ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal30e19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ234421.1|HVU234421 Hordeum vulgare partial mRNA; clone cMW... 276 2e-71
2gb|BT016568.1| Zea mays clone Contig401 mRNA sequence 48 0.008
3gb|DQ427308.1| Sorghum propinquum locus CSU535 genomic sequence 42 0.50
4gb|DQ427307.1| Sorghum bicolor voucher PI585454 locus CSU535 gen... 42 0.50
5gb|DQ427306.1| Sorghum bicolor voucher PI267539 locus CSU535 gen... 42 0.50
6gb|DQ427305.1| Sorghum bicolor voucher PI267408 locus CSU535 gen... 42 0.50
7gb|DQ427304.1| Sorghum bicolor voucher PI221607 locus CSU535 gen... 42 0.50
8gb|DQ427303.1| Sorghum bicolor voucher PI152702 locus CSU535 gen... 42 0.50
9gb|DQ427302.1| Sorghum bicolor voucher NSL92371 locus CSU535 gen... 42 0.50
10gb|DQ427301.1| Sorghum bicolor voucher NSL87902b locus CSU535 ge... 42 0.50
11gb|DQ427300.1| Sorghum bicolor voucher NSL87902a locus CSU535 ge... 42 0.50
12gb|DQ427299.1| Sorghum bicolor voucher NSL87666 locus CSU535 gen... 42 0.50
13gb|DQ427298.1| Sorghum bicolor voucher NSL77217 locus CSU535 gen... 42 0.50
14gb|DQ427297.1| Sorghum bicolor voucher NSL77034 locus CSU535 gen... 42 0.50
15gb|DQ427296.1| Sorghum bicolor voucher NSL56174 locus CSU535 gen... 42 0.50
16gb|DQ427295.1| Sorghum bicolor voucher NSL56003 locus CSU535 gen... 42 0.50
17gb|DQ427294.1| Sorghum bicolor voucher NSL55243 locus CSU535 gen... 42 0.50
18gb|DQ427293.1| Sorghum bicolor voucher NSL51365 locus CSU535 gen... 42 0.50
19gb|DQ427292.1| Sorghum bicolor voucher NSL51030 locus CSU535 gen... 42 0.50
20gb|DQ427291.1| Sorghum bicolor voucher NSL50875 locus CSU535 gen... 42 0.50
21gb|DQ427290.1| Sorghum bicolor voucher BTx623 locus CSU535 genom... 42 0.50
22ref|NM_064268.1| Caenorhabditis elegans Serpentine Receptor, cla... 40 2.0
23ref|NM_064267.1| Caenorhabditis elegans Serpentine Receptor, cla... 40 2.0
24gb|AY107844.1| Zea mays PCO146552 mRNA sequence 40 2.0
25emb|Z81124.1|CET21B4 Caenorhabditis elegans Cosmid T21B4, comple... 40 2.0
26gb|AC168051.3| Mus musculus BAC clone RP23-169M5 from chromosome... 40 2.0
27ref|XM_586934.2| PREDICTED: Bos taurus similar to General transc... 38 7.8
28ref|XM_877865.1| PREDICTED: Bos taurus similar to General transc... 38 7.8
29gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 38 7.8
30gb|AC160760.4| Mus musculus BAC clone RP23-449G13 from chromosom... 38 7.8
31gb|AC018767.3|AC018767 Homo sapiens chromosome 16 clone RP11-279... 38 7.8
32gb|AC132312.4| Mus musculus BAC clone RP24-298A20 from 12, compl... 38 7.8
33gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complet... 38 7.8
34gb|AC141637.3| Mus musculus BAC clone RP23-424D5 from 9, complet... 38 7.8
35dbj|AP006114.1| Lotus japonicus genomic DNA, chromosome 3, clone... 38 7.8
36gb|AC160112.2| Mus musculus BAC clone RP24-80F17 from chromosome... 38 7.8
37gb|AC136457.3| Mus musculus BAC clone RP23-76G19 from chromosome... 38 7.8
38emb|AL731783.10| Mouse DNA sequence from clone RP23-124E18 on ch... 38 7.8

>emb|AJ234421.1|HVU234421 Hordeum vulgare partial mRNA; clone cMWG0682
          Length = 577

 Score =  276 bits (139), Expect = 2e-71
 Identities = 157/162 (96%), Gaps = 2/162 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cactggacgggcaacctacccaaagtcttcgtgataggcagcgtggtcgccctggcttgc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112 cactggacgggcaacctacccaaagtcttcgtgataggcagcgtggtcgccctggcttgc 171

                                                                       
Query: 61  accttcgacaaggggctactgaccaaggctctcgtgttcggaacggcaagaaggtttgca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 accttcgacaaggggctactgaccaaggctctcgtgttcggaacggcaagaaggtttgca 231

                                                     
Query: 121 ggacccagggaagaagataggaacccaaacatccgcgcctat 162
           |||||   ||||||||||||| | ||||||||||||||||||
Sbjct: 232 ggacc--aggaagaagatagggaaccaaacatccgcgcctat 271



to top

>gb|BT016568.1| Zea mays clone Contig401 mRNA sequence
          Length = 845

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 46  gtcgccctggcttgcaccttcgac 69
           ||||||||||||||||||||||||
Sbjct: 136 gtcgccctggcttgcaccttcgac 159



to top

>gb|DQ427308.1| Sorghum propinquum locus CSU535 genomic sequence
          Length = 696

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427307.1| Sorghum bicolor voucher PI585454 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427306.1| Sorghum bicolor voucher PI267539 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427305.1| Sorghum bicolor voucher PI267408 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427304.1| Sorghum bicolor voucher PI221607 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427303.1| Sorghum bicolor voucher PI152702 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427302.1| Sorghum bicolor voucher NSL92371 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427301.1| Sorghum bicolor voucher NSL87902b locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427300.1| Sorghum bicolor voucher NSL87902a locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427299.1| Sorghum bicolor voucher NSL87666 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427298.1| Sorghum bicolor voucher NSL77217 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427297.1| Sorghum bicolor voucher NSL77034 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427296.1| Sorghum bicolor voucher NSL56174 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427295.1| Sorghum bicolor voucher NSL56003 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427294.1| Sorghum bicolor voucher NSL55243 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427293.1| Sorghum bicolor voucher NSL51365 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427292.1| Sorghum bicolor voucher NSL51030 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427291.1| Sorghum bicolor voucher NSL50875 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>gb|DQ427290.1| Sorghum bicolor voucher BTx623 locus CSU535 genomic sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  gtcgccctggcttgcaccttcgacaaggggctactgaccaaggctctcgtgttcggaacg 105
           |||||||||||||||||||| |||   ||  |  ||||||||||  || | ||||| |||
Sbjct: 76  gtcgccctggcttgcacctttgacggtggattgttgaccaaggccgtcatattcggcacg 135

                            
Query: 106 gcaagaaggtttgcagg 122
           || ||||||||||||||
Sbjct: 136 gcgagaaggtttgcagg 152



to top

>ref|NM_064268.1| Caenorhabditis elegans Serpentine Receptor, class H family member
           (srh-67) (srh-67) mRNA, complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 105 ggcaagaaggtttgcaggac 124
           ||||||||||||||||||||
Sbjct: 797 ggcaagaaggtttgcaggac 778



to top

>ref|NM_064267.1| Caenorhabditis elegans Serpentine Receptor, class H family member
           (srh-68) (srh-68) mRNA, complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 105 ggcaagaaggtttgcaggac 124
           ||||||||||||||||||||
Sbjct: 797 ggcaagaaggtttgcaggac 778



to top

>gb|AY107844.1| Zea mays PCO146552 mRNA sequence
          Length = 823

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 58  tgcaccttcgacaaggggctactgaccaaggctctc 93
           |||||| | ||| ||||||| |||||||||||||||
Sbjct: 421 tgcacccttgaccaggggctcctgaccaaggctctc 456



to top

>emb|Z81124.1|CET21B4 Caenorhabditis elegans Cosmid T21B4, complete sequence
          Length = 37797

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   ggcaagaaggtttgcaggac 124
             ||||||||||||||||||||
Sbjct: 19787 ggcaagaaggtttgcaggac 19768



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   ggcaagaaggtttgcaggac 124
             ||||||||||||||||||||
Sbjct: 18104 ggcaagaaggtttgcaggac 18085



to top

>gb|AC168051.3| Mus musculus BAC clone RP23-169M5 from chromosome 8, complete sequence
          Length = 222981

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    caggacccagggaagaagat 138
              ||||||||||||||||||||
Sbjct: 106797 caggacccagggaagaagat 106778



to top

>ref|XM_586934.2| PREDICTED: Bos taurus similar to General transcription factor 3C
            polypeptide 1 (Transcription factor IIIC-alpha subunit)
            (TF3C-alpha) (TFIIIC 220 kDa subunit) (TFIIIC220) (TFIIIC
            box B-binding subunit), transcript variant 1 (LOC509874),
            mRNA
          Length = 7105

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 120  aggacccagggaagaagat 138
            |||||||||||||||||||
Sbjct: 3614 aggacccagggaagaagat 3632



to top

>ref|XM_877865.1| PREDICTED: Bos taurus similar to General transcription factor 3C
            polypeptide 1 (Transcription factor IIIC-alpha subunit)
            (TF3C-alpha) (TFIIIC 220 kDa subunit) (TFIIIC220) (TFIIIC
            box B-binding subunit), transcript variant 2 (LOC509874),
            mRNA
          Length = 7132

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 120  aggacccagggaagaagat 138
            |||||||||||||||||||
Sbjct: 3614 aggacccagggaagaagat 3632



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 101     gaacggcaagaaggtttgc 119
               |||||||||||||||||||
Sbjct: 3994257 gaacggcaagaaggtttgc 3994239



to top

>gb|AC160760.4| Mus musculus BAC clone RP23-449G13 from chromosome 17, complete
             sequence
          Length = 174449

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 113   ggtttgcaggacccaggga 131
             |||||||||||||||||||
Sbjct: 68209 ggtttgcaggacccaggga 68227



to top

>gb|AC018767.3|AC018767 Homo sapiens chromosome 16 clone RP11-279O17, complete sequence
          Length = 159857

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    cgacaaggggctactgacc 84
             |||||||||||||||||||
Sbjct: 85711 cgacaaggggctactgacc 85729



to top

>gb|AC132312.4| Mus musculus BAC clone RP24-298A20 from 12, complete sequence
          Length = 177464

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   caggacccagggaagaaga 137
             |||||||||||||||||||
Sbjct: 55017 caggacccagggaagaaga 55035



to top

>gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complete sequence
          Length = 206831

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 127   agggaagaagataggaacc 145
             |||||||||||||||||||
Sbjct: 58378 agggaagaagataggaacc 58396



to top

>gb|AC141637.3| Mus musculus BAC clone RP23-424D5 from 9, complete sequence
          Length = 183859

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 127   agggaagaagataggaacc 145
             |||||||||||||||||||
Sbjct: 19461 agggaagaagataggaacc 19443



to top

>dbj|AP006114.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT43M15, TM0198a,
             complete sequence
          Length = 75051

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 131   aagaagataggaacccaaa 149
             |||||||||||||||||||
Sbjct: 25103 aagaagataggaacccaaa 25085



to top

>gb|AC160112.2| Mus musculus BAC clone RP24-80F17 from chromosome 12, complete
            sequence
          Length = 230823

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 119  caggacccagggaagaaga 137
            |||||||||||||||||||
Sbjct: 8340 caggacccagggaagaaga 8322



to top

>gb|AC136457.3| Mus musculus BAC clone RP23-76G19 from chromosome 13, complete sequence
          Length = 204369

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 133    gaagataggaacccaaaca 151
              |||||||||||||||||||
Sbjct: 176795 gaagataggaacccaaaca 176813



to top

>emb|AL731783.10| Mouse DNA sequence from clone RP23-124E18 on chromosome 2, complete
              sequence
          Length = 207209

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 125    ccagggaagaagataggaa 143
              |||||||||||||||||||
Sbjct: 161224 ccagggaagaagataggaa 161242


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 923,439
Number of Sequences: 3902068
Number of extensions: 923439
Number of successful extensions: 57649
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57562
Number of HSP's gapped (non-prelim): 86
length of query: 162
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 140
effective length of database: 17,147,199,772
effective search space: 2400607968080
effective search space used: 2400607968080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top