaggaggaggagaagaagg 6996



to top

>emb|AL445650.9| Human DNA sequence from clone RP11-152K20 on chromosome 1 Contains the
             5' end of the USH2A gene for Usher syndrome 2A (autosomal
             recessive, mild) and the 3' end of the ESRRG gene for
             estrogen-related receptor gamma, complete sequence
          Length = 153705

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 80412 gaggaggagggggagaagaag 80432



to top

>gb|BC040216.1| Mus musculus dynein heavy chain-related, mRNA (cDNA clone
            IMAGE:5363263), with apparent retained intron
          Length = 5542

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 123  gaggaggagggggagaagaag 143
            |||||||||||||||||||||
Sbjct: 5321 gaggaggagggggagaagaag 5341



to top

>emb|AL805940.7| Mouse DNA sequence from clone RP24-286B19 on chromosome 4, complete
             sequence
          Length = 128829

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 89195 gaggaggagggggagaagaag 89215



to top

>gb|BC016134.1| Mus musculus pleckstrin homology domain containing, family F (with
           FYVE domain) member 2, mRNA (cDNA clone MGC:28979
           IMAGE:4503757), complete cds
          Length = 2897

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 240 gattccatcaaagatgaaggg 260
           |||||||||||||||||||||
Sbjct: 444 gattccatcaaagatgaaggg 464



to top

>gb|AC010117.6| Drosophila melanogaster 3L BAC RP98-21J2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 178965

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 613    tgtgaaatattttttgatgag 633
              |||||||||||||||||||||
Sbjct: 147942 tgtgaaatattttttgatgag 147922



to top

>gb|AC009840.7| Drosophila melanogaster 3L BAC RP98-2B14 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 194790

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 613    tgtgaaatattttttgatgag 633
              |||||||||||||||||||||
Sbjct: 171968 tgtgaaatattttttgatgag 171988



to top

>gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164078

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 124   aggaggagggggagaagaagg 144
             |||||||||||||||||||||
Sbjct: 82730 aggaggagggggagaagaagg 82710



to top

>dbj|AK154634.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630101M03
           product:pleckstrin homology domain containing, family F
           (with FYVE domain) member 2, full insert sequence
          Length = 1964

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 240 gattccatcaaagatgaaggg 260
           |||||||||||||||||||||
Sbjct: 494 gattccatcaaagatgaaggg 514



to top

>emb|AL512584.13| Mouse DNA sequence from clone RP23-232D1 on chromosome 2, complete
            sequence
          Length = 141386

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 123  gaggaggagggggagaagaag 143
            |||||||||||||||||||||
Sbjct: 5537 gaggaggagggggagaagaag 5517



to top

>gb|AC125310.5| Mus musculus BAC clone RP24-548E5 from chromosome 1, complete sequence
          Length = 223534

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 217892 gaggaggagggggagaagaag 217912



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 175     ccgaggcgctggacttctcgc 195
               |||||||||||||||||||||
Sbjct: 1358734 ccgaggcgctggacttctcgc 1358714



to top

>dbj|AK033666.1| Mus musculus adult male cecum cDNA, RIKEN full-length enriched
           library, clone:9130213H04 product:CDNA FLJ13187 FIS,
           CLONE NT2RP3004242, WEAKLY SIMILAR TO PUTATIVE RHO/RAC
           GUANINE NUCLEOTIDE EXCHANGE FACTOR (HYPOTHETICAL 27.8
           KDA PROTEIN) homolog [Homo sapiens], full insert
           sequence
          Length = 2228

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 240 gattccatcaaagatgaaggg 260
           |||||||||||||||||||||
Sbjct: 497 gattccatcaaagatgaaggg 517



to top

>gb|AC158651.12| Mus musculus  BAC RP24-68I7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 190089

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 63490 gaggaggagggggagaagaag 63470



to top

>gb|AC132660.7| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 64263

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 51631 gaggaggagggggagaagaag 51611



to top

>gb|AC138229.16| Mus musculus chromosome 1, clone RP23-399N18, complete sequence
          Length = 211732

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 130062 gaggaggagggggagaagaag 130042



to top

>gb|AF089023.1|AF089023 Euphagus carolinus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 888

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 356 cgtggaggaaggttgggtggacaag 380
           |||||||||||||| ||||||||||
Sbjct: 487 cgtggaggaaggttaggtggacaag 463



to top

>gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, complete sequence
          Length = 240821

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 130484 gaggaggagggggagaagaag 130504



to top

>gb|AE003591.4| Drosophila melanogaster chromosome 3L, section 72 of 83 of the complete
              sequence
          Length = 301136

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 613    tgtgaaatattttttgatgag 633
              |||||||||||||||||||||
Sbjct: 221260 tgtgaaatattttttgatgag 221280



to top

>emb|CT486006.6| Mouse DNA sequence from clone RP23-433C10 on chromosome 9, complete
              sequence
          Length = 208668

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 109339 gaggaggagggggagaagaag 109319



to top

>emb|AL732497.15| Mouse DNA sequence from clone RP23-130H14 on chromosome 4, complete
             sequence
          Length = 208663

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   gattccatcaaagatgaaggg 260
             |||||||||||||||||||||
Sbjct: 86024 gattccatcaaagatgaaggg 86004



to top

>emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on chromosome 2, complete
              sequence
          Length = 257676

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 246251 gaggaggagggggagaagaag 246271



to top

>gb|AC144774.3| Mus musculus BAC clone RP24-128I18 from 6, complete sequence
          Length = 143838

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 7      ctctcgctctttcccctaccc 27
              |||||||||||||||||||||
Sbjct: 132005 ctctcgctctttcccctaccc 131985



to top

>gb|AC122486.4| Mus musculus BAC clone RP24-380B9 from 12, complete sequence
          Length = 128253

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 124   aggaggagggggagaagaagg 144
             |||||||||||||||||||||
Sbjct: 96379 aggaggagggggagaagaagg 96359



to top

>ref|NM_175175.3| Mus musculus pleckstrin homology domain containing, family F (with
           FYVE domain) member 2 (Plekhf2), mRNA
          Length = 2897

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 240 gattccatcaaagatgaaggg 260
           |||||||||||||||||||||
Sbjct: 444 gattccatcaaagatgaaggg 464



to top

>gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosome 7, complete sequence
          Length = 232098

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 123    gaggaggagggggagaagaag 143
              |||||||||||||||||||||
Sbjct: 117219 gaggaggagggggagaagaag 117199



to top

>gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome 17, complete sequence
          Length = 219548

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 40063 gaggaggagggggagaagaag 40083



to top

>emb|AL627105.13| Mouse DNA sequence from clone RP23-383D12 on chromosome 4, complete
             sequence
          Length = 190882

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   gaggaggagggggagaagaag 143
             |||||||||||||||||||||
Sbjct: 54679 gaggaggagggggagaagaag 54699



to top

>emb|AL928738.8| Mouse DNA sequence from clone RP23-76M15 on chromosome 4, complete
             sequence
          Length = 188568

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 248   caaagatgaagggaggatgacaagg 272
             ||||||||||| |||||||||||||
Sbjct: 63432 caaagatgaagagaggatgacaagg 63456



to top

>gb|AC153581.18| Mus musculus 6 BAC RP23-111F17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 208262

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   atgaggaggagggggagaag 140
             ||||||||||||||||||||
Sbjct: 59388 atgaggaggagggggagaag 59369



to top

>ref|NM_115487.3| Arabidopsis thaliana unknown protein AT3G56290 mRNA, complete cds
          Length = 753

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 336 gttgaagttgatggcgaatacgtggaggaaggttgggtggacaa 379
           |||||||| |||||  |||| |||||||| || |||||||||||
Sbjct: 373 gttgaagtggatgggcaatatgtggaggagggatgggtggacaa 416



to top

>gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OABb-289A1, complete
             sequence
          Length = 109794

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 120   gatgaggaggagggggagaagaag 143
             ||||| ||||||||||||||||||
Sbjct: 33653 gatgaagaggagggggagaagaag 33630



to top

>ref|XM_512314.1| PREDICTED: Pan troglodytes similar to general transcription factor
            IIF, polypeptide 1, 74kDa; general transcription factor
            IIF, polypeptide 1 (74kD subunit) (LOC455639), mRNA
          Length = 2391

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 123  gaggaggagggggagaagaaggtgccca 150
            |||||||||| ||||||||||| |||||
Sbjct: 1717 gaggaggaggaggagaagaaggcgccca 1744



to top

>ref|XM_471715.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ggaggagggggagaagaagg 144
           ||||||||||||||||||||
Sbjct: 207 ggaggagggggagaagaagg 226



to top

>gb|AY665795.1| Cynomys ludovicianus clone A115 microsatellite sequence
          Length = 690

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 149 caagcagtccctgtttggga 168
           ||||||||||||||||||||
Sbjct: 624 caagcagtccctgtttggga 605



to top

>gb|AF030453.1| Homo sapiens chromosome 7 clone PAC 76h2 map 7q22, complete sequence
          Length = 125108

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 355   acgtggaggaaggttgggtg 374
             ||||||||||||||||||||
Sbjct: 17021 acgtggaggaaggttgggtg 17040



to top

>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 473     gaaaccaacaaacttctttt 492
               ||||||||||||||||||||
Sbjct: 1065976 gaaaccaacaaacttctttt 1065995



to top

>gb|BT020716.1| Bos taurus general transcription factor IIF, polypeptide 1, 74kDa
            (GTF2F1), mRNA, complete cds
          Length = 1788

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 123  gaggaggagggggagaagaaggtgccca 150
            |||||||||| ||||||||||| |||||
Sbjct: 1166 gaggaggaggaggagaagaaggcgccca 1193



to top

>gb|AC003676.1| Homo sapiens chromosome 2, P1 clone 777H5 (LBNL H27), complete sequence
          Length = 86894

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 71667 gaggaggagggggagaagaa 71686



to top

>gb|AC113585.4| Trypanosoma brucei chromosome 5 clone RPCI93-27M3, complete sequence
          Length = 127380

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 473    gaaaccaacaaacttctttt 492
              ||||||||||||||||||||
Sbjct: 107977 gaaaccaacaaacttctttt 107996



to top

>gb|AC094749.8| Rattus norvegicus 1 BAC CH230-5H10 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 77448

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   aggaggagggggagaagaag 143
             ||||||||||||||||||||
Sbjct: 37792 aggaggagggggagaagaag 37773



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   aggaggagggggagaagaag 143
             ||||||||||||||||||||
Sbjct: 37771 aggaggagggggagaagaag 37752



to top

>gb|AC121292.9| Mus musculus chromosome 1, clone RP23-172B15, complete sequence
          Length = 193192

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 121    atgaggaggagggggagaagaagg 144
              |||||||||||| |||||||||||
Sbjct: 122475 atgaggaggaggaggagaagaagg 122452



to top

>ref|XM_594493.2| PREDICTED: Bos taurus calcium channel, voltage-dependent, alpha 1E
            subunit (CACNA1E), partial mRNA
          Length = 6542

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 2813 gatgaggaggaggtggagaagaag 2836



to top

>ref|XM_601826.2| PREDICTED: Bos taurus similar to type IV alpha 6 collagen isoform A
            precursor (LOC523526), mRNA
          Length = 4990

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 231  gaggccagggattccatcaa 250
            ||||||||||||||||||||
Sbjct: 4065 gaggccagggattccatcaa 4046



to top

>ref|XM_363197.1| Magnaporthe grisea 70-15 hypothetical protein (MG08781.4) partial
           cds
          Length = 567

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 220 agctgctgtacgaggccagg 239
           ||||||||||||||||||||
Sbjct: 223 agctgctgtacgaggccagg 204



to top

>ref|XM_323481.1| Neurospora crassa OR74A hypothetical protein ( (AL513463) heat
           shock protein 80 [Neurospora crassa OR74A]  )
           (NCU04142.1) partial mRNA
          Length = 2118

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 120 gatgaggaggagggggagaagaag 143
           ||||||||||||| ||||||||||
Sbjct: 721 gatgaggaggaggaggagaagaag 744



to top

>ref|XM_953179.1| Neurospora crassa OR74A hypothetical protein (NCU07578.1) partial
           mRNA
          Length = 1344

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 114 aaagcagatgaggaggagggggag 137
           |||||||| |||||||||||||||
Sbjct: 497 aaagcagaagaggaggagggggag 474



to top

>ref|XM_956205.1| Neurospora crassa OR74A hypothetical protein ( (AL513463) heat
           shock protein 80 [Neurospora crassa OR74A]  )
           (NCU04142.1) partial mRNA
          Length = 2118

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 120 gatgaggaggagggggagaagaag 143
           ||||||||||||| ||||||||||
Sbjct: 721 gatgaggaggaggaggagaagaag 744



to top

>ref|XM_327863.1| Neurospora crassa OR74A hypothetical protein (NCU07578.1) partial
           mRNA
          Length = 1344

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 114 aaagcagatgaggaggagggggag 137
           |||||||| |||||||||||||||
Sbjct: 497 aaagcagaagaggaggagggggag 474



to top

>ref|NM_000721.2| Homo sapiens calcium channel, voltage-dependent, alpha 1E subunit
            (CACNA1E), mRNA
          Length = 9734

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 3484 gatgaggaggaggtggagaagaag 3507



to top

>gb|AC131343.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0057E15, complete sequence
          Length = 149035

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 50325 gaggaggagggggagaagaa 50306



to top

>gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosome 5, complete sequence
          Length = 227388

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    aggaggagggggagaagaag 143
              ||||||||||||||||||||
Sbjct: 204798 aggaggagggggagaagaag 204817



to top

>gb|AC158932.5| Mus musculus chromosome 3, clone RP24-338G13, complete sequence
          Length = 159429

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 123   gaggaggagggggagaagaaggtg 146
             |||||||||| |||||||||||||
Sbjct: 79089 gaggaggaggaggagaagaaggtg 79112



to top

>gb|AC162894.4| Mus musculus chromosome 3, clone RP23-326A24, complete sequence
          Length = 187598

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 123    gaggaggagggggagaagaaggtg 146
              |||||||||| |||||||||||||
Sbjct: 120704 gaggaggaggaggagaagaaggtg 120727



to top

>gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, complete sequence
          Length = 207763

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 325  tcaagtcatatgttgaagtt 344
            ||||||||||||||||||||
Sbjct: 7582 tcaagtcatatgttgaagtt 7563



to top

>gb|AC164091.3| Mus musculus BAC clone RP23-97M20 from chromosome 3, complete sequence
          Length = 218807

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 473    gaaaccaacaaacttctttt 492
              ||||||||||||||||||||
Sbjct: 101151 gaaaccaacaaacttctttt 101170



to top

>gb|AC164701.4| Mus musculus BAC clone RP24-108J12 from chromosome 17, complete
             sequence
          Length = 184296

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   gatgaggaggagggggagaagaag 143
             |||||||||||||||||| |||||
Sbjct: 62565 gatgaggaggagggggaggagaag 62588



to top

>gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0078f20,
              complete sequence
          Length = 151042

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    gaggaggagggggagaagaa 142
              ||||||||||||||||||||
Sbjct: 150161 gaggaggagggggagaagaa 150142



to top

>gb|AC116593.4| Mus musculus BAC clone RP24-91C7 from chromosome 8, complete sequence
          Length = 174603

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 30679 gaggaggagggggagaagaa 30660



to top

>gb|AC005088.3| Homo sapiens BAC clone CTA-313A17 from 7, complete sequence
          Length = 158663

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 355   acgtggaggaaggttgggtg 374
             ||||||||||||||||||||
Sbjct: 51950 acgtggaggaaggttgggtg 51969



to top

>gb|AC093734.3| Homo sapiens BAC clone RP11-16P10 from 7, complete sequence
          Length = 114085

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   ggaggagggggagaagaagg 144
             ||||||||||||||||||||
Sbjct: 13000 ggaggagggggagaagaagg 12981



to top

>gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, complete sequence
          Length = 153903

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    aggaggagggggagaagaag 143
              ||||||||||||||||||||
Sbjct: 109525 aggaggagggggagaagaag 109506



to top

>gb|DQ483781.1| Gymnogyps californianus clone 204F microsatellite sequence
          Length = 583

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 121 atgaggaggagggggagaagaagg 144
           ||||||||||||||||| ||||||
Sbjct: 234 atgaggaggagggggaggagaagg 257



to top

>ref|XM_533935.2| PREDICTED: Canis familiaris similar to Transcription initiation
            factor IIF alpha subunit (TFIIF-alpha) (Transcription
            initiation factor RAP74) (General transcription factor
            IIF polypeptide 1 74 kDa subunit protein) (LOC476731),
            mRNA
          Length = 1896

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 123  gaggaggagggggagaagaaggtgccca 150
            |||||||||| ||||||||||| |||||
Sbjct: 1267 gaggaggaggaggagaagaaggcgccca 1294



to top

>ref|XM_820621.1| Trypanosoma brucei TREU927 clone RPCI93-27M3 50S ribosomal protein
           L2 (Tb927.5.3360) partial mRNA
          Length = 1236

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 473 gaaaccaacaaacttctttt 492
           ||||||||||||||||||||
Sbjct: 615 gaaaccaacaaacttctttt 596



to top

>gb|AC125528.4| Mus musculus BAC clone RP23-365I9 from chromosome 15, complete sequence
          Length = 197376

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 119   agatgaggaggagggggagaagaa 142
             ||||||||||||||||||| ||||
Sbjct: 90482 agatgaggaggagggggaggagaa 90505



to top

>gb|AC122488.3| Mus musculus BAC clone RP24-383B2 from chromosome 17, complete
            sequence
          Length = 206003

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 123  gaggaggagggggagaagaaggtg 146
            |||||||||| |||||||||||||
Sbjct: 3162 gaggaggaggaggagaagaaggtg 3139



to top

>gb|AC125404.4| Mus musculus BAC clone RP23-10A1 from 12, complete sequence
          Length = 209092

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 123  gaggaggagggggagaagaa 142
            ||||||||||||||||||||
Sbjct: 5728 gaggaggagggggagaagaa 5747



to top

>gb|AC073886.4| Homo sapiens BAC clone RP11-101N13 from 7, complete sequence
          Length = 112568

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 123   gaggaggagggggagaagaaggtg 146
             |||||||||| |||||||||||||
Sbjct: 38675 gaggaggaggaggagaagaaggtg 38652



to top

>gb|AC011899.5| Homo sapiens BAC clone RP11-452C13 from 7, complete sequence
          Length = 214229

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    atgaggaggagggggagaag 140
              ||||||||||||||||||||
Sbjct: 169357 atgaggaggagggggagaag 169338



to top

>gb|AC005998.3| Homo sapiens PAC clone RP4-622E21 from 7, complete sequence
          Length = 96556

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 396   aagaaagacacaagagggga 415
             ||||||||||||||||||||
Sbjct: 25618 aagaaagacacaagagggga 25599



to top

>gb|AC113524.9| Mus musculus chromosome 6, clone RP23-120I17, complete sequence
          Length = 216807

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    atgaggaggagggggagaag 140
              ||||||||||||||||||||
Sbjct: 126235 atgaggaggagggggagaag 126254



to top

>gb|AC165343.3| Mus musculus BAC clone RP23-476C24 from chromosome 17, complete
             sequence
          Length = 190724

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 123   gaggaggagggggagaagaaggtg 146
             |||||||||| |||||||||||||
Sbjct: 99410 gaggaggaggaggagaagaaggtg 99387



to top

>gb|AC133425.3| Rattus norvegicus 7 BAC CH230-333I12 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 64809

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   aggaggagggggagaagaag 143
             ||||||||||||||||||||
Sbjct: 25645 aggaggagggggagaagaag 25626



to top

>emb|Z99495.1|HS441J1 Human DNA sequence from clone RP3-441J1 on chromosome 6p24 Contains the
             5' end of gene KIAA1733, complete sequence
          Length = 151213

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 605   gttgtccatgtgaaatattt 624
             ||||||||||||||||||||
Sbjct: 74237 gttgtccatgtgaaatattt 74256



to top

>ref|XM_794857.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC577282 (LOC577282), mRNA
          Length = 465

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 113 gaaagcagatgaggaggagggggagaagaagg 144
           |||||| || |||||||| |||||||||||||
Sbjct: 135 gaaagcggaggaggaggaaggggagaagaagg 166



to top

>emb|AL590998.7| Human DNA sequence from clone RP4-677A15 on chromosome 1 Contains parrt
             of the CACNA1E gene for calcium channel voltage-dependent
             alpha 1E subunit, complete sequence
          Length = 102196

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   gatgaggaggagggggagaagaag 143
             ||||||||||||| ||||||||||
Sbjct: 75077 gatgaggaggaggtggagaagaag 75100



to top

>emb|AL359928.11| Human DNA sequence from clone RP11-80D19 on chromosome 1, complete
             sequence
          Length = 63855

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 424   aagttgacaatctaggaagatata 447
             ||||||||||| ||||||||||||
Sbjct: 11393 aagttgacaatttaggaagatata 11370



to top

>emb|AL157768.6| Human DNA sequence from clone RP11-481A22 on chromosome 13, complete
             sequence
          Length = 145603

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 600   aatgtgttgtccatgtgaaatatt 623
             |||||||| |||||||||||||||
Sbjct: 12174 aatgtgttatccatgtgaaatatt 12197



to top

>gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121i21 map 11, complete
              sequence
          Length = 168186

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 120    gatgaggaggagggggagaagaag 143
              ||||||||||||| ||||||||||
Sbjct: 156638 gatgaggaggaggaggagaagaag 156661



to top

>emb|AL078590.28|HSA557H15 Human DNA sequence from clone RP11-557H15 on chromosome 6q23.1-23.3
              Contains three novel genes, the 3' part of a novel gene and
              a member A1 of family with sequence similarity 8 (FAM8A1)
              pseudogene, complete sequence
          Length = 195021

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    gaggaggagggggagaagaa 142
              ||||||||||||||||||||
Sbjct: 103621 gaggaggagggggagaagaa 103640



to top

>emb|AL031650.22|HS1018D12 Human DNA sequence from clone RP5-1018D12 on chromosome 20q11.1-11.22
             Contains part of a CDK5 regulatory subunit associated
             protein 3 (CDK5RAP3) pseudogene, the RPL31P3 gene for
             ribosomal protein L31 pseudogene 3, a novel pseudogene,
             the DEFB118 gene for defensin beta 118 and the 3' end of
             the the DEFB119 gene for defensin beta 119, complete
             sequence
          Length = 98490

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   aggaggagggggagaagaag 143
             ||||||||||||||||||||
Sbjct: 44868 aggaggagggggagaagaag 44887



to top

>gb|AC068909.31| Mus musculus BAC Clone 407f20 RPCI-23, complete sequence
          Length = 196383

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    ggaggagggggagaagaagg 144
              ||||||||||||||||||||
Sbjct: 185285 ggaggagggggagaagaagg 185266



to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 521     tgtaccatcaaacccgatgttgtt 544
               ||||||||||| ||||||||||||
Sbjct: 2540396 tgtaccatcaatcccgatgttgtt 2540373



to top

>emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmid contig 9G6
          Length = 125561

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 120   gatgaggaggagggggagaagaag 143
             ||||||||||||| ||||||||||
Sbjct: 62406 gatgaggaggaggaggagaagaag 62383



to top

>emb|AL606482.14| Mouse DNA sequence from clone RP23-360H16 on chromosome 11 Contains the
              genes for olfactory receptors MOR135-7, -8, -10 and -28,
              three olfactory receptor MOR135 pseudogenes, and the gene
              for olfactory receptor MOR157-1, complete sequence
          Length = 199115

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 120    gatgaggaggagggggagaagaag 143
              ||||||||||||| ||||||||||
Sbjct: 146333 gatgaggaggaggaggagaagaag 146310



to top

>gb|AC094105.3| Homo sapiens chromosome 5 clone RP11-468D11, complete sequence
          Length = 186314

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 119   agatgaggaggagggggagaagaa 142
             |||||||||||||| |||||||||
Sbjct: 35203 agatgaggaggaggaggagaagaa 35226



to top

>emb|AL450406.17| Mouse DNA sequence from clone RP23-262J21 on chromosome 13 Contains two
              serine (or cysteine) proteinase inhibitor clade B (Serpinb)
              pseudogenes, a G protein-coupled receptor family C (Gprc)
              pseudogene, a vomeronasal 2 receptor (V2r) or Gprc group 2
              member A related sequence (Gprc2a-rs) pseudogene, two genes
              for novel Serpinb members, the Serpinb6 gene for serine (or
              cysteine) proteinase inhibitor clade B member 6 and a CpG
              island, complete sequence
          Length = 213270

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 604    tgttgtccatgtgaaatatt 623
              ||||||||||||||||||||
Sbjct: 120350 tgttgtccatgtgaaatatt 120369



to top

>gb|BC045562.1| Homo sapiens cDNA clone IMAGE:4815142
          Length = 3092

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 355  acgtggaggaaggttgggtg 374
            ||||||||||||||||||||
Sbjct: 1855 acgtggaggaaggttgggtg 1874



to top

>gb|BC040199.1| Homo sapiens cDNA clone IMAGE:4816860
          Length = 3212

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 355  acgtggaggaaggttgggtg 374
            ||||||||||||||||||||
Sbjct: 1972 acgtggaggaaggttgggtg 1991



to top

>gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig containing Eve, the hox
              cluster, cholinesterase, and COLP5alpha genes, complete
              sequence
          Length = 796348

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 121    atgaggaggagggggagaagaagg 144
              |||||||||||| |||||||||||
Sbjct: 429285 atgaggaggaggaggagaagaagg 429262



to top

>gb|AC112673.7| Homo sapiens chromosome 8, clone RP11-212F11, complete sequence
          Length = 167547

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 382   cctgcaaagtttgcaagaaa 401
             ||||||||||||||||||||
Sbjct: 18546 cctgcaaagtttgcaagaaa 18565



to top

>gb|AY081675.1| Arabidopsis thaliana putative protein (At3g56290) mRNA, complete
           cds
          Length = 655

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 336 gttgaagttgatggcgaatacgtggaggaaggttgggtggacaa 379
           |||||||| |||||  |||| |||||||| || |||||||||||
Sbjct: 346 gttgaagtggatgggcaatatgtggaggagggatgggtggacaa 389



to top

>gb|AC009093.10| Homo sapiens chromosome 16 clone RP11-426C22, complete sequence
          Length = 207997

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   ggagaagaaggtgcccaagc 153
             ||||||||||||||||||||
Sbjct: 63525 ggagaagaaggtgcccaagc 63544



to top

>gb|AC011405.6| Homo sapiens chromosome 5 clone CTB-46B19, complete sequence
          Length = 184541

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 617    aaatattttttgatgagcatatat 640
              ||||||||| ||||||||||||||
Sbjct: 136810 aaatattttatgatgagcatatat 136833



to top

>gb|AY062503.1| Arabidopsis thaliana putative protein (At3g56290; F18O21_250) mRNA,
           complete cds
          Length = 744

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 336 gttgaagttgatggcgaatacgtggaggaaggttgggtggacaa 379
           |||||||| |||||  |||| |||||||| || |||||||||||
Sbjct: 373 gttgaagtggatgggcaatatgtggaggagggatgggtggacaa 416



to top

>gb|AC157498.2| Pan troglodytes BAC clone CH251-412M6 from chromosome unknown, complete
              sequence
          Length = 159994

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 120    gatgaggaggagggggagaagaag 143
              ||||||||||| ||||||||||||
Sbjct: 154324 gatgaggaggaaggggagaagaag 154347



to top

>gb|AC154751.2| Mus musculus BAC clone RP24-399L21 from chromosome 14, complete
             sequence
          Length = 176992

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   atgaggaggagggggagaagaagg 144
             |||||||||| |||||||||||||
Sbjct: 14082 atgaggaggatggggagaagaagg 14059



to top

>gb|AY958432.1| Homo sapiens methionine sulfoxide reductase gene, complete cds,
              alternatively spliced
          Length = 379048

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 382    cctgcaaagtttgcaagaaa 401
              ||||||||||||||||||||
Sbjct: 364927 cctgcaaagtttgcaagaaa 364908



to top

>gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, region 30F-31B, BAC clone
             BACR29P12, complete sequence
          Length = 161446

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 123   gaggaggagggggagaagaaggtg 146
             ||||||||||||||| ||||||||
Sbjct: 73752 gaggaggagggggaggagaaggtg 73729



to top

>gb|AC010409.6|AC010409 Homo sapiens chromosome 5 clone CTD-2158P22, complete sequence
          Length = 117334

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 113   gaaagcagatgaggaggagggggagaagaagg 144
             ||||| ||| ||||||||||||||| ||||||
Sbjct: 80026 gaaagaagaggaggaggagggggaggagaagg 79995



to top

>gb|AF212996.1|AF212996 Neurospora crassa heat shock protein 80 gene, complete cds
          Length = 3556

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 1923 gatgaggaggaggaggagaagaag 1946



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 125      ggaggagggggagaagaagg 144
                ||||||||||||||||||||
Sbjct: 13660752 ggaggagggggagaagaagg 13660771



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 123      gaggaggagggggagaagaa 142
                ||||||||||||||||||||
Sbjct: 16409726 gaggaggagggggagaagaa 16409707



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 113      gaaagcagatgaggaggagg 132
                ||||||||||||||||||||
Sbjct: 23838280 gaaagcagatgaggaggagg 23838299



to top

>dbj|AB197319.1| Uncultured bacterium C23O gene for catechol 2,3-dioxygenase,
           partial cds, clone: R2-375-103b
          Length = 375

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 172 tcaccgaggcgctggacttc 191
           ||||||||||||||||||||
Sbjct: 75  tcaccgaggcgctggacttc 94



to top

>gb|AC104599.4| Homo sapiens BAC clone RP11-652K9 from 2, complete sequence
          Length = 80146

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 46470 gaggaggagggggagaagaa 46451



to top

>gb|AC079895.7| Homo sapiens BAC clone RP11-749M12 from 2, complete sequence
          Length = 149309

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 35604 gaggaggagggggagaagaa 35585



to top

>gb|AC113618.5| Homo sapiens BAC clone RP11-1367O10 from 2, complete sequence
          Length = 199917

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 99380 gaggaggagggggagaagaa 99361



to top

>gb|AC154838.2| Mus musculus BAC clone RP23-64F2 from chromosome 14, complete sequence
          Length = 224431

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 123   gaggaggagggggagaagaaggtg 146
             ||||||||||||||| ||||||||
Sbjct: 34881 gaggaggagggggaggagaaggtg 34858



to top

>gb|AC156835.2| Mus musculus BAC clone RP23-322L4 from chromosome 9, complete sequence
          Length = 216124

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 605    gttgtccatgtgaaatattt 624
              ||||||||||||||||||||
Sbjct: 150373 gttgtccatgtgaaatattt 150354



to top

>gb|AC154245.2| Mus musculus BAC clone RP24-326A24 from chromosome 14, complete
             sequence
          Length = 185892

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 121   atgaggaggagggggagaagaagg 144
             |||||||||| |||||||||||||
Sbjct: 37487 atgaggaggatggggagaagaagg 37510



to top

>gb|AC155820.2| Mus musculus BAC clone RP23-360J10 from chromosome 10, complete sequence
          Length = 221801

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    aagcagatgaggaggagggg 134
              ||||||||||||||||||||
Sbjct: 123648 aagcagatgaggaggagggg 123629



to top

>gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, complete sequence
          Length = 183129

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 123   gaggaggagggggagaagaa 142
             ||||||||||||||||||||
Sbjct: 83805 gaggaggagggggagaagaa 83824



to top

>ref|NM_001015527.1| Bos taurus general transcription factor IIF, polypeptide 1, 74kDa
            (GTF2F1), mRNA
          Length = 1788

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 123  gaggaggagggggagaagaaggtgccca 150
            |||||||||| ||||||||||| |||||
Sbjct: 1166 gaggaggaggaggagaagaaggcgccca 1193



to top

>gb|AC134312.3| Homo sapiens chromosome 16 clone RP11-863P13, complete sequence
          Length = 205610

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   ggagaagaaggtgcccaagc 153
             ||||||||||||||||||||
Sbjct: 94581 ggagaagaaggtgcccaagc 94600



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 169     acatcaccgaggcgctggac 188
               ||||||||||||||||||||
Sbjct: 6749797 acatcaccgaggcgctggac 6749816



to top

>gb|AC127455.4| Homo sapiens chromosome 16 clone CTD-3057O21, complete sequence
          Length = 184641

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 134  ggagaagaaggtgcccaagc 153
            ||||||||||||||||||||
Sbjct: 2107 ggagaagaaggtgcccaagc 2088



to top

>gb|AC092758.3| Papio anubis clone RP41-22J16, complete sequence
          Length = 171690

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ggaggagggggagaagaagg 144
             ||||||||||||||||||||
Sbjct: 33140 ggaggagggggagaagaagg 33159



to top

>gb|AC010629.8| Homo sapiens chromosome 5 clone CTD-2213L16, complete sequence
          Length = 82882

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   gatgaggaggagggggagaagaag 143
             ||||||||||||| ||||||||||
Sbjct: 60004 gatgaggaggaggaggagaagaag 60027



to top

>dbj|AP002869.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0554D10
          Length = 158723

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 123   gaggaggagggggagaagaaggtg 146
             |||||||||| |||||||||||||
Sbjct: 84082 gaggaggaggaggagaagaaggtg 84059



to top

>dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0030C08
          Length = 163423

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   gaaagcagatgaggaggagg 132
             ||||||||||||||||||||
Sbjct: 59946 gaaagcagatgaggaggagg 59965



to top

>emb|BX323545.11| Mouse DNA sequence from clone RP23-358N13 on chromosome 4, complete
             sequence
          Length = 47574

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   gaaagcagatgaggaggagg 132
             ||||||||||||||||||||
Sbjct: 11145 gaaagcagatgaggaggagg 11164



to top

>dbj|AK120056.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000O15, full
           insert sequence
          Length = 1895

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 123 gaggaggagggggagaagaaggtg 146
           |||||||||| |||||||||||||
Sbjct: 78  gaggaggaggaggagaagaaggtg 55



to top

>gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E subunit (CACNA1E) gene, exons 7-49,
              and partial cds, alternatively spliced
          Length = 316704

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 120    gatgaggaggagggggagaagaag 143
              ||||||||||||| ||||||||||
Sbjct: 132566 gatgaggaggaggtggagaagaag 132589



to top

>gb|AC002479.1|AC002479 Human BAC clone GS1-9G13 from 5p15.2, complete sequence
          Length = 88682

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   gatgaggaggagggggagaagaag 143
             ||||||||||||| ||||||||||
Sbjct: 24407 gatgaggaggaggaggagaagaag 24430



to top

>dbj|AK108051.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-137-H02, full
           insert sequence
          Length = 1184

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ggaggagggggagaagaagg 144
           ||||||||||||||||||||
Sbjct: 426 ggaggagggggagaagaagg 445



to top

>dbj|AK105168.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-F02, full
           insert sequence
          Length = 801

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 123 gaggaggagggggagaagaaggtg 146
           |||||||||| |||||||||||||
Sbjct: 77  gaggaggaggaggagaagaaggtg 54



to top

>gb|AC154040.7| Mus musculus 10 BAC RP23-348E15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 210862

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    gaggaggagggggagaagaa 142
              ||||||||||||||||||||
Sbjct: 151601 gaggaggagggggagaagaa 151620



to top

>gb|AF151527.1|AF151527 Hyphantria cunea serpin gene, complete cds
          Length = 18665

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 425  agttgacaatctaggaagatatat 448
            |||||||||||||| |||||||||
Sbjct: 7227 agttgacaatctagcaagatatat 7250



to top

>gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36 of 83 of the complete
              sequence
          Length = 264225

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 123    gaggaggagggggagaagaaggtg 146
              ||||||||||||||| ||||||||
Sbjct: 174616 gaggaggagggggaggagaaggtg 174639



to top

>gb|AC005666.1|AC005666 Homo sapiens chromosome 17, clone hRPK.112_H_10, complete sequence
          Length = 158905

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ggaggagggggagaagaagg 144
             ||||||||||||||||||||
Sbjct: 76710 ggaggagggggagaagaagg 76729



to top

>gb|AC005734.1|AC005734 Drosophila melanogaster DNA sequence (P1s DS00058 (D296), DS02068 (D297),
              and DS07249 (D318)), complete sequence
          Length = 155335

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 123    gaggaggagggggagaagaaggtg 146
              ||||||||||||||| ||||||||
Sbjct: 112909 gaggaggagggggaggagaaggtg 112932



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 123      gaggaggagggggagaagaa 142
                ||||||||||||||||||||
Sbjct: 16500730 gaggaggagggggagaagaa 16500711



to top

>emb|AL731609.2|OSJN00259 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0079M09,
             complete sequence
          Length = 187359

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ggaggagggggagaagaagg 144
             ||||||||||||||||||||
Sbjct: 55360 ggaggagggggagaagaagg 55379



to top

>emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chromosome 2, complete
             sequence
          Length = 229583

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 121   atgaggaggagggggagaagaagg 144
             |||||||||||| |||||||||||
Sbjct: 77262 atgaggaggaggaggagaagaagg 77285



to top

>gb|AC125520.3| Mus musculus BAC clone RP24-281J17 from 8, complete sequence
          Length = 178227

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    ccagggattccatcaaagat 254
              ||||||||||||||||||||
Sbjct: 119236 ccagggattccatcaaagat 119255



to top

>gb|AC127255.4| Mus musculus BAC clone RP24-291I7 from 5, complete sequence
          Length = 153492

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   aggaggagggggagaagaag 143
             ||||||||||||||||||||
Sbjct: 44409 aggaggagggggagaagaag 44390



to top

>gb|AC068908.21| Mus musculus BAC Clone 389o18 RPCI-23, complete sequence
          Length = 198576

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    ggaggagggggagaagaagg 144
              ||||||||||||||||||||
Sbjct: 117905 ggaggagggggagaagaagg 117886



to top

>gb|AC136837.1| Homo sapiens chromosome 16 clone RP11-483N11, complete sequence
          Length = 65756

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 134  ggagaagaaggtgcccaagc 153
            ||||||||||||||||||||
Sbjct: 6679 ggagaagaaggtgcccaagc 6698



to top

>gb|AC161461.5| Mus musculus BAC clone RP23-104L7 from chromosome 13, complete sequence
          Length = 234110

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 604    tgttgtccatgtgaaatatt 623
              ||||||||||||||||||||
Sbjct: 151635 tgttgtccatgtgaaatatt 151616



to top

>dbj|AB209499.1| Homo sapiens mRNA for calcium channel, voltage-dependent, alpha 1E
            subunit variant protein
          Length = 11702

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 2116 gatgaggaggaggtggagaagaag 2139



to top

>gb|AC167020.3| Mus musculus BAC clone RP23-201I6 from chromosome 1, complete sequence
          Length = 209249

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 121    atgaggaggagggggagaagaagg 144
              |||||||||||| |||||||||||
Sbjct: 207810 atgaggaggaggaggagaagaagg 207833



to top

>emb|AL732615.15| Mouse DNA sequence from clone RP23-190O8 on chromosome 4, complete
              sequence
          Length = 189819

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    aggaggagggggagaagaag 143
              ||||||||||||||||||||
Sbjct: 108560 aggaggagggggagaagaag 108579



to top

>emb|AL928553.8| Mouse DNA sequence from clone RP23-312N5 on chromosome 2, complete
             sequence
          Length = 148202

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 246   atcaaagatgaagggaggat 265
             ||||||||||||||||||||
Sbjct: 28876 atcaaagatgaagggaggat 28895



to top

>emb|AL953913.5| Mouse DNA sequence from clone RP23-390H16 on chromosome 11, complete
             sequence
          Length = 60880

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ggaggagggggagaagaagg 144
             ||||||||||||||||||||
Sbjct: 43105 ggaggagggggagaagaagg 43124



to top

>gb|L27745.1|HUMVOCC Homo sapiens voltage-operated calcium channel, alpha-1 subunit mRNA,
            complete cds
          Length = 7110

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 3316 gatgaggaggaggtggagaagaag 3339



to top

>emb|AL672100.7| Mouse DNA sequence from clone RP23-125A1 on chromosome 2, complete
            sequence
          Length = 196421

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  atgaggaggagggggagaag 140
            ||||||||||||||||||||
Sbjct: 5784 atgaggaggagggggagaag 5803



to top

>emb|AL837521.6| Mouse DNA sequence from clone RP23-28I8 on chromosome 4, complete
             sequence
          Length = 230493

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 114   aaagcagatgaggaggagggggag 137
             |||||||| |||||||||||||||
Sbjct: 54820 aaagcagaggaggaggagggggag 54843



to top

>gb|L29385.1|HUMHVDCA Homo sapiens (clone pcDNA-alpha1E-3) voltage-dependent calcium
            channel alpha-1E-3 subunit mRNA, complete cds
          Length = 7089

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 3484 gatgaggaggaggtggagaagaag 3507



to top

>gb|L29384.1|HUMHVDC Homo sapiens (clone pcDNA-alpha1E-1) voltage-dependent calcium
            channel alpha-1E-1 subunit mRNA, complete cds
          Length = 7032

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 120  gatgaggaggagggggagaagaag 143
            ||||||||||||| ||||||||||
Sbjct: 3427 gatgaggaggaggtggagaagaag 3450


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,494,726
Number of Sequences: 3902068
Number of extensions: 6494726
Number of successful extensions: 147923
Number of sequences better than 10.0: 210
Number of HSP's better than 10.0 without gapping: 210
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 146796
Number of HSP's gapped (non-prelim): 1126
length of query: 645
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 622
effective length of database: 17,143,297,704
effective search space: 10663131171888
effective search space used: 10663131171888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top