Clone Information

BLAST Search Result

Clone Name	baal29p13
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|XM_478932.1\| Oryza sativa (japonica cultivar-group), mRNA	256	7e-65
2	dbj\|AK099482.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	256	7e-65
3	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	159	1e-35
4	dbj\|AP005149.4\| Oryza sativa (japonica cultivar-group) genomic D...	159	1e-35
5	dbj\|AP003985.4\| Oryza sativa (japonica cultivar-group) genomic D...	159	1e-35
6	ref\|XM_468892.1\| Oryza sativa (japonica cultivar-group), mRNA	82	2e-12
7	dbj\|AK102551.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	82	2e-12
8	gb\|AC156616.5\| Mus musculus chromosome 3, clone RP24-158L2, comp...	50	0.008
9	gb\|AC157364.6\| Mus musculus chromosome 3, clone RP23-324P1, comp...	50	0.008
10	gb\|AC102854.12\| Mus musculus chromosome 3, clone RP24-493E20, co...	50	0.008
11	gb\|AF519811.1\| Lagenaria siceraria cyclin D3.2 protein mRNA, com...	48	0.032
12	gb\|AC108909.15\| Mus musculus chromosome 3, clone RP24-245I16, co...	46	0.13
13	gb\|AC133601.3\| Mus musculus BAC clone RP24-179O1 from chromosome...	46	0.13
14	ref\|XM_756136.1\| Ustilago maydis 521 hypothetical protein (UM050...	46	0.13
15	gb\|AC131113.4\| Mus musculus BAC clone RP24-155C13 from chromosom...	46	0.13
16	gb\|AC105301.44\| Mus musculus strain C57BL/6J clone rp23-317h14 m...	44	0.50
17	gb\|AC109195.27\| Mus musculus chromosome 15, clone RP24-212B11, c...	44	0.50
18	ref\|NM_175138.2\| Mus musculus dynein, axonemal, intermediate cha...	44	0.50
19	ref\|XM_958850.1\| Neurospora crassa OR74A hypothetical protein (N...	44	0.50
20	gb\|AC104277.2\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.50
21	ref\|XM_329974.1\| Neurospora crassa OR74A hypothetical protein (N...	44	0.50
22	gb\|AC145952.3\| Pan troglodytes BAC clone RP43-18D16 from 7, comp...	44	0.50
23	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	44	0.50
24	gb\|AC166178.10\| Mus musculus 6 BAC RP24-414G20 (Roswell Park Can...	44	0.50
25	gb\|AC116106.18\| Mus musculus chromosome 16, clone RP23-23D5, com...	44	0.50
26	gb\|AC110818.5\| Mus musculus BAC clone RP23-198H8 from 16, comple...	44	0.50
27	gb\|AC117574.7\| Mus musculus chromosome 5, clone RP23-32E20, comp...	44	0.50
28	gb\|AC083867.7\| Homo sapiens chromosome 7 clone RP11-183I20, comp...	44	0.50
29	emb\|AL591004.3\| Human DNA sequence from clone RP11-497F24 on chr...	44	0.50
30	ref\|XM_505002.1\| Yarrowia lipolytica CLIB122, YALI0F04686g predi...	44	0.50
31	gb\|AC157572.4\| Mus musculus BAC clone RP23-79O10 from chromosome...	44	0.50
32	emb\|AL604022.21\| Mouse DNA sequence from clone RP23-449P23 on ch...	44	0.50
33	emb\|BX294020.1\|NC7F4 Neurospora crassa DNA linkage group V Cosmi...	44	0.50
34	gb\|AC159323.3\| Mus musculus BAC clone RP23-6I8 from chromosome 1...	44	0.50
35	gb\|AC158355.2\| Mus musculus BAC clone RP24-374N16 from chromosom...	44	0.50
36	emb\|CR752647.6\| Mouse DNA sequence from clone RP24-115K8 on chro...	44	0.50
37	gb\|AC154839.3\| Mus musculus BAC clone RP23-61L24 from chromosome...	44	0.50
38	gb\|AC155301.2\| Mus musculus BAC clone RP24-216J21 from chromosom...	44	0.50
39	dbj\|AK047808.1\| Mus musculus adult male corpus striatum cDNA, RI...	44	0.50
40	dbj\|AK030213.1\| Mus musculus adult male testis cDNA, RIKEN full-...	44	0.50
41	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.50
42	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.50
43	gb\|AC098695.2\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.50
44	emb\|AL713898.9\| Mouse DNA sequence from clone RP23-253D13 on chr...	44	0.50
45	gb\|AC091254.77\| Mus musculus strain C57BL/6J clone rp23-364j24 m...	44	0.50
46	gb\|AC138666.6\| Mus musculus chromosome 5, clone RP24-140D11, com...	44	0.50
47	emb\|CR382132.1\| Yarrowia lipolytica chromosome F of strain CLIB1...	44	0.50
48	emb\|AL831723.8\| Mouse DNA sequence from clone RP23-100C7 on chro...	44	0.50
49	emb\|AL807242.7\| Mouse DNA sequence from clone RP23-152G19 on chr...	44	0.50
50	gb\|AC105262.3\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.50
51	ref\|NM_148504.1\| Arabidopsis thaliana unknown protein AT1G33135 ...	42	2.0
52	gb\|AC121552.14\| Mus musculus chromosome 19, clone RP24-145I16, c...	42	2.0
53	ref\|XM_468530.1\| Oryza sativa (japonica cultivar-group), mRNA	42	2.0
54	gb\|AC120543.7\| Mus musculus chromosome 8, clone RP23-330A24, com...	42	2.0
55	gb\|AC161798.6\| Mus musculus chromosome 7, clone RP23-267I20, com...	42	2.0
56	gb\|BT018190.1\| Zea mays clone EL01N0558H06.c mRNA sequence	42	2.0
57	gb\|AC009256.9\| Drosophila melanogaster clone BACR03G18, complete...	42	2.0
58	gb\|AC122791.13\| Mus musculus chromosome 13, clone RP24-266G22, c...	42	2.0
59	ref\|XM_867181.1\| PREDICTED: Bos taurus similar to Olfactory guan...	42	2.0
60	ref\|XM_603081.2\| PREDICTED: Bos taurus similar to Y55F3AM.9 (LOC...	42	2.0
61	gb\|AC132595.3\| Mus musculus BAC clone RP24-229G7 from chromosome...	42	2.0
62	gb\|AC124437.4\| Mus musculus BAC clone RP24-257N6 from chromosome...	42	2.0
63	ref\|NM_011097.1\| Mus musculus paired-like homeodomain transcript...	42	2.0
64	gb\|AC110564.7\| Mus musculus chromosome 12, clone RP23-292A16, co...	42	2.0
65	gb\|AC159641.2\| Mus musculus BAC clone RP23-465F1 from chromosome...	42	2.0
66	gb\|AC129013.3\| Mus musculus BAC clone RP24-550P17 from chromosom...	42	2.0
67	gb\|AC118227.12\| Mus musculus chromosome 15, clone RP23-379H6, co...	42	2.0
68	emb\|CT010522.7\| Mouse DNA sequence from clone RP23-310H3 on chro...	42	2.0
69	gb\|AC131653.4\| Mus musculus BAC clone RP23-220N8 from chromosome...	42	2.0
70	gb\|AC135907.1\| Genomic sequence for Oryza sativa, Nipponbare str...	42	2.0
71	gb\|AC121967.3\| Mus musculus BAC clone RP24-268P11 from chromosom...	42	2.0
72	gb\|AC121826.3\| Mus musculus BAC clone RP23-470O13 from chromosom...	42	2.0
73	gb\|AC132600.3\| Mus musculus BAC clone RP24-134A5 from chromosome...	42	2.0
74	ref\|XM_724473.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	42	2.0
75	ref\|XM_726211.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	42	2.0
76	gb\|AC111103.7\| Mus musculus chromosome 16, clone RP23-187G7, com...	42	2.0
77	gb\|AC162909.2\| Mus musculus BAC clone RP24-308O19 from chromosom...	42	2.0
78	gb\|AC120138.9\| Mus musculus chromosome 1, clone RP23-283D3, comp...	42	2.0
79	gb\|AC165968.3\| Mus musculus BAC clone RP23-181K4 from chromosome...	42	2.0
80	gb\|AC109169.13\| Mus musculus chromosome 6, clone RP23-5D6, compl...	42	2.0
81	gb\|AC160032.7\| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cance...	42	2.0
82	emb\|AL357713.11\| Human DNA sequence from clone RP11-3J23 on chro...	42	2.0
83	gb\|AC119801.14\| Mus musculus, clone RP23-54N13, complete sequence	42	2.0
84	emb\|AL109924.20\|HSDJ495K2 Human DNA sequence from clone RP3-495K...	42	2.0
85	gb\|AC134175.1\| Drosophila pseudoobscura FOSMID DPSF1-548A9 (Chi...	42	2.0
86	gb\|AC096051.7\| Rattus norvegicus 10 BAC CH230-21G1 (Children's H...	42	2.0
87	gb\|AC107619.1\| Genomic sequence for Oryza sativa, Nipponbare str...	42	2.0
88	gb\|AE015928.1\| Bacteroides thetaiotaomicron VPI-5482, complete g...	42	2.0
89	gb\|AC157950.2\| Mus musculus BAC clone RP23-128A23 from chromosom...	42	2.0
90	gb\|AC154264.2\| Mus musculus BAC clone RP24-316B2 from chromosome...	42	2.0
91	gb\|AC157773.6\| Mus musculus chromosome 8, clone RP24-161L20, com...	42	2.0
92	gb\|AC157782.7\| Mus musculus chromosome 7, clone RP23-86L13, comp...	42	2.0
93	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.0
94	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.0
95	gb\|AC083869.2\|AC083869 Homo sapiens chromosome 7 clone RP11-733N...	42	2.0
96	gb\|AC021045.2\|AC021045 Arabidopsis thaliana chromosome I BAC T9L...	42	2.0
97	gb\|AC009541.16\|AC009541 Human Chromosome 7 clone RP11-233L24, co...	42	2.0
98	dbj\|AP004043.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.0
99	dbj\|AP005385.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.0
100	dbj\|AP005293.2\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.0
101	dbj\|AK066974.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.0
102	gb\|AF137263.1\|AF137263 Bacteroides thetaiotaomicron 30S ribosoma...	42	2.0
103	dbj\|AK058978.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.0
104	emb\|CT571242.10\| Mouse DNA sequence from clone RP24-82P13 on chr...	42	2.0
105	gb\|AE003501.4\| Drosophila melanogaster chromosome X, section 53 ...	42	2.0
106	gb\|AC121131.14\| Mus musculus chromosome 8, clone RP23-187D7, com...	42	2.0
107	emb\|CT025557.11\| Mouse DNA sequence from clone RP23-356F21 on ch...	42	2.0
108	emb\|BX005145.8\| Zebrafish DNA sequence from clone CH211-120O1, c...	42	2.0
109	gb\|CP000086.1\| Burkholderia thailandensis E264 chromosome I, com...	42	2.0
110	gb\|AF037027.1\|AF037027 Zea mays peroxidase R15 mRNA, partial cds	42	2.0
111	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	42	2.0
112	emb\|BX000434.11\| Zebrafish DNA sequence from clone CH211-2E18, c...	42	2.0
113	emb\|AL731884.4\|CNS08C8O Oryza sativa chromosome 12, . BAC OSJNBa...	42	2.0
114	emb\|AL928774.3\|CNS08CC4 Oryza sativa chromosome 12, . BAC OSJNBa...	42	2.0
115	gb\|AC124471.4\| Mus musculus BAC clone RP24-79D7 from 12, complet...	42	2.0
116	gb\|AC129780.5\| Mus musculus BAC clone RP23-44N12 from 13, comple...	42	2.0
117	gb\|AC140318.4\| Mus musculus BAC clone RP23-400F19 from 9, comple...	42	2.0
118	gb\|U71206.1\|MMU71206 Mus musculus Ptx1 mRNA, complete cds	42	2.0
119	emb\|AL808105.15\| Mouse DNA sequence from clone RP23-22G24 on chr...	42	2.0
120	gb\|AC162921.3\| Mus musculus BAC clone RP23-342H1 from chromosome...	42	2.0
121	emb\|AL773592.5\| Mouse DNA sequence from clone RP23-336B11 on chr...	42	2.0
122	emb\|AL669828.13\| Mouse DNA sequence from clone RP23-163J20 on ch...	42	2.0
123	dbj\|AP001542.4\| Homo sapiens genomic DNA, chromosome 18 clone:RP...	42	2.0
124	gb\|AC108432.14\| Mus musculus chromosome 7, clone RP23-170D4, com...	40	7.9
125	gb\|AC108424.14\| Mus musculus chromosome 7, clone RP23-105A10, co...	40	7.9
126	ref\|NM_115295.1\| Arabidopsis thaliana EMB1967 AT3G54350 (EMB1967...	40	7.9
127	ref\|NM_180371.1\| Arabidopsis thaliana EMB1967 AT3G54350 (EMB1967...	40	7.9
128	ref\|NM_125450.1\| Arabidopsis thaliana unknown protein AT5G60570 ...	40	7.9
129	ref\|NM_117343.2\| Arabidopsis thaliana unknown protein AT4G12740 ...	40	7.9
130	ref\|NM_112372.1\| Arabidopsis thaliana unknown protein AT3G15095 ...	40	7.9
131	gb\|AC116389.12\| Mus musculus chromosome 7, clone RP23-21B1, comp...	40	7.9
132	ref\|NM_114803.3\| Arabidopsis thaliana RNA binding / nucleic acid...	40	7.9
133	ref\|NM_123096.3\| Arabidopsis thaliana binding AT5G37370 transcri...	40	7.9
134	ref\|NM_180770.1\| Arabidopsis thaliana binding AT5G37370 transcri...	40	7.9
135	gb\|AC168061.3\| Mus musculus BAC clone RP23-199J14 from chromosom...	40	7.9
136	gb\|AC164119.4\| Mus musculus BAC clone RP24-288I15 from chromosom...	40	7.9
137	gb\|AC123629.10\| Mus musculus chromosome 13, clone RP24-344N4, co...	40	7.9
138	gb\|AC108442.6\| Mus musculus chromosome 8, clone RP23-242M14, com...	40	7.9
139	gb\|AC104713.3\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.9
140	gb\|AC122005.3\| Mus musculus chromosome 5 clone RP24-340B11, comp...	40	7.9
141	gb\|AC163703.4\| Mus musculus BAC clone RP23-359B23 from chromosom...	40	7.9
142	gb\|AC159286.3\| Mus musculus BAC clone RP23-314E22 from chromosom...	40	7.9
143	gb\|AC009388.5\| Drosophila melanogaster clone BACR11P22, complete...	40	7.9
144	ref\|XM_483049.1\| Oryza sativa (japonica cultivar-group), mRNA	40	7.9
145	ref\|XM_507274.1\| PREDICTED Oryza sativa (japonica cultivar-group...	40	7.9
146	ref\|XM_479973.1\| Oryza sativa (japonica cultivar-group), mRNA	40	7.9
147	ref\|XM_475808.1\| Oryza sativa (japonica cultivar-group), predic...	40	7.9
148	gb\|AC161793.9\| Mus musculus chromosome 7, clone RP23-80J7, compl...	40	7.9
149	gb\|AC156548.13\| Mus musculus chromosome 5, clone RP23-412C8, com...	40	7.9
150	ref\|XM_470696.1\| Oryza sativa (japonica cultivar-group), mRNA	40	7.9
151	gb\|AC102490.7\| Mus musculus chromosome 1, clone RP24-512M8, comp...	40	7.9
152	gb\|BT018617.1\| Zea mays clone EL01N0501E07.d mRNA sequence	40	7.9
153	ref\|NM_021350.1\| Mus musculus choroideremia-like (Chml), mRNA	40	7.9
154	gb\|AC139637.17\| Mus musculus chromosome 15, clone RP24-253M12, c...	40	7.9
155	gb\|AC102484.7\| Mus musculus chromosome 1, clone RP24-455F18, com...	40	7.9
156	gb\|AC161609.6\| Mus musculus BAC clone RP23-139D15 from chromosom...	40	7.9
157	gb\|AC160993.5\| Mus musculus BAC clone RP23-159D11 from chromosom...	40	7.9
158	gb\|AC160136.2\| Mus musculus BAC clone RP23-125E11 from chromosom...	40	7.9
159	gb\|AC164956.2\| Mus musculus BAC clone RP24-250C7 from chromosome...	40	7.9
160	gb\|AC164303.2\| Mus musculus BAC clone RP24-530J21 from chromosom...	40	7.9
161	gb\|AC163335.6\| Mus musculus chromosome 7, clone RP24-149G13, com...	40	7.9
162	gb\|AC129942.7\| Mus musculus chromosome 8, clone RP23-267A22, com...	40	7.9
163	gb\|AC139062.10\| Mus musculus chromosome 17, clone RP23-69L11, co...	40	7.9
164	gb\|AC139225.10\| Mus musculus chromosome 9, clone RP24-361G12, co...	40	7.9
165	gb\|AC009847.9\| Drosophila melanogaster clone BACR03L10, complete...	40	7.9
166	gb\|AC129162.5\| Rattus norvegicus 9 BAC CH230-108L13 (Children's ...	40	7.9
167	gb\|AC094571.8\| Rattus norvegicus 20 BAC CH230-4L21 (Children's H...	40	7.9
168	gb\|AC102155.10\| Mus musculus chromosome 18, clone RP23-334J12, c...	40	7.9
169	gb\|AC012376.12\| Drosophila melanogaster clone BACR48C12, complet...	40	7.9
170	gb\|AC008309.8\| Drosophila melanogaster clone BACR06L13, complete...	40	7.9
171	gb\|AC008257.6\| Drosophila melanogaster clone BACR08A11, complete...	40	7.9
172	gb\|AC093102.2\| Drosophila melanogaster clone BACR34C10, complete...	40	7.9
173	ref\|XM_581298.2\| PREDICTED: Bos taurus similar to translocation ...	40	7.9
174	ref\|XM_423660.1\| PREDICTED: Gallus gallus similar to CD244 natur...	40	7.9
175	gb\|AC169378.2\| Sorghum bicolor clone SB_BBc0007L02, complete seq...	40	7.9
176	gb\|BC077759.1\| Xenopus laevis nemo-like kinase, mRNA (cDNA clone...	40	7.9
177	ref\|XM_456580.1\| Debaryomyces hansenii CBS767 hypothetical prote...	40	7.9
178	ref\|XM_456805.1\| Debaryomyces hansenii CBS767 hypothetical prote...	40	7.9
179	ref\|XM_456856.1\| Debaryomyces hansenii CBS767 hypothetical prote...	40	7.9
180	gb\|AC102745.10\| Mus musculus chromosome 17, clone RP24-371L2, co...	40	7.9
181	gb\|AC116527.18\| Mus musculus chromosome 16, clone RP24-354B8, co...	40	7.9
182	gb\|AC107738.16\| Mus musculus chromosome 1, clone RP23-348C6, com...	40	7.9
183	gb\|AC110559.11\| Mus musculus chromosome 7, clone RP23-253E12, co...	40	7.9
184	gb\|AC139580.4\| Mus musculus BAC clone RP23-110M15 from chromosom...	40	7.9
185	gb\|AC144816.3\| Mus musculus BAC clone RP24-243E15 from chromosom...	40	7.9
186	ref\|XM_959659.1\| Neurospora crassa OR74A hypothetical protein (N...	40	7.9
187	ref\|XM_325105.1\| Neurospora crassa OR74A hypothetical protein (N...	40	7.9
188	gb\|CP000124.1\| Burkholderia pseudomallei 1710b chromosome I, com...	40	7.9
189	gb\|AC131728.4\| Mus musculus BAC clone RP23-122G5 from chromosome...	40	7.9
190	gb\|AC131690.3\| Mus musculus BAC clone RP23-386P10 from chromosom...	40	7.9
191	gb\|AC111010.5\| Mus musculus BAC clone RP23-419L21 from chromosom...	40	7.9
192	gb\|AC140412.2\| Mus musculus BAC clone RP24-173O20 from chromosom...	40	7.9
193	gb\|AC124717.3\| Mus musculus BAC clone RP24-147K15 from chromosom...	40	7.9
194	ref\|XM_715405.1\| Candida albicans SC5314 putative transcription ...	40	7.9
195	ref\|XM_715174.1\| Candida albicans SC5314 putative transcription ...	40	7.9
196	ref\|XM_709599.1\| Candida albicans SC5314 putative small GTPase a...	40	7.9
197	gb\|AC108802.15\| Mus musculus chromosome 12, clone RP23-220J1, co...	40	7.9
198	gb\|AC146113.3\| Pan troglodytes BAC clone RP43-5I6 from 7, comple...	40	7.9
199	gb\|AC130529.2\| Mus musculus BAC clone RP23-124O11 from chromosom...	40	7.9
200	gb\|AC125105.3\| Mus musculus BAC clone RP24-220B7 from chromosome...	40	7.9
201	ref\|XM_658678.1\| Aspergillus nidulans FGSC A4 hypothetical prote...	40	7.9
202	gb\|CP000075.1\| Pseudomonas syringae pv. syringae B728a, complete...	40	7.9
203	gb\|AC105166.16\| Mus musculus chromosome 5, clone RP24-311D15, co...	40	7.9
204	gb\|AC131320.8\| Mus musculus chromosome 12, clone RP23-398E18, co...	40	7.9
205	gb\|AC112682.12\| Mus musculus chromosome 6, clone RP23-332K10, co...	40	7.9
206	gb\|AC153010.3\| Mus musculus BAC clone RP23-325H1 from chromosome...	40	7.9
207	gb\|AC121533.6\| Mus musculus chromosome 9, clone RP24-555P22, com...	40	7.9
208	gb\|AC166903.2\| Mus musculus BAC clone RP24-163K10 from chromosom...	40	7.9
209	gb\|AC125274.12\| Mus musculus chromosome 15, clone RP24-157F9, co...	40	7.9
210	gb\|AY557640.1\| Saccharomyces cerevisiae clone FLH001150.01X YCR0...	40	7.9
211	gb\|AC141899.4\| Mus musculus BAC clone RP23-116G15 from chromosom...	40	7.9
212	gb\|AC162901.4\| Mus musculus BAC clone RP23-417K5 from chromosome...	40	7.9
213	gb\|AC137742.3\| Mus musculus BAC clone RP24-345F6 from chromosome...	40	7.9
214	ref\|XR_002820.1\| PREDICTED: Mus musculus similar to complexin 2 ...	40	7.9
215	gb\|AC117610.7\| Mus musculus chromosome 1, clone RP23-102B12, com...	40	7.9
216	gb\|AC102350.14\| Mus musculus chromosome 9, clone RP23-323P3, com...	40	7.9
217	ref\|XM_973057.1\| PREDICTED: Mus musculus hypothetical protein LO...	40	7.9
218	ref\|XM_973504.1\| PREDICTED: Mus musculus hypothetical protein LO...	40	7.9
219	ref\|XM_975074.1\| PREDICTED: Mus musculus hypothetical protein LO...	40	7.9
220	ref\|XM_001002647.1\| PREDICTED: Mus musculus hypothetical protein...	40	7.9
221	ref\|XR_003410.1\| PREDICTED: Mus musculus hypothetical protein LO...	40	7.9
222	gb\|AC140373.2\| Mus musculus BAC clone RP23-197O10 from chromosom...	40	7.9
223	gb\|AC132608.2\| Mus musculus BAC clone RP23-451E12 from chromosom...	40	7.9
224	gb\|AC123830.5\| Mus musculus BAC clone RP24-125B17 from chromosom...	40	7.9
225	ref\|XM_715231.1\| Candida albicans SC5314 hypothetical protein (C...	40	7.9
226	ref\|XM_756180.1\| Ustilago maydis 521 hypothetical protein (UM051...	40	7.9
227	ref\|XM_756235.1\| Ustilago maydis 521 hypothetical protein (UM051...	40	7.9
228	emb\|AM039952.1\| Xanthomonas campestris pv. vesicatoria complete ...	40	7.9
229	emb\|CT025688.6\| Mouse DNA sequence from clone RP24-310A8 on chro...	40	7.9
230	ref\|XM_389958.1\| Gibberella zeae PH-1 chromosome 4 hypothetical ...	40	7.9
231	ref\|XM_386348.1\| Gibberella zeae PH-1 chromosome 3 hypothetical ...	40	7.9
232	ref\|XM_386337.1\| Gibberella zeae PH-1 chromosome 3 hypothetical ...	40	7.9
233	gb\|AC138400.12\| Mus musculus chromosome 14, clone RP23-260C21, c...	40	7.9
234	gb\|AC113470.14\| Mus musculus chromosome 9, clone RP23-262N17, co...	40	7.9
235	ref\|XM_568987.1\| Cryptococcus neoformans var. neoformans JEC21 p...	40	7.9
236	ref\|XM_568988.1\| Cryptococcus neoformans var. neoformans JEC21 p...	40	7.9
237	gb\|AC102769.11\| Mus musculus chromosome 17, clone RP23-89A3, com...	40	7.9
238	gb\|AC135633.3\| Mus musculus BAC clone RP24-84O13 from chromosome...	40	7.9
239	gb\|AC142110.4\| Mus musculus BAC clone RP24-104I11 from chromosom...	40	7.9
240	gb\|AC123817.4\| Mus musculus BAC clone RP24-255D13 from chromosom...	40	7.9
241	gb\|AC132255.3\| Mus musculus BAC clone RP24-472I15 from chromosom...	40	7.9
242	gb\|AC130209.3\| Mus musculus BAC clone RP24-369J19 from chromosom...	40	7.9
243	gb\|AC130549.4\| Mus musculus BAC clone RP24-456I3 from chromosome...	40	7.9
244	ref\|XM_799864.1\| Trypanosoma cruzi strain CL Brener protein kina...	40	7.9
245	gb\|AC127353.3\| Mus musculus BAC clone RP23-81P21 from chromosome...	40	7.9
246	gb\|AC132685.3\| Mus musculus BAC clone RP23-278G24 from chromosom...	40	7.9
247	gb\|AC125321.4\| Mus musculus BAC clone RP23-371B13 from chromosom...	40	7.9
248	gb\|AC130204.4\| Mus musculus BAC clone RP24-427M16 from chromosom...	40	7.9
249	ref\|XM_812058.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	40	7.9
250	gb\|AC124366.4\| Mus musculus BAC clone RP24-541E9 from chromosome...	40	7.9
251	ref\|XM_816220.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	40	7.9
252	gb\|AC124455.6\| Mus musculus BAC clone RP24-129J9 from chromosome...	40	7.9
253	gb\|AC121890.3\| Mus musculus BAC clone RP24-146K18 from chromosom...	40	7.9
254	gb\|AC121924.3\| Mus musculus BAC clone RP24-198P16 from chromosom...	40	7.9
255	gb\|BT000948.1\| Arabidopsis thaliana clone C105055 unknown protei...	40	7.9
256	emb\|CR956422.6\| Pig DNA sequence from clone PigE-93N11 on chromo...	40	7.9
257	ref\|XM_883623.1\| Candida albicans SC5314 hypothetical protein (C...	40	7.9
258	gb\|AC132684.3\| Mus musculus BAC clone RP23-277L20 from 9, comple...	40	7.9
259	ref\|XM_946349.1\| Candida albicans SC5314 hypothetical protein (C...	40	7.9
260	gb\|AC117198.3\| Mus musculus BAC clone RP23-127K18 from 9, comple...	40	7.9
261	gb\|AC114002.4\| Mus musculus BAC clone RP23-165H7 from 12, comple...	40	7.9
262	gb\|AC112268.3\| Mus musculus BAC clone RP24-114C23 from 2, comple...	40	7.9
263	gb\|AC121917.2\| Mus musculus BAC clone RP24-194F23 from 5, comple...	40	7.9
264	gb\|AC123050.2\| Mus musculus BAC clone RP24-366D7 from 10, comple...	40	7.9
265	gb\|AC104872.8\| Mus musculus chromosome 12, clone RP23-360C2, com...	40	7.9
266	ref\|XM_766295.1\| Giardia lamblia ATCC 50803 hypothetical protein...	40	7.9
267	ref\|XM_721022.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	40	7.9
268	ref\|XM_726040.1\| Plasmodium yoelii yoelii str. 17XNL splicing fa...	40	7.9
269	gb\|AC092022.5\| Homo sapiens BAC clone RP11-750F10 from 7, comple...	40	7.9
270	ref\|XM_740560.1\| Plasmodium chabaudi chabaudi hypothetical prote...	40	7.9
271	emb\|CR662629.2\|CNS0FA97 Tetraodon nigroviridis full-length cDNA	40	7.9
272	ref\|XM_670627.1\| Plasmodium berghei strain ANKA alpha adaptin-li...	40	7.9
273	gb\|AC107753.10\| Mus musculus chromosome 15, clone RP23-243P15, c...	40	7.9
274	gb\|AC116123.7\| Mus musculus chromosome 6, clone RP23-87I4, compl...	40	7.9
275	gb\|AC123675.7\| Mus musculus chromosome 15, clone RP23-271I6, com...	40	7.9
276	gb\|AC149067.3\| Mus musculus BAC clone RP23-56C20 from chromosome...	40	7.9
277	gb\|AC160462.6\| Mus musculus chromosome 1, clone RP23-225K21, com...	40	7.9
278	gb\|AC146068.2\| Pan troglodytes BAC clone RP43-60N22 from 7, comp...	40	7.9
279	gb\|AC087903.26\| Mus musculus strain C57BL/6J clone rp23-4p7 map ...	40	7.9
280	gb\|AC144645.17\| Medicago truncatula clone mth2-11e15, complete s...	40	7.9
281	gb\|AC159466.3\| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can...	40	7.9
282	gb\|AC134322.25\| Medicago truncatula clone mth2-17i21, complete s...	40	7.9
283	gb\|AC166572.1\| Mus musculus BAC clone RP23-346L20 from chromosom...	40	7.9
284	gb\|AC157789.5\| Mus musculus chromosome 8, clone RP24-95E2, compl...	40	7.9
285	gb\|AC108799.9\| Mus musculus, clone RP23-119G12, complete sequence	40	7.9
286	emb\|CR932964.2\| Medicago truncatula chromosome 5 clone mte1-60l1...	40	7.9
287	gb\|BC112797.1\| Bos taurus similar to Y55F3AM.9, mRNA (cDNA clone...	40	7.9
288	gb\|AC158956.6\| Mus musculus chromosome 3, clone RP23-370F14, com...	40	7.9
289	emb\|AL512601.18\| Human DNA sequence from clone RP11-500B3 on chr...	40	7.9
290	ref\|XM_503681.1\| Yarrowia lipolytica CLIB122, YALI0E08008g predi...	40	7.9
291	ref\|XM_505913.1\| Yarrowia lipolytica CLIB122, YALI0F26565g predi...	40	7.9
292	emb\|AL355353.23\| Human DNA sequence from clone RP11-385F7 on chr...	40	7.9
293	emb\|AL022323.7\|HS243E7 Human DNA sequence from clone CTA-243E7 o...	40	7.9
294	ref\|XM_784123.1\| PREDICTED: Strongylocentrotus purpuratus simila...	40	7.9
295	gb\|BT008856.1\| Arabidopsis thaliana At5g37370 mRNA, complete cds	40	7.9
296	gb\|AC084765.9\| Oryza sativa chromosome 3 BAC OSJNBa0090L05 genom...	40	7.9
297	gb\|AC130187.4\| Atelerix albiventris clone LB4-344F17, complete s...	40	7.9
298	gb\|AC112163.7\| Mus Musculus chromosome 13 BAC, clone MGS1-437011...	40	7.9
299	emb\|Y12465.1\|SBPPSTK2 S.bicolor mRNA for putative protein serine...	40	7.9
300	emb\|X89226.1\|OSLRK2GEN O.sativa DNA for LRK2 gene	40	7.9
301	emb\|X59720.2\|SCCHRIII S.cerevisiae chromosome III complete DNA s...	40	7.9
302	gb\|BT023756.1\| Drosophila melanogaster RE60237 full insert cDNA	40	7.9
303	emb\|CR382133.1\| Debaryomyces hansenii chromosome A of strain CBS...	40	7.9
304	gb\|AC163286.4\| Mus musculus BAC clone RP23-334L22 from chromosom...	40	7.9
305	gb\|AC166325.1\| Mus musculus BAC clone RP24-421O23 from chromosom...	40	7.9
306	gb\|AC163018.3\| Mus musculus chromosome 15, clone RP24-366J14, co...	40	7.9
307	emb\|BX883042.1\| Rattus norvegicus chromosome 20, major histocomp...	40	7.9
308	emb\|BX842638.1\| Neurospora crassa DNA linkage group I cosmid con...	40	7.9
309	gb\|AC164432.3\| Mus musculus BAC clone RP23-394G23 from chromosom...	40	7.9
310	emb\|BX571965.1\| Burkholderia pseudomallei strain K96243, chromos...	40	7.9
311	emb\|BX571873.1\| Photorhabdus luminescens subsp. laumondii TTO1 c...	40	7.9
312	gb\|AC155933.3\| Mus musculus BAC clone RP23-89K6 from chromosome ...	40	7.9
313	gb\|AC151992.3\| Mus musculus BAC clone RP23-212H13 from chromosom...	40	7.9
314	gb\|AC161258.2\| Mus musculus BAC clone RP23-457H24 from chromosom...	40	7.9
315	emb\|AL772195.4\| Mouse DNA sequence from clone RP23-218C5 on chro...	40	7.9
316	emb\|AL670003.1\|NCB9G16 Neurospora crassa DNA linkage group II BA...	40	7.9
317	emb\|AL161534.2\|ATCHRIV34 Arabidopsis thaliana DNA chromosome 4, ...	40	7.9
318	emb\|AL132971.2\|ATT12E18 Arabidopsis thaliana DNA chromosome 3, B...	40	7.9
319	emb\|AL132964.2\|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC...	40	7.9
320	emb\|AL049640.1\|ATT20K18 Arabidopsis thaliana DNA chromosome 4, B...	40	7.9
321	gb\|AC158753.8\| Mus musculus chromosome 5, clone RP23-301E24, com...	40	7.9
322	emb\|AJ491151.1\|EFI491151 Endomyces fibuliger ilv2 gene for aceto...	40	7.9
323	gb\|AC164311.4\| Mus musculus BAC clone RP23-144H18 from chromosom...	40	7.9
324	emb\|CR932960.3\| Medicago truncatula chromosome 5 clone mth4-7a5,...	40	7.9
325	emb\|AL691470.17\| Mouse DNA sequence from clone RP23-160F12 on ch...	40	7.9
326	emb\|AL663029.11\| Mouse DNA sequence from clone RP23-355B12 on ch...	40	7.9
327	emb\|AL669857.7\| Mouse DNA sequence from clone RP23-291B8 on chro...	40	7.9
328	emb\|BX005025.16\| Zebrafish DNA sequence from clone DKEY-67K20 in...	40	7.9
329	gb\|AE017342.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	7.9
330	gb\|AC127343.3\| Mus musculus BAC clone RP23-194I18 from chromosom...	40	7.9
331	gb\|AC154350.3\| Mus musculus BAC clone RP23-225B15 from chromosom...	40	7.9
332	gb\|AC158922.8\| Mus musculus chromosome 15, clone RP23-182C12, co...	40	7.9
333	gb\|AC074111.2\| Arabidopsis thaliana chromosome 1 BAC T18N24 geno...	40	7.9
334	gb\|AC013251.19\| Homo sapiens 3 BAC RP11-38P22 (Roswell Park Canc...	40	7.9
335	gb\|AF249733.1\| Arabidopsis thaliana putative SR-like splicing fa...	40	7.9
336	gb\|AC079320.9\| Homo sapiens chromosome 5, clone RP11-729C24, com...	40	7.9
337	gb\|DQ309557.1\| Neurospora crassa HET domain protein pin-c2 (pin-...	40	7.9
338	gb\|AC120734.5\| Rattus norvegicus BAC CH230-220D1 (Children's Ho...	40	7.9
339	gb\|AC122144.1\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.9
340	tpg\|BK002558.1\| TPA: TPA_inf: Drosophila melanogaster HDC13886 (...	40	7.9
341	tpg\|BK003220.1\| TPA: TPA_inf: Drosophila melanogaster HDC19720 (...	40	7.9
342	gb\|AC116366.2\| Homo sapiens chromosome 5 clone RP11-89G4, comple...	40	7.9
343	dbj\|AB226939.1\| Aspergillus oryzae cDNA, contig sequence: AoEST3801	40	7.9
344	gb\|AC090431.9\| Mus Musculus Strain C57BL6/J chromosome 14 RP23-3...	40	7.9
345	gb\|CP000267.1\| Rhodoferax ferrireducens DSM 15236, complete genome	40	7.9
346	ref\|NM_206779.1\| Drosophila melanogaster CG5907-RB, transcript v...	40	7.9
347	ref\|NM_206778.1\| Drosophila melanogaster CG5907-RC, transcript v...	40	7.9
348	gb\|AC093521.3\| Homo sapiens chromosome 5 clone RP11-152P24, comp...	40	7.9
349	gb\|AC069544.9\| Homo sapiens chromosome 10 clone RP11-398C13, com...	40	7.9
350	dbj\|AP007155.1\| Aspergillus oryzae RIB40 genomic DNA, SC003	40	7.9
351	gb\|AY093216.1\| Arabidopsis thaliana unknown protein (At5g37370) ...	40	7.9
352	ref\|NM_080354.2\| Drosophila melanogaster CG5907-RA, transcript v...	40	7.9
353	gb\|AC095352.7\| Homo sapiens X BAC RP11-605J4 (Roswell Park Cance...	40	7.9
354	gb\|AC108884.1\| Oryza sativa (japonica cultivar-group) cultivar N...	40	7.9
355	gb\|AC108075.3\| Homo sapiens BAC clone RP11-728C8 from 4, complet...	40	7.9
356	gb\|AC068515.6\| Homo sapiens, clone RP11-61O11, complete sequence	40	7.9
357	gb\|AC091774.7\| Oryza sativa chromosome 6 BAC OJ1540_H01 genomic ...	40	7.9
358	gb\|AC090685.8\| Homo sapiens chromosome 17, clone RP11-252O24, co...	40	7.9
359	gb\|AC027013.7\| Homo sapiens chromosome 15, clone RP11-398J10, co...	40	7.9
360	gb\|AY062111.1\| Arabidopsis thaliana AT3g54350/T12E18_40 mRNA seq...	40	7.9
361	gb\|AC079389.2\| Rattus norvegicus strain Brown Norway chromosome ...	40	7.9
362	gb\|AC011614.8\| Drosophila melanogaster, chromosome X, region 16F...	40	7.9
363	gb\|AC149601.3\| Medicago truncatula chromosome 7 BAC clone mth2-2...	40	7.9
364	gb\|AC155331.5\| Mus musculus 6 BAC RP24-189G6 (Roswell Park Cance...	40	7.9
365	gb\|DP000003.1\| Atelerix albiventris target 1 genomic scaffold	40	7.9
366	emb\|BX005020.7\| Zebrafish DNA sequence from clone DKEY-237D7 in ...	40	7.9
367	gb\|AC158315.9\| Mus musculus chromosome 7, clone RP23-146D22, com...	40	7.9
368	gb\|AC154859.2\| Mus musculus BAC clone RP23-14B14 from chromosome...	40	7.9
369	gb\|AC162308.2\| Mus musculus BAC clone RP23-109E9 from chromosome...	40	7.9
370	gb\|AC159823.2\| Mus musculus BAC clone RP23-113F14 from chromosom...	40	7.9
371	gb\|AC156642.2\| Mus musculus BAC clone RP23-254J5 from chromosome...	40	7.9
372	gb\|AC159202.2\| Mus musculus BAC clone RP23-297L21 from chromosom...	40	7.9
373	gb\|AC153150.5\| Mus musculus BAC clone RP23-181B14 from chromosom...	40	7.9
374	gb\|BC050878.1\| Mus musculus, clone IMAGE:6512811, mRNA	40	7.9
375	gb\|AC124316.32\| Mus musculus chromosome 17, clone RP24-222O13, c...	40	7.9
376	ref\|NM_001027650.1\| Caenorhabditis elegans Y111B2A.5a (Y111B2A.5...	40	7.9
377	gb\|AC009389.9\|AC009389 Drosophila melanogaster, chromosome 3R, r...	40	7.9
378	gb\|AC011071.12\|AC011071 Drosophila melanogaster, chromosome X, r...	40	7.9
379	ref\|NR_002374.1\| Caenorhabditis elegans strain Bristol N2 chromo...	40	7.9
380	gb\|AC114560.8\| Mus musculus chromosome 15, clone RP23-54K6, comp...	40	7.9
381	dbj\|AK007887.1\| Mus musculus 10 day old male pancreas cDNA, RIKE...	40	7.9
382	gb\|AC179924.2\| Mus musculus BAC clone RP23-270O20 from chromosom...	40	7.9
383	emb\|BX323009.6\| Zebrafish DNA sequence from clone DKEYP-70D5 in ...	40	7.9
384	gb\|AC142129.4\| Rattus norvegicus BAC CH230-183M21 (Children's H...	40	7.9
385	gb\|AC008339.2\|AC008339 Drosophila melanogaster, chromosome 2R, r...	40	7.9
386	gb\|AC009255.4\|AC009255 Drosophila melanogaster, chromosome 2R, r...	40	7.9
387	dbj\|AP008216.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
388	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
389	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
390	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
391	gb\|AF532117.1\| Mus musculus strain 129/SvJ BAC clone citb9k22 fr...	40	7.9
392	gb\|AC022348.2\|AC022348 Drosophila melanogaster, chromosome X, re...	40	7.9
393	gb\|AC012165.6\|AC012165 Drosophila melanogaster, chromosome X, re...	40	7.9
394	emb\|BX842566.4\| Mouse DNA sequence from clone RP23-174M7 on chro...	40	7.9
395	emb\|AL592214.14\| Mouse DNA sequence from clone RP23-212I24 on ch...	40	7.9
396	gb\|AY900631.1\| Drosophila buzzatii clone BAC 5H14, complete sequ...	40	7.9
397	emb\|BX822083.1\|CNS0A60D Arabidopsis thaliana Full-length cDNA Co...	40	7.9
398	gb\|AC007984.4\|AC007984 Drosophila melanogaster, chromosome 3R, r...	40	7.9
399	gb\|AC007726.7\|AC007726 Drosophila melanogaster, chromosome 3R, r...	40	7.9
400	gb\|AC139993.16\| Mus musculus chromosome 12, clone RP23-67O10, co...	40	7.9
401	gb\|AC130784.3\| Atelerix albiventris clone LB4-112D1, complete se...	40	7.9
402	gb\|AC156276.6\| Mus musculus 10 BAC RP24-323L12 (Roswell Park Can...	40	7.9
403	gb\|AC159150.5\| Mus musculus BAC RP23-339M5 (Roswell Park Cancer...	40	7.9
404	gb\|AC156804.2\| Pan troglodytes BAC clone CH251-371A18 from chrom...	40	7.9
405	gb\|AC154633.2\| Mus musculus BAC clone RP23-296I10 from chromosom...	40	7.9
406	gb\|AC074046.9\|AC074046 Mus musculus 5 BAC RP23-440C1 (Roswell Pa...	40	7.9
407	gb\|AC153377.5\| Mus musculus 6 BAC RP23-380O16 (Roswell Park Canc...	40	7.9
408	gb\|AC012329.5\|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G...	40	7.9
409	dbj\|AB013718.2\| Brassica rapa SRK46Bra gene for SRK46Bra, comple...	40	7.9
410	gb\|AC158989.1\| Mus musculus BAC clone RP23-399H20 from chromosom...	40	7.9
411	gb\|AC127223.5\| Mus musculus BAC clone RP24-484M18 from chromosom...	40	7.9
412	gb\|AC020602.6\| Homo sapiens BAC clone RP11-461M18 from 2, comple...	40	7.9
413	gb\|AC004968.1\|AC004968 Homo sapiens PAC clone RP5-1119N5 from 14...	40	7.9
414	dbj\|BA000031.2\| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo...	40	7.9
415	gb\|AC022120.7\| Homo sapiens chromosome 5 clone CTC-570I13, compl...	40	7.9
416	gb\|AC117539.6\| Papio hamadryas, clone RP41-208E11, complete sequ...	40	7.9
417	gb\|DQ352178.1\| Hordeum vulgare subsp. vulgare rust resistance ge...	40	7.9
418	ref\|XM_220314.3\| PREDICTED: Rattus norvegicus similar to novel p...	40	7.9
419	ref\|XM_580031.1\| PREDICTED: Rattus norvegicus LOC499910 (LOC4999...	40	7.9
420	ref\|XM_580030.1\| PREDICTED: Rattus norvegicus LOC499907 (LOC4999...	40	7.9
421	gb\|AF482427.1\| Mus musculus encephalopsin (Opn3) and choroiderem...	40	7.9
422	gb\|AY190949.1\| Drosophila pseudoobscura clone DPSF01_8_J08 (D142...	40	7.9
423	gb\|AY190946.1\| Drosophila pseudoobscura clone DPSF01_27_F17 (D14...	40	7.9
424	gb\|AC125035.3\| Mus musculus chromosome UL clone RP23-328F24, com...	40	7.9
425	gb\|AC093132.2\| Papio anubis clone RP41-51M7, complete sequence	40	7.9
426	gb\|AC134868.3\| Mus musculus BAC clone RP23-75E2 from chromosome ...	40	7.9
427	gb\|AC167467.1\| Mus musculus BAC clone RP23-158E17 from chromosom...	40	7.9
428	gb\|AC018641.3\|AC018641 Human Chromosome 7 clone RP11-182G3, comp...	40	7.9
429	gb\|AC018637.3\|AC018637 Human Chromosome 7 clone RP11-175P8, comp...	40	7.9
430	dbj\|AP004376.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
431	dbj\|AP003339.4\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
432	dbj\|AP004729.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
433	dbj\|AP003769.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
434	dbj\|AP003614.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
435	dbj\|AP003896.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
436	emb\|AL672306.11\| Mouse DNA sequence from clone RP23-149O3 on chr...	40	7.9
437	emb\|AL772218.29\| Mouse DNA sequence from clone RP23-129K21 on ch...	40	7.9
438	dbj\|AP005620.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
439	gb\|AC158183.2\| Selaginella moellendorffii clone JGIASXY-5D8, com...	40	7.9
440	emb\|AL807237.17\| Mouse DNA sequence from clone RP23-384O9 on chr...	40	7.9
441	emb\|AL807810.19\| Mouse DNA sequence from clone RP23-186F3 on chr...	40	7.9
442	gb\|AC157891.3\| Medicago truncatula chromosome 7 BAC clone mte1-1...	40	7.9
443	dbj\|AP000370.1\| Arabidopsis thaliana genomic DNA, chromosome 3, ...	40	7.9
444	dbj\|AB017069.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	7.9
445	dbj\|AB011483.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	7.9
446	gb\|AC158407.1\| Mus musculus BAC RP23-23E11 (Roswell Park Cancer...	40	7.9
447	emb\|X84225.1\|NTPHIIPRC N.tabacum mRNA for precursor of photosyst...	40	7.9
448	dbj\|AK107193.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.9
449	dbj\|AK103676.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.9
450	dbj\|AK102875.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.9
451	gb\|AY940051.1\| Mus musculus clone BAC UH-K8 genomic sequence	40	7.9
452	dbj\|AK100455.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.9
453	dbj\|AK100364.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.9
454	gb\|AC155927.2\| Mus musculus BAC clone RP24-133E20 from 12, compl...	40	7.9
455	gb\|AF072686.1\|AF072686 Oreochromis aureus vitellogenin gene, com...	40	7.9
456	emb\|AL359239.4\|CNS05TEQ Human chromosome 14 DNA sequence BAC R-4...	40	7.9
457	emb\|AL132904.5\|CEY111B2A Caenorhabditis elegans YAC Y111B2A, com...	40	7.9
458	emb\|AL646052.1\| Ralstonia solanacearum GMI1000 chromosome comple...	40	7.9
459	gb\|AY555143.1\| Zea may BAC clone c573L14, complete sequence	40	7.9
460	gb\|AF189156.1\|AF189156 Mus musculus rab escort protein-2 (Chml) ...	40	7.9
461	gb\|AC140381.3\| Mus musculus BAC clone RP23-176M4 from 10, comple...	40	7.9
462	gb\|AC141896.5\| Mus musculus BAC clone RP23-238B2 from 5, complet...	40	7.9
463	dbj\|AK064030.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.9
464	gb\|AC124636.23\| Mus musculus chromosome 16, clone RP23-454J20, c...	40	7.9
465	gb\|AC109224.16\| Mus musculus chromosome 5, clone RP23-150I2, com...	40	7.9
466	gb\|AY109674.1\| Zea mays CL12175_1 mRNA sequence	40	7.9
467	gb\|AC156271.5\| Mus musculus 10 BAC RP24-317L8 (Roswell Park Canc...	40	7.9
468	gb\|AC007461.8\|AC007461 Homo sapiens chromosome 17, clone 84_E_24...	40	7.9
469	gb\|AF134731.1\|AF134731 Prunus armeniaca putative allergen protei...	40	7.9
470	emb\|X51780.1\|SCABP1 Yeast ABP1 gene for actin binding protein	40	7.9
471	gb\|AE003763.3\| Drosophila melanogaster chromosome 3R, section 10...	40	7.9
472	gb\|AE003758.4\| Drosophila melanogaster chromosome 3R, section 96...	40	7.9
473	gb\|AE003734.3\| Drosophila melanogaster chromosome 3R, section 72...	40	7.9
474	gb\|AE003711.3\| Drosophila melanogaster chromosome 3R, section 49...	40	7.9
475	gb\|AC007121.1\|AC007121 Drosophila melanogaster, chromosome 2R, r...	40	7.9
476	gb\|AE003629.2\| Drosophila melanogaster chromosome 2L, section 38...	40	7.9
477	emb\|AL135744.4\|CNS01DVC Human chromosome 14 DNA sequence BAC R-5...	40	7.9
478	gb\|AE003785.4\| Drosophila melanogaster chromosome 2R, section 4 ...	40	7.9
479	gb\|AE003784.5\| Drosophila melanogaster chromosome 2R, section 5 ...	40	7.9
480	gb\|AE003513.3\| Drosophila melanogaster chromosome X, section 65 ...	40	7.9
481	gb\|AE003512.3\| Drosophila melanogaster chromosome X, section 64 ...	40	7.9
482	emb\|AJ417060.1\|HSA417060 Homo sapiens partial RPGRIP1 gene for R...	40	7.9
483	gb\|AE003508.4\| Drosophila melanogaster chromosome X, section 60 ...	40	7.9
484	gb\|AC152984.2\| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cance...	40	7.9
485	gb\|AF017250.1\|AF017250 Oreochromis aureus vitellogenin precursor...	40	7.9
486	gb\|U88832.1\|HSGROUCH2 Human groucho protein homolog (AES) gene, ...	40	7.9
487	dbj\|AP001699.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	40	7.9
488	gb\|AC006050.1\|AC006050 Homo sapiens chromosome 17, clone hRPK.2...	40	7.9
489	gb\|AE015451.1\| Pseudomonas putida KT2440 complete genome	40	7.9
490	gb\|AC121538.11\| Mus musculus chromosome 1, clone RP23-125I14, co...	40	7.9
491	emb\|CT009504.11\| Mouse DNA sequence from clone RP23-149M9 on chr...	40	7.9
492	gb\|AC159275.6\| Mus musculus BAC clone RP23-367C13 from chromosom...	40	7.9
493	gb\|AC113471.9\| Mus musculus chromosome 7, clone RP23-268E17, com...	40	7.9
494	gb\|DQ180309.1\| Fragaria x ananassa clone PBCESTFXA4 SSR marker	40	7.9
495	emb\|AL928958.15\| Mouse DNA sequence from clone RP23-344N23 on ch...	40	7.9
496	dbj\|AP002912.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.9
497	emb\|AL844840.8\| Mouse DNA sequence from clone RP23-337P9 on chro...	40	7.9
498	gb\|AC174082.3\| Mus musculus BAC clone RP23-395H10 from chromosom...	40	7.9
499	gb\|AC110519.13\| Mus musculus chromosome 8, clone RP23-183M15, co...	40	7.9
500	emb\|CT010500.11\| Mouse DNA sequence from clone RP23-454F17 on ch...	40	7.9

>ref|XM_478932.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2049

 Score =  256 bits (129), Expect = 7e-65
 Identities = 278/327 (85%), Gaps = 3/327 (0%)
 Strand = Plus / Plus

                                                                       
Query: 248 tcgccatggggaagagtaagaagagcaaggtccgcggcgc---cggaggggacgaccttc 304
           |||||||||||||||||||||||||||||||||| ||||    ||| |||||||||||  
Sbjct: 446 tcgccatggggaagagtaagaagagcaaggtccgtggcgttggcggcggggacgacctga 505

                                                                       
Query: 305 tggacagcagcgacgccgacagcgtgggatcgtcgtccaccgcgctctcagatctctcca 364
           | |||||||||||||||||||||||||| |||||||| || ||||| || ||||| ||||
Sbjct: 506 tcgacagcagcgacgccgacagcgtgggctcgtcgtcgacggcgctgtcggatctatcca 565

                                                                       
Query: 365 tctcgtacgccaccgagaacgtcaactcgcacgagtttgttctcgacaagtacatcgacg 424
           | |||||||| |||||| |||||  |||||| ||||| || ||||||||||||||||| |
Sbjct: 566 tgtcgtacgctaccgagcacgtcggctcgcaggagttcgtcctcgacaagtacatcgatg 625

                                                                       
Query: 425 ctctctacgagaagagggggtctacaagagaggcagcgttggcttcgttggttgatgctt 484
           ||||||| ||||||||||||||||| || || || ||  |  ||    ||||||||||||
Sbjct: 626 ctctctatgagaagagggggtctaccagggaagccgcactctctcaactggttgatgctt 685

                                                                       
Query: 485 tcgaaagttttatgcttgatggtcttgttgagaacaaatatgccactctactgagtctat 544
           | ||||| || || ||| |||||||||| ||||||||||||||||| || |||||||| |
Sbjct: 686 ttgaaagcttcattcttcatggtcttgtggagaacaaatatgccaccctgctgagtctgt 745

                                      
Query: 545 tcaatacttcgatcaagaagggatcta 571
           |||| | |||||| |||||||||||||
Sbjct: 746 tcaacagttcgataaagaagggatcta 772



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 33/34 (97%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                             
Query: 17  ccctcaagnaacaacccctgcttctgcttctgct 50
           |||||||| |||||||||||||||||||||||||
Sbjct: 193 ccctcaag-aacaacccctgcttctgcttctgct 225

to top

>dbj|AK099482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013025G13, full
           insert sequence
          Length = 2049

 Score =  256 bits (129), Expect = 7e-65
 Identities = 278/327 (85%), Gaps = 3/327 (0%)
 Strand = Plus / Plus

                                                                       
Query: 248 tcgccatggggaagagtaagaagagcaaggtccgcggcgc---cggaggggacgaccttc 304
           |||||||||||||||||||||||||||||||||| ||||    ||| |||||||||||  
Sbjct: 446 tcgccatggggaagagtaagaagagcaaggtccgtggcgttggcggcggggacgacctga 505

                                                                       
Query: 305 tggacagcagcgacgccgacagcgtgggatcgtcgtccaccgcgctctcagatctctcca 364
           | |||||||||||||||||||||||||| |||||||| || ||||| || ||||| ||||
Sbjct: 506 tcgacagcagcgacgccgacagcgtgggctcgtcgtcgacggcgctgtcggatctatcca 565

                                                                       
Query: 365 tctcgtacgccaccgagaacgtcaactcgcacgagtttgttctcgacaagtacatcgacg 424
           | |||||||| |||||| |||||  |||||| ||||| || ||||||||||||||||| |
Sbjct: 566 tgtcgtacgctaccgagcacgtcggctcgcaggagttcgtcctcgacaagtacatcgatg 625

                                                                       
Query: 425 ctctctacgagaagagggggtctacaagagaggcagcgttggcttcgttggttgatgctt 484
           ||||||| ||||||||||||||||| || || || ||  |  ||    ||||||||||||
Sbjct: 626 ctctctatgagaagagggggtctaccagggaagccgcactctctcaactggttgatgctt 685

                                                                       
Query: 485 tcgaaagttttatgcttgatggtcttgttgagaacaaatatgccactctactgagtctat 544
           | ||||| || || ||| |||||||||| ||||||||||||||||| || |||||||| |
Sbjct: 686 ttgaaagcttcattcttcatggtcttgtggagaacaaatatgccaccctgctgagtctgt 745

                                      
Query: 545 tcaatacttcgatcaagaagggatcta 571
           |||| | |||||| |||||||||||||
Sbjct: 746 tcaacagttcgataaagaagggatcta 772



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 33/34 (97%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                             
Query: 17  ccctcaagnaacaacccctgcttctgcttctgct 50
           |||||||| |||||||||||||||||||||||||
Sbjct: 193 ccctcaag-aacaacccctgcttctgcttctgct 225

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  159 bits (80), Expect = 1e-35
 Identities = 157/182 (86%), Gaps = 3/182 (1%)
 Strand = Plus / Plus

                                                                            
Query: 263      gtaagaagagcaaggtccgcggc---gccggaggggacgaccttctggacagcagcgacg 319
                ||||||||||||||||||| |||   | ||| |||||||||||  | |||||||||||||
Sbjct: 23872922 gtaagaagagcaaggtccgtggcgttggcggcggggacgacctgatcgacagcagcgacg 23872981

                                                                            
Query: 320      ccgacagcgtgggatcgtcgtccaccgcgctctcagatctctccatctcgtacgccaccg 379
                ||||||||||||| |||||||| || ||||| || ||||| ||||| |||||||| ||||
Sbjct: 23872982 ccgacagcgtgggctcgtcgtcgacggcgctgtcggatctatccatgtcgtacgctaccg 23873041

                                                                            
Query: 380      agaacgtcaactcgcacgagtttgttctcgacaagtacatcgacgctctctacgagaaga 439
                || |||||  |||||| ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 23873042 agcacgtcggctcgcaggagttcgtcctcgacaagtacatcgatgctctctatgagaaga 23873101

                  
Query: 440      gg 441
                ||
Sbjct: 23873102 gg 23873103



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                  
Query: 522      atatgccactctactgagtctattcaatacttcgatcaagaagggatcta 571
                ||||||||| || |||||||| ||||| | |||||| |||||||||||||
Sbjct: 23874643 atatgccaccctgctgagtctgttcaacagttcgataaagaagggatcta 23874692



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 33/34 (97%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                                  
Query: 17       ccctcaagnaacaacccctgcttctgcttctgct 50
                |||||||| |||||||||||||||||||||||||
Sbjct: 23872565 ccctcaag-aacaacccctgcttctgcttctgct 23872597



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                                 
Query: 473      tggttgatgctttcgaaagttttatgcttgatggtcttgttgagaacaa 521
                ||||||||||||| ||||| || || ||| |||||||||| ||||||||
Sbjct: 23874346 tggttgatgcttttgaaagcttcattcttcatggtcttgtggagaacaa 23874394

to top

>dbj|AP005149.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0005G07
          Length = 142850

 Score =  159 bits (80), Expect = 1e-35
 Identities = 157/182 (86%), Gaps = 3/182 (1%)
 Strand = Plus / Plus

                                                                         
Query: 263   gtaagaagagcaaggtccgcggcgc---cggaggggacgaccttctggacagcagcgacg 319
             ||||||||||||||||||| ||||    ||| |||||||||||  | |||||||||||||
Sbjct: 27849 gtaagaagagcaaggtccgtggcgttggcggcggggacgacctgatcgacagcagcgacg 27908

                                                                         
Query: 320   ccgacagcgtgggatcgtcgtccaccgcgctctcagatctctccatctcgtacgccaccg 379
             ||||||||||||| |||||||| || ||||| || ||||| ||||| |||||||| ||||
Sbjct: 27909 ccgacagcgtgggctcgtcgtcgacggcgctgtcggatctatccatgtcgtacgctaccg 27968

                                                                         
Query: 380   agaacgtcaactcgcacgagtttgttctcgacaagtacatcgacgctctctacgagaaga 439
             || |||||  |||||| ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 27969 agcacgtcggctcgcaggagttcgtcctcgacaagtacatcgatgctctctatgagaaga 28028

               
Query: 440   gg 441
             ||
Sbjct: 28029 gg 28030



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 522   atatgccactctactgagtctattcaatacttcgatcaagaagggatcta 571
             ||||||||| || |||||||| ||||| | |||||| |||||||||||||
Sbjct: 29570 atatgccaccctgctgagtctgttcaacagttcgataaagaagggatcta 29619



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 33/34 (97%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                               
Query: 17    ccctcaagnaacaacccctgcttctgcttctgct 50
             |||||||| |||||||||||||||||||||||||
Sbjct: 27492 ccctcaag-aacaacccctgcttctgcttctgct 27524



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 473   tggttgatgctttcgaaagttttatgcttgatggtcttgttgagaacaa 521
             ||||||||||||| ||||| || || ||| |||||||||| ||||||||
Sbjct: 29273 tggttgatgcttttgaaagcttcattcttcatggtcttgtggagaacaa 29321

to top

>dbj|AP003985.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_C01
          Length = 97427

 Score =  159 bits (80), Expect = 1e-35
 Identities = 157/182 (86%), Gaps = 3/182 (1%)
 Strand = Plus / Plus

                                                                         
Query: 263   gtaagaagagcaaggtccgcggc---gccggaggggacgaccttctggacagcagcgacg 319
             ||||||||||||||||||| |||   | ||| |||||||||||  | |||||||||||||
Sbjct: 61422 gtaagaagagcaaggtccgtggcgttggcggcggggacgacctgatcgacagcagcgacg 61481

                                                                         
Query: 320   ccgacagcgtgggatcgtcgtccaccgcgctctcagatctctccatctcgtacgccaccg 379
             ||||||||||||| |||||||| || ||||| || ||||| ||||| |||||||| ||||
Sbjct: 61482 ccgacagcgtgggctcgtcgtcgacggcgctgtcggatctatccatgtcgtacgctaccg 61541

                                                                         
Query: 380   agaacgtcaactcgcacgagtttgttctcgacaagtacatcgacgctctctacgagaaga 439
             || |||||  |||||| ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 61542 agcacgtcggctcgcaggagttcgtcctcgacaagtacatcgatgctctctatgagaaga 61601

               
Query: 440   gg 441
             ||
Sbjct: 61602 gg 61603



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 522   atatgccactctactgagtctattcaatacttcgatcaagaagggatcta 571
             ||||||||| || |||||||| ||||| | |||||| |||||||||||||
Sbjct: 63143 atatgccaccctgctgagtctgttcaacagttcgataaagaagggatcta 63192



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 33/34 (97%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                               
Query: 17    ccctcaagnaacaacccctgcttctgcttctgct 50
             |||||||| |||||||||||||||||||||||||
Sbjct: 61065 ccctcaag-aacaacccctgcttctgcttctgct 61097



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 473   tggttgatgctttcgaaagttttatgcttgatggtcttgttgagaacaa 521
             ||||||||||||| ||||| || || ||| |||||||||| ||||||||
Sbjct: 62846 tggttgatgcttttgaaagcttcattcttcatggtcttgtggagaacaa 62894

to top

>ref|XM_468892.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2445

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 373 gccaccgagaacgtcaactcgcacgagtttgttctcgacaagtacatcgacgctctctac 432
           ||||||||| | || | |||||| || |||||||| ||||| |||||||||| |||||| 
Sbjct: 351 gccaccgagcaagttagctcgcaggattttgttcttgacaaatacatcgacgatctctat 410

                                        
Query: 433 gagaagagggggtctacaagagaggcagc 461
           ||||||||||| || ||||||||||||||
Sbjct: 411 gagaagaggggatccacaagagaggcagc 439

to top

>dbj|AK102551.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033097C13, full
           insert sequence
          Length = 1741

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 373 gccaccgagaacgtcaactcgcacgagtttgttctcgacaagtacatcgacgctctctac 432
           ||||||||| | || | |||||| || |||||||| ||||| |||||||||| |||||| 
Sbjct: 351 gccaccgagcaagttagctcgcaggattttgttcttgacaaatacatcgacgatctctat 410

                                        
Query: 433 gagaagagggggtctacaagagaggcagc 461
           ||||||||||| || ||||||||||||||
Sbjct: 411 gagaagaggggatccacaagagaggcagc 439

to top

>gb|AC156616.5| Mus musculus chromosome 3, clone RP24-158L2, complete sequence
          Length = 127112

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 31    cccctgcttctgcttctgcttctcc 55
             |||||||||||||||||||||||||
Sbjct: 26386 cccctgcttctgcttctgcttctcc 26410

to top

>gb|AC157364.6| Mus musculus chromosome 3, clone RP23-324P1, complete sequence
          Length = 198706

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 31    cccctgcttctgcttctgcttctcc 55
             |||||||||||||||||||||||||
Sbjct: 24235 cccctgcttctgcttctgcttctcc 24211

to top

>gb|AC102854.12| Mus musculus chromosome 3, clone RP24-493E20, complete sequence
          Length = 133271

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 31    cccctgcttctgcttctgcttctcc 55
             |||||||||||||||||||||||||
Sbjct: 91709 cccctgcttctgcttctgcttctcc 91733

to top

>gb|AF519811.1| Lagenaria siceraria cyclin D3.2 protein mRNA, complete cds
          Length = 1565

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 32   ccctgcttctgcttctgcttctcc 55
            ||||||||||||||||||||||||
Sbjct: 1138 ccctgcttctgcttctgcttctcc 1115

to top

>gb|AC108909.15| Mus musculus chromosome 3, clone RP24-245I16, complete sequence
          Length = 194252

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 31     cccctgcttctgcttctgcttct 53
              |||||||||||||||||||||||
Sbjct: 179597 cccctgcttctgcttctgcttct 179619



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 179606 ctgcttctgcttctgcttct 179625

to top

>gb|AC133601.3| Mus musculus BAC clone RP24-179O1 from chromosome 18, complete sequence
          Length = 180978

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 33     cctgcttctgcttctgcttctcc 55
              |||||||||||||||||||||||
Sbjct: 120646 cctgcttctgcttctgcttctcc 120668

to top

>ref|XM_756136.1| Ustilago maydis 521 hypothetical protein (UM05082.1) partial mRNA
          Length = 1848

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 31   cccctgcttctgcttctgcttct 53
            |||||||||||||||||||||||
Sbjct: 1736 cccctgcttctgcttctgcttct 1758



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1751 ctgcttctgcttctgcttct 1770



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1745 ctgcttctgcttctgcttct 1764

to top

>gb|AC131113.4| Mus musculus BAC clone RP24-155C13 from chromosome 3, complete sequence
          Length = 173268

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 31     cccctgcttctgcttctgcttct 53
              |||||||||||||||||||||||
Sbjct: 146185 cccctgcttctgcttctgcttct 146163



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 146176 ctgcttctgcttctgcttct 146157

to top

>gb|AC105301.44| Mus musculus strain C57BL/6J clone rp23-317h14 map 17, complete
             sequence
          Length = 208029

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 63249 ctgcttctgcttctgcttctcc 63270

to top

>gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, complete sequence
          Length = 168270

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 97785 ctgcttctgcttctgcttctcc 97764



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 97821 ctgcttctgcttctgcttct 97802



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 97815 ctgcttctgcttctgcttct 97796



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 97809 ctgcttctgcttctgcttct 97790



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 97803 ctgcttctgcttctgcttct 97784



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 97797 ctgcttctgcttctgcttct 97778



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 97791 ctgcttctgcttctgcttct 97772

to top

>ref|NM_175138.2| Mus musculus dynein, axonemal, intermediate chain 1 (Dnaic1), mRNA
          Length = 2484

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 34  ctgcttctgcttctgcttctcc 55
           ||||||||||||||||||||||
Sbjct: 665 ctgcttctgcttctgcttctcc 644

to top

>ref|XM_958850.1| Neurospora crassa OR74A hypothetical protein (NCU02787.1) partial
            mRNA
          Length = 3525

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 34   ctgcttctgcttctgcttctcc 55
            ||||||||||||||||||||||
Sbjct: 3341 ctgcttctgcttctgcttctcc 3362



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3335 ctgcttctgcttctgcttct 3354



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3329 ctgcttctgcttctgcttct 3348



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3323 ctgcttctgcttctgcttct 3342



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3317 ctgcttctgcttctgcttct 3336



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3311 ctgcttctgcttctgcttct 3330



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3305 ctgcttctgcttctgcttct 3324

to top

>gb|AC104277.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1264_A04,
             complete sequence
          Length = 133271

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 15109 ctgcttctgcttctgcttctcc 15088

to top

>ref|XM_329974.1| Neurospora crassa OR74A hypothetical protein (NCU02787.1) partial
            mRNA
          Length = 3525

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 34   ctgcttctgcttctgcttctcc 55
            ||||||||||||||||||||||
Sbjct: 3341 ctgcttctgcttctgcttctcc 3362



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3335 ctgcttctgcttctgcttct 3354



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3329 ctgcttctgcttctgcttct 3348



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3323 ctgcttctgcttctgcttct 3342



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3317 ctgcttctgcttctgcttct 3336



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3311 ctgcttctgcttctgcttct 3330



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3305 ctgcttctgcttctgcttct 3324

to top

>gb|AC145952.3| Pan troglodytes BAC clone RP43-18D16 from 7, complete sequence
          Length = 160354

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 70982 ctgcttctgcttctgcttctcc 70961



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 71072 ctgcttctgcttctgcttct 71053



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 71066 ctgcttctgcttctgcttct 71047



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 71060 ctgcttctgcttctgcttct 71041



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 70988 ctgcttctgcttctgcttct 70969

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 33      cctgcttctgcttctgcttctc 54
               ||||||||||||||||||||||
Sbjct: 1197707 cctgcttctgcttctgcttctc 1197728



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 33       cctgcttctgcttctgcttct 53
                |||||||||||||||||||||
Sbjct: 13854162 cctgcttctgcttctgcttct 13854142



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 32       ccctgcttctgcttctgctt 51
                ||||||||||||||||||||
Sbjct: 14596686 ccctgcttctgcttctgctt 14596667

to top

>gb|AC166178.10| Mus musculus 6 BAC RP24-414G20 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 173015

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 51618 ctgcttctgcttctgcttctcc 51597



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51690 ctgcttctgcttctgcttct 51671



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51684 ctgcttctgcttctgcttct 51665



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51678 ctgcttctgcttctgcttct 51659



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51672 ctgcttctgcttctgcttct 51653



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51666 ctgcttctgcttctgcttct 51647



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51660 ctgcttctgcttctgcttct 51641



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51654 ctgcttctgcttctgcttct 51635



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51648 ctgcttctgcttctgcttct 51629



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51642 ctgcttctgcttctgcttct 51623



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51636 ctgcttctgcttctgcttct 51617



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51630 ctgcttctgcttctgcttct 51611



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51624 ctgcttctgcttctgcttct 51605

to top

>gb|AC116106.18| Mus musculus chromosome 16, clone RP23-23D5, complete sequence
          Length = 252718

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 34     ctgcttctgcttctgcttctcc 55
              ||||||||||||||||||||||
Sbjct: 189270 ctgcttctgcttctgcttctcc 189249



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 189276 ctgcttctgcttctgcttct 189257

to top

>gb|AC110818.5| Mus musculus BAC clone RP23-198H8 from 16, complete sequence
          Length = 182807

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 34     ctgcttctgcttctgcttctcc 55
              ||||||||||||||||||||||
Sbjct: 181357 ctgcttctgcttctgcttctcc 181378



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 181351 ctgcttctgcttctgcttct 181370

to top

>gb|AC117574.7| Mus musculus chromosome 5, clone RP23-32E20, complete sequence
          Length = 255008

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 32    ccctgcttctgcttctgcttct 53
             ||||||||||||||||||||||
Sbjct: 25394 ccctgcttctgcttctgcttct 25373

to top

>gb|AC083867.7| Homo sapiens chromosome 7 clone RP11-183I20, complete sequence
          Length = 148251

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 85556 ctgcttctgcttctgcttctcc 85535



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85610 ctgcttctgcttctgcttct 85591



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85604 ctgcttctgcttctgcttct 85585



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85598 ctgcttctgcttctgcttct 85579



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85592 ctgcttctgcttctgcttct 85573



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85586 ctgcttctgcttctgcttct 85567



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85580 ctgcttctgcttctgcttct 85561



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85574 ctgcttctgcttctgcttct 85555



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85568 ctgcttctgcttctgcttct 85549



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85562 ctgcttctgcttctgcttct 85543

to top

>emb|AL591004.3| Human DNA sequence from clone RP11-497F24 on chromosome 6, complete
             sequence
          Length = 159845

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 22144 ctgcttctgcttctgcttctcc 22123



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 22162 ctgcttctgcttctgcttct 22143



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 22156 ctgcttctgcttctgcttct 22137



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 22150 ctgcttctgcttctgcttct 22131

to top

>ref|XM_505002.1| Yarrowia lipolytica CLIB122, YALI0F04686g predicted mRNA
          Length = 3408

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 34  ctgcttctgcttctgcttctcc 55
           ||||||||||||||||||||||
Sbjct: 565 ctgcttctgcttctgcttctcc 544



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 607 ctgcttctgcttctgcttct 588



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 601 ctgcttctgcttctgcttct 582



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 595 ctgcttctgcttctgcttct 576



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 589 ctgcttctgcttctgcttct 570



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 583 ctgcttctgcttctgcttct 564



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 577 ctgcttctgcttctgcttct 558



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 571 ctgcttctgcttctgcttct 552

to top

>gb|AC157572.4| Mus musculus BAC clone RP23-79O10 from chromosome 14, complete sequence
          Length = 242759

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 34     ctgcttctgcttctgcttctcc 55
              ||||||||||||||||||||||
Sbjct: 101006 ctgcttctgcttctgcttctcc 100985



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101072 ctgcttctgcttctgcttct 101053



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101066 ctgcttctgcttctgcttct 101047



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101060 ctgcttctgcttctgcttct 101041



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101054 ctgcttctgcttctgcttct 101035



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101048 ctgcttctgcttctgcttct 101029



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101042 ctgcttctgcttctgcttct 101023



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101036 ctgcttctgcttctgcttct 101017



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101030 ctgcttctgcttctgcttct 101011



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101024 ctgcttctgcttctgcttct 101005



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101018 ctgcttctgcttctgcttct 100999



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 101012 ctgcttctgcttctgcttct 100993

to top

>emb|AL604022.21| Mouse DNA sequence from clone RP23-449P23 on chromosome 11 Contains the
             3' end of a novel gene (4732452J19Rik), the Supt4h gene
             for suppressor of Ty 4 homolog (S. cerevisiae), a novel
             gene (A430104N18Rik), the Bzrap1 gene for benzodiazapine
             receptor associated protein 1, the Mpo gene for
             myeloperoxidase, a novel gene, the 3' end of the Lpo gene
             for lactoperoxidase and a CpG island, complete sequence
          Length = 92337

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 32    ccctgcttctgcttctgcttct 53
             ||||||||||||||||||||||
Sbjct: 59539 ccctgcttctgcttctgcttct 59560

to top

>emb|BX294020.1|NC7F4 Neurospora crassa DNA linkage group V Cosmid contig 7F4
          Length = 115416

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 32   ccctgcttctgcttctgcttct 53
            ||||||||||||||||||||||
Sbjct: 4545 ccctgcttctgcttctgcttct 4524



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 4537 ctgcttctgcttctgcttct 4518

to top

>gb|AC159323.3| Mus musculus BAC clone RP23-6I8 from chromosome 14, complete sequence
          Length = 223640

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 37190 ctgcttctgcttctgcttctcc 37211



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37184 ctgcttctgcttctgcttct 37203



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37178 ctgcttctgcttctgcttct 37197



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37172 ctgcttctgcttctgcttct 37191



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37166 ctgcttctgcttctgcttct 37185



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37160 ctgcttctgcttctgcttct 37179



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37154 ctgcttctgcttctgcttct 37173



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37148 ctgcttctgcttctgcttct 37167



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37142 ctgcttctgcttctgcttct 37161



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37136 ctgcttctgcttctgcttct 37155



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37130 ctgcttctgcttctgcttct 37149



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37124 ctgcttctgcttctgcttct 37143

to top

>gb|AC158355.2| Mus musculus BAC clone RP24-374N16 from chromosome 9, complete sequence
          Length = 172612

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 76854 ctgcttctgcttctgcttctcc 76833



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 86701 cctgcttctgcttctgcttct 86721



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76914 ctgcttctgcttctgcttct 76895



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76908 ctgcttctgcttctgcttct 76889



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76902 ctgcttctgcttctgcttct 76883



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76896 ctgcttctgcttctgcttct 76877



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76890 ctgcttctgcttctgcttct 76871



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76884 ctgcttctgcttctgcttct 76865



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76878 ctgcttctgcttctgcttct 76859



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76872 ctgcttctgcttctgcttct 76853



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76866 ctgcttctgcttctgcttct 76847



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76860 ctgcttctgcttctgcttct 76841

to top

>emb|CR752647.6| Mouse DNA sequence from clone RP24-115K8 on chromosome X, complete
             sequence
          Length = 37067

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 36572 ctgcttctgcttctgcttctcc 36551



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 36518 ctgcttctgcttctgcttctcc 36497



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 36578 ctgcttctgcttctgcttct 36559

to top

>gb|AC154839.3| Mus musculus BAC clone RP23-61L24 from chromosome 13, complete sequence
          Length = 209819

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 99381 ctgcttctgcttctgcttctcc 99402



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 99461 cctgcttctgcttctgcttct 99481



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 99375 ctgcttctgcttctgcttct 99394

to top

>gb|AC155301.2| Mus musculus BAC clone RP24-216J21 from chromosome 13, complete
            sequence
          Length = 192299

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 34   ctgcttctgcttctgcttctcc 55
            ||||||||||||||||||||||
Sbjct: 7698 ctgcttctgcttctgcttctcc 7719



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 33   cctgcttctgcttctgcttct 53
            |||||||||||||||||||||
Sbjct: 7778 cctgcttctgcttctgcttct 7798



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7692 ctgcttctgcttctgcttct 7711

to top

>dbj|AK047808.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length
           enriched library, clone:C030047J03 product:DYNEIN
           INTERMEDIATE CHAIN 1, AXONEMAL (AXONEMAL DYNEIN
           INTERMEDIATE CHAIN 1) homolog [Homo sapiens], full
           insert sequence
          Length = 2484

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 34  ctgcttctgcttctgcttctcc 55
           ||||||||||||||||||||||
Sbjct: 665 ctgcttctgcttctgcttctcc 644

to top

>dbj|AK030213.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4933424D14 product:DYNEIN INTERMEDIATE
           CHAIN 1, AXONEMAL (AXONEMAL DYNEIN INTERMEDIATE CHAIN 1)
           homolog [Homo sapiens], full insert sequence
          Length = 2417

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 34  ctgcttctgcttctgcttctcc 55
           ||||||||||||||||||||||
Sbjct: 598 ctgcttctgcttctgcttctcc 577

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 34      ctgcttctgcttctgcttctcc 55
               ||||||||||||||||||||||
Sbjct: 2339509 ctgcttctgcttctgcttctcc 2339488



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 281      gcggcgccggaggggacgac 300
                ||||||||||||||||||||
Sbjct: 26656674 gcggcgccggaggggacgac 26656693

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 33      cctgcttctgcttctgcttctc 54
               ||||||||||||||||||||||
Sbjct: 1197705 cctgcttctgcttctgcttctc 1197726



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 33       cctgcttctgcttctgcttct 53
                |||||||||||||||||||||
Sbjct: 13849137 cctgcttctgcttctgcttct 13849117



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 32       ccctgcttctgcttctgctt 51
                ||||||||||||||||||||
Sbjct: 14591661 ccctgcttctgcttctgctt 14591642

to top

>gb|AC098695.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1126B12,
            complete sequence
          Length = 146241

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 33   cctgcttctgcttctgcttctc 54
            ||||||||||||||||||||||
Sbjct: 2609 cctgcttctgcttctgcttctc 2630

to top

>emb|AL713898.9| Mouse DNA sequence from clone RP23-253D13 on chromosome X, complete
            sequence
          Length = 189001

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 34   ctgcttctgcttctgcttctcc 55
            ||||||||||||||||||||||
Sbjct: 1505 ctgcttctgcttctgcttctcc 1484



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 34   ctgcttctgcttctgcttctcc 55
            ||||||||||||||||||||||
Sbjct: 1451 ctgcttctgcttctgcttctcc 1430



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1511 ctgcttctgcttctgcttct 1492

to top

>gb|AC091254.77| Mus musculus strain C57BL/6J clone rp23-364j24 map 17, complete
             sequence
          Length = 187696

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 63131 ctgcttctgcttctgcttctcc 63110

to top

>gb|AC138666.6| Mus musculus chromosome 5, clone RP24-140D11, complete sequence
          Length = 209938

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 32    ccctgcttctgcttctgcttct 53
             ||||||||||||||||||||||
Sbjct: 50830 ccctgcttctgcttctgcttct 50851

to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 34     ctgcttctgcttctgcttctcc 55
              ||||||||||||||||||||||
Sbjct: 725111 ctgcttctgcttctgcttctcc 725090



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 34      ctgcttctgcttctgcttct 53
               ||||||||||||||||||||
Sbjct: 3401163 ctgcttctgcttctgcttct 3401182



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 34      ctgcttctgcttctgcttct 53
               ||||||||||||||||||||
Sbjct: 3401157 ctgcttctgcttctgcttct 3401176



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725153 ctgcttctgcttctgcttct 725134



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725147 ctgcttctgcttctgcttct 725128



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725141 ctgcttctgcttctgcttct 725122



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725135 ctgcttctgcttctgcttct 725116



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725129 ctgcttctgcttctgcttct 725110



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725123 ctgcttctgcttctgcttct 725104



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 725117 ctgcttctgcttctgcttct 725098

to top

>emb|AL831723.8| Mouse DNA sequence from clone RP23-100C7 on chromosome 4, complete
              sequence
          Length = 171424

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 34     ctgcttctgcttctgcttctcc 55
              ||||||||||||||||||||||
Sbjct: 128973 ctgcttctgcttctgcttctcc 128952

to top

>emb|AL807242.7| Mouse DNA sequence from clone RP23-152G19 on chromosome 4, complete
             sequence
          Length = 213746

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 57618 ctgcttctgcttctgcttctcc 57639



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 57612 ctgcttctgcttctgcttct 57631

to top

>gb|AC105262.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1489_G03,
             complete sequence
          Length = 107870

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    ctgcttctgcttctgcttctcc 55
             ||||||||||||||||||||||
Sbjct: 67424 ctgcttctgcttctgcttctcc 67403

to top

>ref|NM_148504.1| Arabidopsis thaliana unknown protein AT1G33135 mRNA, complete cds
          Length = 423

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 34 ctgcttctgcttctgcttctc 54
          |||||||||||||||||||||
Sbjct: 43 ctgcttctgcttctgcttctc 23



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 49 ctgcttctgcttctgcttct 30

to top

>gb|AC121552.14| Mus musculus chromosome 19, clone RP24-145I16, complete sequence
          Length = 179737

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 153818 cctgcttctgcttctgcttct 153798



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 154312 ctgcttctgcttctgcttct 154293

to top

>ref|XM_468530.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 921

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 33 cctgcttctgcttctgcttct 53
          |||||||||||||||||||||
Sbjct: 52 cctgcttctgcttctgcttct 72

to top

>gb|AC120543.7| Mus musculus chromosome 8, clone RP23-330A24, complete sequence
          Length = 210696

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 84478 cctgcttctgcttctgcttct 84458



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84531 ctgcttctgcttctgcttct 84512



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84525 ctgcttctgcttctgcttct 84506



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84519 ctgcttctgcttctgcttct 84500



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84513 ctgcttctgcttctgcttct 84494



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84507 ctgcttctgcttctgcttct 84488



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84501 ctgcttctgcttctgcttct 84482



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84471 ctgcttctgcttctgcttct 84452

to top

>gb|AC161798.6| Mus musculus chromosome 7, clone RP23-267I20, complete sequence
          Length = 182519

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 180648 cctgcttctgcttctgcttct 180628



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180641 ctgcttctgcttctgcttct 180622



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180635 ctgcttctgcttctgcttct 180616



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180629 ctgcttctgcttctgcttct 180610



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180623 ctgcttctgcttctgcttct 180604



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180617 ctgcttctgcttctgcttct 180598



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180611 ctgcttctgcttctgcttct 180592



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180605 ctgcttctgcttctgcttct 180586



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180599 ctgcttctgcttctgcttct 180580



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180593 ctgcttctgcttctgcttct 180574



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180587 ctgcttctgcttctgcttct 180568



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180581 ctgcttctgcttctgcttct 180562



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180575 ctgcttctgcttctgcttct 180556



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 180569 ctgcttctgcttctgcttct 180550

to top

>gb|BT018190.1| Zea mays clone EL01N0558H06.c mRNA sequence
          Length = 962

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 523 tatgccactctactgagtctattcaatacttcgatcaagaagggatcta 571
           |||||| |||||||||||| |||||||| ||| || || | ||||||||
Sbjct: 452 tatgccgctctactgagtcaattcaataattccatgaaaaggggatcta 500

to top

>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence
          Length = 179931

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 57891 cctgcttctgcttctgcttct 57871

to top

>gb|AC122791.13| Mus musculus chromosome 13, clone RP24-266G22, complete sequence
          Length = 165861

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 89    gattccgcccgcgcccgctcc 109
             |||||||||||||||||||||
Sbjct: 22061 gattccgcccgcgcccgctcc 22041

to top

>ref|XM_867181.1| PREDICTED: Bos taurus similar to Olfactory guanylyl cyclase GC-D
           precursor (Guanylate cyclase, olfactory) (LOC615385),
           mRNA
          Length = 1026

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 472 ttggttgatgctttcgaaagt 492
           |||||||||||||||||||||
Sbjct: 102 ttggttgatgctttcgaaagt 82

to top

>ref|XM_603081.2| PREDICTED: Bos taurus similar to Y55F3AM.9 (LOC524749), mRNA
          Length = 2363

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 34   ctgcttctgcttctgcttctc 54
            |||||||||||||||||||||
Sbjct: 1748 ctgcttctgcttctgcttctc 1768



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1742 ctgcttctgcttctgcttct 1761



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1736 ctgcttctgcttctgcttct 1755

to top

>gb|AC132595.3| Mus musculus BAC clone RP24-229G7 from chromosome 7, complete sequence
          Length = 155547

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 47795 cctgcttctgcttctgcttct 47815



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47771 ctgcttctgcttctgcttct 47790



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47765 ctgcttctgcttctgcttct 47784



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47759 ctgcttctgcttctgcttct 47778



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47753 ctgcttctgcttctgcttct 47772



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47747 ctgcttctgcttctgcttct 47766



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47741 ctgcttctgcttctgcttct 47760



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47735 ctgcttctgcttctgcttct 47754



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47729 ctgcttctgcttctgcttct 47748



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47723 ctgcttctgcttctgcttct 47742



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47717 ctgcttctgcttctgcttct 47736



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47711 ctgcttctgcttctgcttct 47730



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 47705 ctgcttctgcttctgcttct 47724

to top

>gb|AC124437.4| Mus musculus BAC clone RP24-257N6 from chromosome 3, complete sequence
          Length = 149145

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 16491 cctgcttctgcttctgcttct 16511



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16510 ctgcttctgcttctgcttct 16529



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16504 ctgcttctgcttctgcttct 16523



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16498 ctgcttctgcttctgcttct 16517

to top

>ref|NM_011097.1| Mus musculus paired-like homeodomain transcription factor 1
           (Pitx1), mRNA
          Length = 2463

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 89  gattccgcccgcgcccgctcc 109
           |||||||||||||||||||||
Sbjct: 37  gattccgcccgcgcccgctcc 57

to top

>gb|AC110564.7| Mus musculus chromosome 12, clone RP23-292A16, complete sequence
          Length = 211576

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 172932 cctgcttctgcttctgcttct 172912

to top

>gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome 12, complete sequence
          Length = 176949

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 161830 cctgcttctgcttctgcttct 161850

to top

>gb|AC129013.3| Mus musculus BAC clone RP24-550P17 from chromosome 6, complete sequence
          Length = 169094

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 67022 cctgcttctgcttctgcttct 67002

to top

>gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, complete sequence
          Length = 200663

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 515   agaacaaatatgccactctac 535
             |||||||||||||||||||||
Sbjct: 74219 agaacaaatatgccactctac 74199

to top

>emb|CT010522.7| Mouse DNA sequence from clone RP23-310H3 on chromosome 16, complete
              sequence
          Length = 169798

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 34     ctgcttctgcttctgcttctc 54
              |||||||||||||||||||||
Sbjct: 100707 ctgcttctgcttctgcttctc 100687

to top

>gb|AC131653.4| Mus musculus BAC clone RP23-220N8 from chromosome 19, complete sequence
          Length = 168365

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 108624 cctgcttctgcttctgcttct 108644



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 108130 ctgcttctgcttctgcttct 108149

to top

>gb|AC135907.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1057D12,
              from chromosome 3, complete sequence
          Length = 161676

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 157348 cctgcttctgcttctgcttct 157368

to top

>gb|AC121967.3| Mus musculus BAC clone RP24-268P11 from chromosome 19, complete
             sequence
          Length = 185775

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 31344 cctgcttctgcttctgcttct 31324

to top

>gb|AC121826.3| Mus musculus BAC clone RP23-470O13 from chromosome 3, complete sequence
          Length = 187184

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 91482 cctgcttctgcttctgcttct 91502



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 91489 ctgcttctgcttctgcttct 91508

to top

>gb|AC132600.3| Mus musculus BAC clone RP24-134A5 from chromosome 3, complete sequence
          Length = 160339

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 134413 cctgcttctgcttctgcttct 134433



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 134432 ctgcttctgcttctgcttct 134451



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 134426 ctgcttctgcttctgcttct 134445



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 134420 ctgcttctgcttctgcttct 134439

to top

>ref|XM_724473.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01765)
            partial mRNA
          Length = 3894

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 33   cctgcttctgcttctgcttct 53
            |||||||||||||||||||||
Sbjct: 3275 cctgcttctgcttctgcttct 3255

to top

>ref|XM_726211.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY03308)
            partial mRNA
          Length = 3183

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 33   cctgcttctgcttctgcttct 53
            |||||||||||||||||||||
Sbjct: 1691 cctgcttctgcttctgcttct 1671

to top

>gb|AC111103.7| Mus musculus chromosome 16, clone RP23-187G7, complete sequence
          Length = 222348

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    ctgcttctgcttctgcttctc 54
             |||||||||||||||||||||
Sbjct: 16103 ctgcttctgcttctgcttctc 16123

to top

>gb|AC162909.2| Mus musculus BAC clone RP24-308O19 from chromosome 17, complete
             sequence
          Length = 145512

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 34    ctgcttctgcttctgcttctc 54
             |||||||||||||||||||||
Sbjct: 45178 ctgcttctgcttctgcttctc 45158

to top

>gb|AC120138.9| Mus musculus chromosome 1, clone RP23-283D3, complete sequence
          Length = 216381

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 127746 cctgcttctgcttctgcttct 127766

to top

>gb|AC165968.3| Mus musculus BAC clone RP23-181K4 from chromosome 7, complete sequence
          Length = 190840

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 16945 cctgcttctgcttctgcttct 16965



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16921 ctgcttctgcttctgcttct 16940



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16915 ctgcttctgcttctgcttct 16934



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16909 ctgcttctgcttctgcttct 16928



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16903 ctgcttctgcttctgcttct 16922



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16897 ctgcttctgcttctgcttct 16916



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16891 ctgcttctgcttctgcttct 16910



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16885 ctgcttctgcttctgcttct 16904



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16879 ctgcttctgcttctgcttct 16898



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16873 ctgcttctgcttctgcttct 16892



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16867 ctgcttctgcttctgcttct 16886



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16861 ctgcttctgcttctgcttct 16880



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16855 ctgcttctgcttctgcttct 16874

to top

>gb|AC109169.13| Mus musculus chromosome 6, clone RP23-5D6, complete sequence
          Length = 204911

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 202287 cctgcttctgcttctgcttct 202307

to top

>gb|AC160032.7| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 200439

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 49008 cctgcttctgcttctgcttct 49028

to top

>emb|AL357713.11| Human DNA sequence from clone RP11-3J23 on chromosome 1 Contains part
             of the RERE gene for arginine-glutamic acid dipeptide (RE)
             repeats (FLJ38775), complete sequence
          Length = 103513

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 257   ggaagagtaagaagagcaagg 277
             |||||||||||||||||||||
Sbjct: 53975 ggaagagtaagaagagcaagg 53955

to top

>gb|AC119801.14| Mus musculus, clone RP23-54N13, complete sequence
          Length = 251756

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 237665 cctgcttctgcttctgcttct 237685



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 237171 ctgcttctgcttctgcttct 237190

to top

>emb|AL109924.20|HSDJ495K2 Human DNA sequence from clone RP3-495K2 on chromosome 6q26-27
            Contains three novel genes and two CpG islands, complete
            sequence
          Length = 130296

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 34   ctgcttctgcttctgcttctc 54
            |||||||||||||||||||||
Sbjct: 1990 ctgcttctgcttctgcttctc 2010

to top

>gb|AC134175.1| Drosophila pseudoobscura  FOSMID DPSF1-548A9 (Children's Hospital
            Oakland Research Institute Drosophila pseudoobscura
            FOSMID Library) complete sequence
          Length = 45260

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 34   ctgcttctgcttctgcttctc 54
            |||||||||||||||||||||
Sbjct: 6733 ctgcttctgcttctgcttctc 6713

to top

>gb|AC096051.7| Rattus norvegicus 10 BAC CH230-21G1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 216194

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 109954 cctgcttctgcttctgcttct 109934

to top

>gb|AC107619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0048D11, from chromosome 3, complete sequence
          Length = 158911

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 130690 cctgcttctgcttctgcttct 130670

to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 36      gcttctgcttctgcttctccg 56
               |||||||||||||||||||||
Sbjct: 1581342 gcttctgcttctgcttctccg 1581322

to top

>gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosome 9, complete sequence
          Length = 202301

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 55249 cctgcttctgcttctgcttct 55269

to top

>gb|AC154264.2| Mus musculus BAC clone RP24-316B2 from chromosome 9, complete sequence
          Length = 166515

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 94052 cctgcttctgcttctgcttct 94072

to top

>gb|AC157773.6| Mus musculus chromosome 8, clone RP24-161L20, complete sequence
          Length = 179186

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 34     ctgcttctgcttctgcttctc 54
              |||||||||||||||||||||
Sbjct: 102713 ctgcttctgcttctgcttctc 102693



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102791 ctgcttctgcttctgcttct 102772



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102785 ctgcttctgcttctgcttct 102766



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102779 ctgcttctgcttctgcttct 102760



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102773 ctgcttctgcttctgcttct 102754



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102767 ctgcttctgcttctgcttct 102748



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102761 ctgcttctgcttctgcttct 102742



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102755 ctgcttctgcttctgcttct 102736



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102749 ctgcttctgcttctgcttct 102730



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102743 ctgcttctgcttctgcttct 102724



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102737 ctgcttctgcttctgcttct 102718



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102731 ctgcttctgcttctgcttct 102712



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102725 ctgcttctgcttctgcttct 102706



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 102719 ctgcttctgcttctgcttct 102700

to top

>gb|AC157782.7| Mus musculus chromosome 7, clone RP23-86L13, complete sequence
          Length = 167982

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 24187 cctgcttctgcttctgcttct 24167



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24180 ctgcttctgcttctgcttct 24161



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24174 ctgcttctgcttctgcttct 24155



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24168 ctgcttctgcttctgcttct 24149



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24162 ctgcttctgcttctgcttct 24143



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24156 ctgcttctgcttctgcttct 24137



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24150 ctgcttctgcttctgcttct 24131



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24144 ctgcttctgcttctgcttct 24125



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24138 ctgcttctgcttctgcttct 24119



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24132 ctgcttctgcttctgcttct 24113



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24126 ctgcttctgcttctgcttct 24107



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24120 ctgcttctgcttctgcttct 24101



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24114 ctgcttctgcttctgcttct 24095



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 24108 ctgcttctgcttctgcttct 24089

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 33       cctgcttctgcttctgcttct 53
                |||||||||||||||||||||
Sbjct: 23931446 cctgcttctgcttctgcttct 23931426



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 281     gcggcgccggaggggacgac 300
               ||||||||||||||||||||
Sbjct: 1992949 gcggcgccggaggggacgac 1992968

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 33       cctgcttctgcttctgcttct 53
                |||||||||||||||||||||
Sbjct: 35696496 cctgcttctgcttctgcttct 35696476



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 31       cccctgcttctgcttctgcttctcc 55
                |||||||||||| ||||||||||||
Sbjct: 23485903 cccctgcttctggttctgcttctcc 23485927

to top

>gb|AC083869.2|AC083869 Homo sapiens chromosome 7 clone RP11-733N14, complete sequence
          Length = 172237

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 43200 cctgcttctgcttctgcttct 43220

to top

>gb|AC021045.2|AC021045 Arabidopsis thaliana chromosome I BAC T9L6 genomic sequence, complete
             sequence
          Length = 90632

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 34    ctgcttctgcttctgcttctc 54
             |||||||||||||||||||||
Sbjct: 51534 ctgcttctgcttctgcttctc 51514



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 51540 ctgcttctgcttctgcttct 51521

to top

>gb|AC009541.16|AC009541 Human Chromosome 7 clone RP11-233L24, complete sequence
          Length = 150467

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 64569 cctgcttctgcttctgcttct 64549

to top

>dbj|AP004043.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1124_D06
          Length = 102239

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 57110 cctgcttctgcttctgcttct 57090

to top

>dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1791_B03
          Length = 166214

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 31    cccctgcttctgcttctgcttctcc 55
             |||||||||||| ||||||||||||
Sbjct: 51586 cccctgcttctggttctgcttctcc 51610

to top

>dbj|AP005293.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1653_F07, complete sequence
          Length = 110109

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 31     cccctgcttctgcttctgcttctcc 55
              |||||||||||| ||||||||||||
Sbjct: 104578 cccctgcttctggttctgcttctcc 104602

to top

>dbj|AK066974.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013089P10, full
           insert sequence
          Length = 1252

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 31  cccctgcttctgcttctgcttctcc 55
           |||||||||||| ||||||||||||
Sbjct: 854 cccctgcttctggttctgcttctcc 830

to top

>gb|AF137263.1|AF137263 Bacteroides thetaiotaomicron 30S ribosomal protein S16-like
           protein, fucose gene cluster, and RNA polymerase sigma
           factor SigZ-like protein (sigZ) genes, complete cds
          Length = 10671

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 36  gcttctgcttctgcttctccg 56
           |||||||||||||||||||||
Sbjct: 989 gcttctgcttctgcttctccg 969

to top

>dbj|AK058978.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-D08, full
           insert sequence
          Length = 414

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 31  cccctgcttctgcttctgcttctcc 55
           |||||||||||| ||||||||||||
Sbjct: 276 cccctgcttctggttctgcttctcc 252

to top

>emb|CT571242.10| Mouse DNA sequence from clone RP24-82P13 on chromosome 17, complete
             sequence
          Length = 236078

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    ctgcttctgcttctgcttctc 54
             |||||||||||||||||||||
Sbjct: 10084 ctgcttctgcttctgcttctc 10104

to top

>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete
             sequence
          Length = 323840

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 92965 cctgcttctgcttctgcttct 92945

to top

>gb|AC121131.14| Mus musculus chromosome 8, clone RP23-187D7, complete sequence
          Length = 188634

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 34     ctgcttctgcttctgcttctc 54
              |||||||||||||||||||||
Sbjct: 185301 ctgcttctgcttctgcttctc 185281



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185379 ctgcttctgcttctgcttct 185360



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185373 ctgcttctgcttctgcttct 185354



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185367 ctgcttctgcttctgcttct 185348



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185361 ctgcttctgcttctgcttct 185342



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185355 ctgcttctgcttctgcttct 185336



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185349 ctgcttctgcttctgcttct 185330



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185343 ctgcttctgcttctgcttct 185324



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185337 ctgcttctgcttctgcttct 185318



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185331 ctgcttctgcttctgcttct 185312



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185325 ctgcttctgcttctgcttct 185306



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185319 ctgcttctgcttctgcttct 185300



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185313 ctgcttctgcttctgcttct 185294



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 185307 ctgcttctgcttctgcttct 185288

to top

>emb|CT025557.11| Mouse DNA sequence from clone RP23-356F21 on chromosome 13, complete
              sequence
          Length = 186496

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 116881 cctgcttctgcttctgcttct 116861

to top

>emb|BX005145.8| Zebrafish DNA sequence from clone CH211-120O1, complete sequence
          Length = 181056

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 105    gctcctgattggtgctccgcgtgcg 129
              ||||||||||||||||||| |||||
Sbjct: 161968 gctcctgattggtgctccgagtgcg 161992

to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 70      gccgcgcgccgcgcatctcga 90
               |||||||||||||||||||||
Sbjct: 3051955 gccgcgcgccgcgcatctcga 3051935

to top

>gb|AF037027.1|AF037027 Zea mays peroxidase R15 mRNA, partial cds
          Length = 292

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 34 ctgcttctgcttctgcttctc 54
          |||||||||||||||||||||
Sbjct: 57 ctgcttctgcttctgcttctc 37



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 63 ctgcttctgcttctgcttct 44

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 33       cctgcttctgcttctgcttct 53
                |||||||||||||||||||||
Sbjct: 23859652 cctgcttctgcttctgcttct 23859632



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 281     gcggcgccggaggggacgac 300
               ||||||||||||||||||||
Sbjct: 1992900 gcggcgccggaggggacgac 1992919

to top

>emb|BX000434.11| Zebrafish DNA sequence from clone CH211-2E18, complete sequence
          Length = 179109

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 105    gctcctgattggtgctccgcgtgcg 129
              ||||||||||||||||||| |||||
Sbjct: 162572 gctcctgattggtgctccgagtgcg 162596

to top

>emb|AL731884.4|CNS08C8O Oryza sativa chromosome 12, . BAC OSJNBa0014A07 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 144767

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 41737 cctgcttctgcttctgcttct 41757

to top

>emb|AL928774.3|CNS08CC4 Oryza sativa chromosome 12, . BAC OSJNBa0078O17 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 176388

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 155950 cctgcttctgcttctgcttct 155970

to top

>gb|AC124471.4| Mus musculus BAC clone RP24-79D7 from 12, complete sequence
          Length = 179503

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 49108 cctgcttctgcttctgcttct 49128

to top

>gb|AC129780.5| Mus musculus BAC clone RP23-44N12 from 13, complete sequence
          Length = 125690

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 89    gattccgcccgcgcccgctcc 109
             |||||||||||||||||||||
Sbjct: 26741 gattccgcccgcgcccgctcc 26761

to top

>gb|AC140318.4| Mus musculus BAC clone RP23-400F19 from 9, complete sequence
          Length = 180211

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 109329 cctgcttctgcttctgcttct 109309

to top

>gb|U71206.1|MMU71206 Mus musculus Ptx1 mRNA, complete cds
          Length = 2463

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 89  gattccgcccgcgcccgctcc 109
           |||||||||||||||||||||
Sbjct: 37  gattccgcccgcgcccgctcc 57

to top

>emb|AL808105.15| Mouse DNA sequence from clone RP23-22G24 on chromosome 4, complete
             sequence
          Length = 252003

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    ctgcttctgcttctgcttctc 54
             |||||||||||||||||||||
Sbjct: 99962 ctgcttctgcttctgcttctc 99982

to top

>gb|AC162921.3| Mus musculus BAC clone RP23-342H1 from chromosome 9, complete sequence
          Length = 254666

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 13987 cctgcttctgcttctgcttct 14007

to top

>emb|AL773592.5| Mouse DNA sequence from clone RP23-336B11 on chromosome 4, complete
              sequence
          Length = 219956

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cctgcttctgcttctgcttct 53
              |||||||||||||||||||||
Sbjct: 117371 cctgcttctgcttctgcttct 117391

to top

>emb|AL669828.13| Mouse DNA sequence from clone RP23-163J20 on chromosome 2, complete
             sequence
          Length = 248940

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 74667 cctgcttctgcttctgcttct 74687



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74710 ctgcttctgcttctgcttct 74729



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74704 ctgcttctgcttctgcttct 74723



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74698 ctgcttctgcttctgcttct 74717



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74692 ctgcttctgcttctgcttct 74711



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74686 ctgcttctgcttctgcttct 74705



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74680 ctgcttctgcttctgcttct 74699



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 74674 ctgcttctgcttctgcttct 74693

to top

>dbj|AP001542.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-703I16, complete
             sequences
          Length = 47152

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cctgcttctgcttctgcttct 53
             |||||||||||||||||||||
Sbjct: 24684 cctgcttctgcttctgcttct 24704

to top

>gb|AC108432.14| Mus musculus chromosome 7, clone RP23-170D4, complete sequence
          Length = 183180

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119631 ctgcttctgcttctgcttct 119612



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119625 ctgcttctgcttctgcttct 119606



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119619 ctgcttctgcttctgcttct 119600



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119613 ctgcttctgcttctgcttct 119594



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119607 ctgcttctgcttctgcttct 119588



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119601 ctgcttctgcttctgcttct 119582



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119595 ctgcttctgcttctgcttct 119576



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119589 ctgcttctgcttctgcttct 119570



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119583 ctgcttctgcttctgcttct 119564



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119577 ctgcttctgcttctgcttct 119558



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119571 ctgcttctgcttctgcttct 119552



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119565 ctgcttctgcttctgcttct 119546



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119559 ctgcttctgcttctgcttct 119540



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119553 ctgcttctgcttctgcttct 119534



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119499 ctgcttctgcttctgcttct 119480



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119493 ctgcttctgcttctgcttct 119474



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119487 ctgcttctgcttctgcttct 119468



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119445 ctgcttctgcttctgcttct 119426



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119421 ctgcttctgcttctgcttct 119402



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119415 ctgcttctgcttctgcttct 119396



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119385 ctgcttctgcttctgcttct 119366



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119379 ctgcttctgcttctgcttct 119360



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119373 ctgcttctgcttctgcttct 119354



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119367 ctgcttctgcttctgcttct 119348



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119361 ctgcttctgcttctgcttct 119342



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119355 ctgcttctgcttctgcttct 119336



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119349 ctgcttctgcttctgcttct 119330



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119343 ctgcttctgcttctgcttct 119324



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119337 ctgcttctgcttctgcttct 119318



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119331 ctgcttctgcttctgcttct 119312



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119325 ctgcttctgcttctgcttct 119306



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119319 ctgcttctgcttctgcttct 119300



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119313 ctgcttctgcttctgcttct 119294



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 119307 ctgcttctgcttctgcttct 119288

to top

>gb|AC108424.14| Mus musculus chromosome 7, clone RP23-105A10, complete sequence
          Length = 198191

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 173015 ctgcttctgcttctgcttct 172996



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 173009 ctgcttctgcttctgcttct 172990



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 173003 ctgcttctgcttctgcttct 172984



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 172997 ctgcttctgcttctgcttct 172978



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 172991 ctgcttctgcttctgcttct 172972



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 172985 ctgcttctgcttctgcttct 172966

to top

>ref|NM_115295.1| Arabidopsis thaliana EMB1967 AT3G54350 (EMB1967) transcript variant
            AT3G54350.1 mRNA, complete cds
          Length = 2661

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1889 ctgcttctgcttctgcttct 1870

to top

>ref|NM_180371.1| Arabidopsis thaliana EMB1967 AT3G54350 (EMB1967) transcript variant
            AT3G54350.2 mRNA, complete cds
          Length = 2801

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 2029 ctgcttctgcttctgcttct 2010

to top

>ref|NM_125450.1| Arabidopsis thaliana unknown protein AT5G60570 mRNA, complete cds
          Length = 1182

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 53 ctgcttctgcttctgcttct 72



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 47 ctgcttctgcttctgcttct 66



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 41 ctgcttctgcttctgcttct 60

to top

>ref|NM_117343.2| Arabidopsis thaliana unknown protein AT4G12740 mRNA, complete cds
          Length = 1893

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 265 ctgcttctgcttctgcttct 246

to top

>ref|NM_112372.1| Arabidopsis thaliana unknown protein AT3G15095 mRNA, complete cds
          Length = 2097

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1204 ctgcttctgcttctgcttct 1185



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1198 ctgcttctgcttctgcttct 1179

to top

>gb|AC116389.12| Mus musculus chromosome 7, clone RP23-21B1, complete sequence
          Length = 236139

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98469 ctgcttctgcttctgcttct 98450



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98463 ctgcttctgcttctgcttct 98444



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98457 ctgcttctgcttctgcttct 98438



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98451 ctgcttctgcttctgcttct 98432



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98445 ctgcttctgcttctgcttct 98426



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98439 ctgcttctgcttctgcttct 98420



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98433 ctgcttctgcttctgcttct 98414



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98427 ctgcttctgcttctgcttct 98408



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98406 ctgcttctgcttctgcttct 98387



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 98400 ctgcttctgcttctgcttct 98381

to top

>ref|NM_114803.3| Arabidopsis thaliana RNA binding / nucleic acid binding AT3G49430
           mRNA, complete cds
          Length = 1097

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 719 ctgcttctgcttctgcttct 700

to top

>ref|NM_123096.3| Arabidopsis thaliana binding AT5G37370 transcript variant AT5G37370.2
            mRNA, complete cds
          Length = 1466

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 34   ctgcttctgcttctgcttctccgg 57
            ||||||||||| ||||||||||||
Sbjct: 1089 ctgcttctgctcctgcttctccgg 1066

to top

>ref|NM_180770.1| Arabidopsis thaliana binding AT5G37370 transcript variant AT5G37370.1
            mRNA, complete cds
          Length = 1490

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 34   ctgcttctgcttctgcttctccgg 57
            ||||||||||| ||||||||||||
Sbjct: 1113 ctgcttctgctcctgcttctccgg 1090

to top

>gb|AC168061.3| Mus musculus BAC clone RP23-199J14 from chromosome 16, complete sequence
          Length = 212340

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 204077 ctgcttctgcttctgcttct 204096

to top

>gb|AC164119.4| Mus musculus BAC clone RP24-288I15 from chromosome 5, complete sequence
          Length = 189243

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 154329 ctgcttctgcttctgcttct 154348

to top

>gb|AC123629.10| Mus musculus chromosome 13, clone RP24-344N4, complete sequence
          Length = 177594

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 11349 ctgcttctgcttctgcttct 11330

to top

>gb|AC108442.6| Mus musculus chromosome 8, clone RP23-242M14, complete sequence
          Length = 209618

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 136845 ctgcttctgcttctgcttct 136826

to top

>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11,
             complete sequence
          Length = 115808

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   gcggcgccggaggggacgac 300
             ||||||||||||||||||||
Sbjct: 37671 gcggcgccggaggggacgac 37690

to top

>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence
          Length = 183264

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93476 ctgcttctgcttctgcttct 93457



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93470 ctgcttctgcttctgcttct 93451



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93464 ctgcttctgcttctgcttct 93445



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93458 ctgcttctgcttctgcttct 93439



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93452 ctgcttctgcttctgcttct 93433



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93446 ctgcttctgcttctgcttct 93427



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 93440 ctgcttctgcttctgcttct 93421

to top

>gb|AC163703.4| Mus musculus BAC clone RP23-359B23 from chromosome 8, complete sequence
          Length = 219082

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    cctgcttctgcttctgcttc 52
             ||||||||||||||||||||
Sbjct: 83886 cctgcttctgcttctgcttc 83867

to top

>gb|AC159286.3| Mus musculus BAC clone RP23-314E22 from chromosome 14, complete
             sequence
          Length = 210984

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 31600 ctgcttctgcttctgcttct 31619



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 31594 ctgcttctgcttctgcttct 31613

to top

>gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete sequence
          Length = 172362

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 157139 ctgcttctgcttctgcttct 157120

to top

>ref|XM_483049.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1299

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 619 ctgcttctgcttctgcttct 600

to top

>ref|XM_507274.1| PREDICTED Oryza sativa (japonica cultivar-group), P0481F05.17 mRNA
          Length = 1386

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 608 ctgcttctgcttctgcttct 589

to top

>ref|XM_479973.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3689

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 956 ctgcttctgcttctgcttct 937

to top

>ref|XM_475808.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1227

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 281 gcggcgccggaggggacgac 300
           ||||||||||||||||||||
Sbjct: 46  gcggcgccggaggggacgac 65

to top

>gb|AC161793.9| Mus musculus chromosome 7, clone RP23-80J7, complete sequence
          Length = 268158

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 30983 ctgcttctgcttctgcttct 30964



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 30977 ctgcttctgcttctgcttct 30958



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 30971 ctgcttctgcttctgcttct 30952



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 30965 ctgcttctgcttctgcttct 30946



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 30959 ctgcttctgcttctgcttct 30940



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 30953 ctgcttctgcttctgcttct 30934

to top

>gb|AC156548.13| Mus musculus chromosome 5, clone RP23-412C8, complete sequence
          Length = 197890

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59861 ctgcttctgcttctgcttct 59842



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59855 ctgcttctgcttctgcttct 59836



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59849 ctgcttctgcttctgcttct 59830



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59843 ctgcttctgcttctgcttct 59824



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59837 ctgcttctgcttctgcttct 59818



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59831 ctgcttctgcttctgcttct 59812



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59825 ctgcttctgcttctgcttct 59806



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59819 ctgcttctgcttctgcttct 59800



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 59813 ctgcttctgcttctgcttct 59794

to top

>ref|XM_470696.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 438

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  ccctgcttctgcttctgctt 51
           ||||||||||||||||||||
Sbjct: 398 ccctgcttctgcttctgctt 379

to top

>gb|AC102490.7| Mus musculus chromosome 1, clone RP24-512M8, complete sequence
          Length = 133883

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 742 ctgcttctgcttctgcttct 761



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 736 ctgcttctgcttctgcttct 755



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 730 ctgcttctgcttctgcttct 749



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 724 ctgcttctgcttctgcttct 743



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 718 ctgcttctgcttctgcttct 737



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 712 ctgcttctgcttctgcttct 731



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 706 ctgcttctgcttctgcttct 725



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 700 ctgcttctgcttctgcttct 719



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 694 ctgcttctgcttctgcttct 713



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 688 ctgcttctgcttctgcttct 707



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 682 ctgcttctgcttctgcttct 701



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 676 ctgcttctgcttctgcttct 695

to top

>gb|BT018617.1| Zea mays clone EL01N0501E07.d mRNA sequence
          Length = 1689

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 301 ctgcttctgcttctgcttct 282

to top

>ref|NM_021350.1| Mus musculus choroideremia-like (Chml), mRNA
          Length = 1866

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   cctgcttctgcttctgcttc 52
            ||||||||||||||||||||
Sbjct: 1613 cctgcttctgcttctgcttc 1594

to top

>gb|AC139637.17| Mus musculus chromosome 15, clone RP24-253M12, complete sequence
          Length = 136076

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 45309 ctgcttctgcttctgcttct 45328

to top

>gb|AC102484.7| Mus musculus chromosome 1, clone RP24-455F18, complete sequence
          Length = 150669

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 145033 ctgcttctgcttctgcttct 145052



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 145027 ctgcttctgcttctgcttct 145046



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 145021 ctgcttctgcttctgcttct 145040



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 145015 ctgcttctgcttctgcttct 145034



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 145009 ctgcttctgcttctgcttct 145028



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 145003 ctgcttctgcttctgcttct 145022



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144997 ctgcttctgcttctgcttct 145016



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144991 ctgcttctgcttctgcttct 145010



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144985 ctgcttctgcttctgcttct 145004



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144979 ctgcttctgcttctgcttct 144998



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144973 ctgcttctgcttctgcttct 144992



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144967 ctgcttctgcttctgcttct 144986



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 144961 ctgcttctgcttctgcttct 144980

to top

>gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosome 14, complete sequence
          Length = 219723

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 103255 ctgcttctgcttctgcttct 103236



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 103249 ctgcttctgcttctgcttct 103230



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 103243 ctgcttctgcttctgcttct 103224

to top

>gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosome 16, complete sequence
          Length = 187536

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135449 ctgcttctgcttctgcttct 135430



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 123121 ctgcttctgcttctgcttct 123140



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 123115 ctgcttctgcttctgcttct 123134



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 123109 ctgcttctgcttctgcttct 123128



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 123103 ctgcttctgcttctgcttct 123122

to top

>gb|AC160136.2| Mus musculus BAC clone RP23-125E11 from chromosome 16, complete sequence
          Length = 192119

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 156103 ctgcttctgcttctgcttct 156084



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 156097 ctgcttctgcttctgcttct 156078

to top

>gb|AC164956.2| Mus musculus BAC clone RP24-250C7 from chromosome 12, complete sequence
          Length = 192647

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 129853 ctgcttctgcttctgcttct 129872



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 129847 ctgcttctgcttctgcttct 129866



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 129841 ctgcttctgcttctgcttct 129860

to top

>gb|AC164303.2| Mus musculus BAC clone RP24-530J21 from chromosome 14, complete
             sequence
          Length = 164905

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 53618 ctgcttctgcttctgcttct 53637



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 53612 ctgcttctgcttctgcttct 53631

to top

>gb|AC163335.6| Mus musculus chromosome 7, clone RP24-149G13, complete sequence
          Length = 164660

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 99693 ctgcttctgcttctgcttct 99712



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 99687 ctgcttctgcttctgcttct 99706



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 99681 ctgcttctgcttctgcttct 99700

to top

>gb|AC129942.7| Mus musculus chromosome 8, clone RP23-267A22, complete sequence
          Length = 175030

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155842 ctgcttctgcttctgcttct 155861



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155836 ctgcttctgcttctgcttct 155855



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155830 ctgcttctgcttctgcttct 155849



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155824 ctgcttctgcttctgcttct 155843



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155818 ctgcttctgcttctgcttct 155837



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155812 ctgcttctgcttctgcttct 155831



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155806 ctgcttctgcttctgcttct 155825



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155800 ctgcttctgcttctgcttct 155819



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155794 ctgcttctgcttctgcttct 155813



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155788 ctgcttctgcttctgcttct 155807



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155782 ctgcttctgcttctgcttct 155801



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155776 ctgcttctgcttctgcttct 155795



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155770 ctgcttctgcttctgcttct 155789



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155764 ctgcttctgcttctgcttct 155783



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155758 ctgcttctgcttctgcttct 155777



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155752 ctgcttctgcttctgcttct 155771



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155746 ctgcttctgcttctgcttct 155765



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155740 ctgcttctgcttctgcttct 155759



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155734 ctgcttctgcttctgcttct 155753



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155728 ctgcttctgcttctgcttct 155747



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 155722 ctgcttctgcttctgcttct 155741

to top

>gb|AC139062.10| Mus musculus chromosome 17, clone RP23-69L11, complete sequence
          Length = 136224

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 35875 ctgcttctgcttctgcttct 35894



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 35869 ctgcttctgcttctgcttct 35888



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 35863 ctgcttctgcttctgcttct 35882

to top

>gb|AC139225.10| Mus musculus chromosome 9, clone RP24-361G12, complete sequence
          Length = 196867

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16010 ctgcttctgcttctgcttct 16029



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 16004 ctgcttctgcttctgcttct 16023



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15974 ctgcttctgcttctgcttct 15993

to top

>gb|AC009847.9| Drosophila melanogaster clone BACR03L10, complete sequence
          Length = 180498

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 84633 ctgcttctgcttctgcttct 84652

to top

>gb|AC129162.5| Rattus norvegicus 9 BAC CH230-108L13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 245677

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 100175 ctgcttctgcttctgcttct 100194



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 100169 ctgcttctgcttctgcttct 100188

to top

>gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 230137

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76655 ctgcttctgcttctgcttct 76636



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 76649 ctgcttctgcttctgcttct 76630

to top

>gb|AC102155.10| Mus musculus chromosome 18, clone RP23-334J12, complete sequence
          Length = 189666

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 95738 ctgcttctgcttctgcttct 95757



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 95732 ctgcttctgcttctgcttct 95751

to top

>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 171048 ctgcttctgcttctgcttct 171067

to top

>gb|AC008309.8| Drosophila melanogaster clone BACR06L13, complete sequence
          Length = 163325

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 91299 ctgcttctgcttctgcttct 91280

to top

>gb|AC008257.6| Drosophila melanogaster clone BACR08A11, complete sequence
          Length = 170478

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 4369 ctgcttctgcttctgcttct 4350

to top

>gb|AC093102.2| Drosophila melanogaster clone BACR34C10, complete sequence
          Length = 179428

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 33670 ctgcttctgcttctgcttct 33651

to top

>ref|XM_581298.2| PREDICTED: Bos taurus similar to translocation associated membrane
           protein 1-like 1 (LOC505068), mRNA
          Length = 2391

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 394 ctgcttctgcttctgcttct 375



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 388 ctgcttctgcttctgcttct 369

to top

>ref|XM_423660.1| PREDICTED: Gallus gallus similar to CD244 natural killer cell
           receptor 2B4; NK cell activation inducing ligand NAIL;
           natural killer cell receptor 2B4 (LOC425980), mRNA
          Length = 1005

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 291 aggggacgaccttctggacagcag 314
           ||||||||||||||||| ||||||
Sbjct: 610 aggggacgaccttctggtcagcag 587

to top

>gb|AC169378.2| Sorghum bicolor clone SB_BBc0007L02, complete sequence
          Length = 138518

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 38015 ctgcttctgcttctgcttct 38034

to top

>gb|BC077759.1| Xenopus laevis nemo-like kinase, mRNA (cDNA clone MGC:79839
           IMAGE:5156699), complete cds
          Length = 2569

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 122 ctgcttctgcttctgcttct 103

to top

>ref|XM_456580.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A05962g)
            partial mRNA
          Length = 2298

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1591 ctgcttctgcttctgcttct 1572



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1585 ctgcttctgcttctgcttct 1566



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1579 ctgcttctgcttctgcttct 1560



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1573 ctgcttctgcttctgcttct 1554



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1567 ctgcttctgcttctgcttct 1548



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1561 ctgcttctgcttctgcttct 1542



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1555 ctgcttctgcttctgcttct 1536



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1549 ctgcttctgcttctgcttct 1530



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1543 ctgcttctgcttctgcttct 1524



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1537 ctgcttctgcttctgcttct 1518



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1531 ctgcttctgcttctgcttct 1512



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1525 ctgcttctgcttctgcttct 1506



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1519 ctgcttctgcttctgcttct 1500



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1495 ctgcttctgcttctgcttct 1476



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1489 ctgcttctgcttctgcttct 1470



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1483 ctgcttctgcttctgcttct 1464



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1477 ctgcttctgcttctgcttct 1458



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1471 ctgcttctgcttctgcttct 1452



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1465 ctgcttctgcttctgcttct 1446



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1459 ctgcttctgcttctgcttct 1440



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1453 ctgcttctgcttctgcttct 1434



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1447 ctgcttctgcttctgcttct 1428



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1441 ctgcttctgcttctgcttct 1422



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1435 ctgcttctgcttctgcttct 1416



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1429 ctgcttctgcttctgcttct 1410



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1423 ctgcttctgcttctgcttct 1404

to top

>ref|XM_456805.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A11297g)
            partial mRNA
          Length = 1704

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1408 ctgcttctgcttctgcttct 1389

to top

>ref|XM_456856.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A12551g)
           partial mRNA
          Length = 1689

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 676 ctgcttctgcttctgcttct 657

to top

>gb|AC102745.10| Mus musculus chromosome 17, clone RP24-371L2, complete sequence
          Length = 189211

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135446 ctgcttctgcttctgcttct 135427



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135440 ctgcttctgcttctgcttct 135421



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135434 ctgcttctgcttctgcttct 135415



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135428 ctgcttctgcttctgcttct 135409



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135422 ctgcttctgcttctgcttct 135403



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 135416 ctgcttctgcttctgcttct 135397

to top

>gb|AC116527.18| Mus musculus chromosome 16, clone RP24-354B8, complete sequence
          Length = 165306

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 79866 ctgcttctgcttctgcttct 79847

to top

>gb|AC107738.16| Mus musculus chromosome 1, clone RP23-348C6, complete sequence
          Length = 228427

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 166929 ctgcttctgcttctgcttct 166948



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 166923 ctgcttctgcttctgcttct 166942



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 166917 ctgcttctgcttctgcttct 166936

to top

>gb|AC110559.11| Mus musculus chromosome 7, clone RP23-253E12, complete sequence
          Length = 192856

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 142745 ctgcttctgcttctgcttct 142726



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 142739 ctgcttctgcttctgcttct 142720

to top

>gb|AC139580.4| Mus musculus BAC clone RP23-110M15 from chromosome 13, complete
             sequence
          Length = 205480

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 37248 ctgcttctgcttctgcttct 37267

to top

>gb|AC144816.3| Mus musculus BAC clone RP24-243E15 from chromosome 6, complete sequence
          Length = 167096

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34411 ctgcttctgcttctgcttct 34430



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34405 ctgcttctgcttctgcttct 34424



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34399 ctgcttctgcttctgcttct 34418



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34393 ctgcttctgcttctgcttct 34412



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34387 ctgcttctgcttctgcttct 34406



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34381 ctgcttctgcttctgcttct 34400



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34375 ctgcttctgcttctgcttct 34394



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 34369 ctgcttctgcttctgcttct 34388

to top

>ref|XM_959659.1| Neurospora crassa OR74A hypothetical protein (NCU00926.1) partial
            mRNA
          Length = 2217

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1412 ctgcttctgcttctgcttct 1393



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1406 ctgcttctgcttctgcttct 1387

to top

>ref|XM_325105.1| Neurospora crassa OR74A hypothetical protein (NCU00926.1) partial
            mRNA
          Length = 2217

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1412 ctgcttctgcttctgcttct 1393



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1406 ctgcttctgcttctgcttct 1387

to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 34      ctgcttctgcttctgcttct 53
               ||||||||||||||||||||
Sbjct: 3764103 ctgcttctgcttctgcttct 3764122



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 34      ctgcttctgcttctgcttct 53
               ||||||||||||||||||||
Sbjct: 3764097 ctgcttctgcttctgcttct 3764116

to top

>gb|AC131728.4| Mus musculus BAC clone RP23-122G5 from chromosome 5, complete sequence
          Length = 211796

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 157184 ctgcttctgcttctgcttct 157165

to top

>gb|AC131690.3| Mus musculus BAC clone RP23-386P10 from chromosome 10, complete sequence
          Length = 208306

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168911 ctgcttctgcttctgcttct 168892



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168905 ctgcttctgcttctgcttct 168886



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168847 ctgcttctgcttctgcttct 168828



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168841 ctgcttctgcttctgcttct 168822



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168835 ctgcttctgcttctgcttct 168816



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168829 ctgcttctgcttctgcttct 168810



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 168823 ctgcttctgcttctgcttct 168804

to top

>gb|AC111010.5| Mus musculus BAC clone RP23-419L21 from chromosome 14, complete
             sequence
          Length = 205141

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 29629 ctgcttctgcttctgcttct 29610



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 29623 ctgcttctgcttctgcttct 29604



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 29617 ctgcttctgcttctgcttct 29598



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 29611 ctgcttctgcttctgcttct 29592



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 29605 ctgcttctgcttctgcttct 29586



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 29599 ctgcttctgcttctgcttct 29580

to top

>gb|AC140412.2| Mus musculus BAC clone RP24-173O20 from chromosome 14, complete
             sequence
          Length = 152809

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50386 ctgcttctgcttctgcttct 50367



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50380 ctgcttctgcttctgcttct 50361



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50374 ctgcttctgcttctgcttct 50355



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50368 ctgcttctgcttctgcttct 50349



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50362 ctgcttctgcttctgcttct 50343



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50356 ctgcttctgcttctgcttct 50337



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50350 ctgcttctgcttctgcttct 50331



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50344 ctgcttctgcttctgcttct 50325



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50338 ctgcttctgcttctgcttct 50319



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 50332 ctgcttctgcttctgcttct 50313

to top

>gb|AC124717.3| Mus musculus BAC clone RP24-147K15 from chromosome 18, complete sequence
          Length = 204165

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195409 ctgcttctgcttctgcttct 195428



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195403 ctgcttctgcttctgcttct 195422



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195397 ctgcttctgcttctgcttct 195416



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195391 ctgcttctgcttctgcttct 195410



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195385 ctgcttctgcttctgcttct 195404



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195379 ctgcttctgcttctgcttct 195398



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195373 ctgcttctgcttctgcttct 195392



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 195367 ctgcttctgcttctgcttct 195386

to top

>ref|XM_715405.1| Candida albicans SC5314 putative transcription factor (CaO19_2748),
            mRNA
          Length = 2925

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 2586 ctgcttctgcttctgcttct 2567

to top

>ref|XM_715174.1| Candida albicans SC5314 putative transcription factor (CaO19_10262),
            mRNA
          Length = 2925

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 2586 ctgcttctgcttctgcttct 2567

to top

>ref|XM_709599.1| Candida albicans SC5314 putative small GTPase activator protein
           (CaO19.6986), mRNA
          Length = 2208

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 866 ctgcttctgcttctgcttct 885



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 860 ctgcttctgcttctgcttct 879

to top

>gb|AC108802.15| Mus musculus chromosome 12, clone RP23-220J1, complete sequence
          Length = 175510

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7248 ctgcttctgcttctgcttct 7229



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7242 ctgcttctgcttctgcttct 7223



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7236 ctgcttctgcttctgcttct 7217



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7230 ctgcttctgcttctgcttct 7211



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7224 ctgcttctgcttctgcttct 7205



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7218 ctgcttctgcttctgcttct 7199



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7212 ctgcttctgcttctgcttct 7193



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7206 ctgcttctgcttctgcttct 7187



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7200 ctgcttctgcttctgcttct 7181



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7194 ctgcttctgcttctgcttct 7175



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7188 ctgcttctgcttctgcttct 7169

to top

>gb|AC146113.3| Pan troglodytes BAC clone RP43-5I6 from 7, complete sequence
          Length = 223155

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 14872 ctgcttctgcttctgcttct 14853



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 14866 ctgcttctgcttctgcttct 14847

to top

>gb|AC130529.2| Mus musculus BAC clone RP23-124O11 from chromosome 16, complete
             sequence
          Length = 231967

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 20861 ctgcttctgcttctgcttct 20880

to top

>gb|AC125105.3| Mus musculus BAC clone RP24-220B7 from chromosome 16, complete sequence
          Length = 153616

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 127285 ctgcttctgcttctgcttct 127304

to top

>ref|XM_658678.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6166.2), mRNA
          Length = 1311

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 39   tctgcttctgcttctccggc 58
            ||||||||||||||||||||
Sbjct: 1072 tctgcttctgcttctccggc 1091

to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 34      ctgcttctgcttctgcttct 53
               ||||||||||||||||||||
Sbjct: 5469671 ctgcttctgcttctgcttct 5469652

to top

>gb|AC105166.16| Mus musculus chromosome 5, clone RP24-311D15, complete sequence
          Length = 145019

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 118903 ctgcttctgcttctgcttct 118922



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 118897 ctgcttctgcttctgcttct 118916



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 118891 ctgcttctgcttctgcttct 118910



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 118885 ctgcttctgcttctgcttct 118904

to top

>gb|AC131320.8| Mus musculus chromosome 12, clone RP23-398E18, complete sequence
          Length = 210230

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 92624 ctgcttctgcttctgcttct 92643

to top

>gb|AC112682.12| Mus musculus chromosome 6, clone RP23-332K10, complete sequence
          Length = 206903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132246 ctgcttctgcttctgcttct 132227



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132240 ctgcttctgcttctgcttct 132221



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132234 ctgcttctgcttctgcttct 132215



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132228 ctgcttctgcttctgcttct 132209



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132222 ctgcttctgcttctgcttct 132203



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132216 ctgcttctgcttctgcttct 132197



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132210 ctgcttctgcttctgcttct 132191



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132204 ctgcttctgcttctgcttct 132185



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132198 ctgcttctgcttctgcttct 132179



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132192 ctgcttctgcttctgcttct 132173



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132186 ctgcttctgcttctgcttct 132167



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132180 ctgcttctgcttctgcttct 132161



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132174 ctgcttctgcttctgcttct 132155



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132168 ctgcttctgcttctgcttct 132149



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132129 ctgcttctgcttctgcttct 132110



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132123 ctgcttctgcttctgcttct 132104

to top

>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete
            sequence
          Length = 230097

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9667 ctgcttctgcttctgcttct 9686



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9661 ctgcttctgcttctgcttct 9680



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9655 ctgcttctgcttctgcttct 9674



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9649 ctgcttctgcttctgcttct 9668



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9643 ctgcttctgcttctgcttct 9662



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9637 ctgcttctgcttctgcttct 9656



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9631 ctgcttctgcttctgcttct 9650



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9625 ctgcttctgcttctgcttct 9644



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9619 ctgcttctgcttctgcttct 9638



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9613 ctgcttctgcttctgcttct 9632



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9607 ctgcttctgcttctgcttct 9626



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9601 ctgcttctgcttctgcttct 9620



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 9595 ctgcttctgcttctgcttct 9614

to top

>gb|AC121533.6| Mus musculus chromosome 9, clone RP24-555P22, complete sequence
          Length = 175009

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 159664 ctgcttctgcttctgcttct 159683



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 159658 ctgcttctgcttctgcttct 159677

to top

>gb|AC166903.2| Mus musculus BAC clone RP24-163K10 from chromosome 16, complete
             sequence
          Length = 184060

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    caacccctgcttctgcttct 47
             ||||||||||||||||||||
Sbjct: 58558 caacccctgcttctgcttct 58539

to top

>gb|AC125274.12| Mus musculus chromosome 15, clone RP24-157F9, complete sequence
          Length = 188060

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 171526 ctgcttctgcttctgcttct 171545

to top

>gb|AY557640.1| Saccharomyces cerevisiae clone FLH001150.01X YCR087C-A gene,
           complete cds
          Length = 462

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 219 ctgcttctgcttctgcttct 200

to top

>gb|AC141899.4| Mus musculus BAC clone RP23-116G15 from chromosome 10, complete sequence
          Length = 210306

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122772 ctgcttctgcttctgcttct 122753



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122766 ctgcttctgcttctgcttct 122747



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122760 ctgcttctgcttctgcttct 122741



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122754 ctgcttctgcttctgcttct 122735



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122748 ctgcttctgcttctgcttct 122729



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122742 ctgcttctgcttctgcttct 122723



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122736 ctgcttctgcttctgcttct 122717



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 122730 ctgcttctgcttctgcttct 122711

to top

>gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome 8, complete sequence
          Length = 205244

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 86092 ctgcttctgcttctgcttct 86073

to top

>gb|AC137742.3| Mus musculus BAC clone RP24-345F6 from chromosome 16, complete sequence
          Length = 170248

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 100807 ctgcttctgcttctgcttct 100826

to top

>ref|XR_002820.1| PREDICTED: Mus musculus similar to complexin 2 (LOC670137), mRNA
          Length = 328

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 36 ctgcttctgcttctgcttct 17

to top

>gb|AC117610.7| Mus musculus chromosome 1, clone RP23-102B12, complete sequence
          Length = 191587

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106814 ctgcttctgcttctgcttct 106795



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106808 ctgcttctgcttctgcttct 106789



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106802 ctgcttctgcttctgcttct 106783



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106796 ctgcttctgcttctgcttct 106777



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106790 ctgcttctgcttctgcttct 106771



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106784 ctgcttctgcttctgcttct 106765



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106778 ctgcttctgcttctgcttct 106759



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106772 ctgcttctgcttctgcttct 106753



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106766 ctgcttctgcttctgcttct 106747



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106760 ctgcttctgcttctgcttct 106741



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106754 ctgcttctgcttctgcttct 106735



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106748 ctgcttctgcttctgcttct 106729



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106605 ctgcttctgcttctgcttct 106586



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106599 ctgcttctgcttctgcttct 106580



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 106593 ctgcttctgcttctgcttct 106574

to top

>gb|AC102350.14| Mus musculus chromosome 9, clone RP23-323P3, complete sequence
          Length = 211216

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 33800 ctgcttctgcttctgcttct 33781



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 33794 ctgcttctgcttctgcttct 33775



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 33788 ctgcttctgcttctgcttct 33769

to top

>ref|XM_973057.1| PREDICTED: Mus musculus hypothetical protein LOC669103 (LOC669103),
           mRNA
          Length = 471

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 257 ggaagagtaagaagagcaag 276
           ||||||||||||||||||||
Sbjct: 398 ggaagagtaagaagagcaag 417

to top

>ref|XM_973504.1| PREDICTED: Mus musculus hypothetical protein LOC664943 (LOC664943),
           mRNA
          Length = 471

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 257 ggaagagtaagaagagcaag 276
           ||||||||||||||||||||
Sbjct: 398 ggaagagtaagaagagcaag 417

to top

>ref|XM_975074.1| PREDICTED: Mus musculus hypothetical protein LOC674490 (LOC674490),
           mRNA
          Length = 471

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 257 ggaagagtaagaagagcaag 276
           ||||||||||||||||||||
Sbjct: 398 ggaagagtaagaagagcaag 417

to top

>ref|XM_001002647.1| PREDICTED: Mus musculus hypothetical protein LOC677347 (LOC677347),
           mRNA
          Length = 816

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 777 ctgcttctgcttctgcttct 758



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 771 ctgcttctgcttctgcttct 752



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 765 ctgcttctgcttctgcttct 746



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 759 ctgcttctgcttctgcttct 740



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 753 ctgcttctgcttctgcttct 734



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 747 ctgcttctgcttctgcttct 728



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 741 ctgcttctgcttctgcttct 722



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 735 ctgcttctgcttctgcttct 716



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 729 ctgcttctgcttctgcttct 710



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 705 ctgcttctgcttctgcttct 686



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 699 ctgcttctgcttctgcttct 680



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 669 ctgcttctgcttctgcttct 650



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 663 ctgcttctgcttctgcttct 644



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 657 ctgcttctgcttctgcttct 638



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 651 ctgcttctgcttctgcttct 632



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 645 ctgcttctgcttctgcttct 626



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 639 ctgcttctgcttctgcttct 620



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 633 ctgcttctgcttctgcttct 614



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 552 ctgcttctgcttctgcttct 533



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 528 ctgcttctgcttctgcttct 509



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 522 ctgcttctgcttctgcttct 503



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 516 ctgcttctgcttctgcttct 497



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 510 ctgcttctgcttctgcttct 491



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 504 ctgcttctgcttctgcttct 485



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 498 ctgcttctgcttctgcttct 479



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 492 ctgcttctgcttctgcttct 473



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 486 ctgcttctgcttctgcttct 467



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 480 ctgcttctgcttctgcttct 461



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 474 ctgcttctgcttctgcttct 455



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 468 ctgcttctgcttctgcttct 449



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 462 ctgcttctgcttctgcttct 443



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 456 ctgcttctgcttctgcttct 437

to top

>ref|XR_003410.1| PREDICTED: Mus musculus hypothetical protein LOC671416 (LOC671416),
           mRNA
          Length = 270

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 106 ctgcttctgcttctgcttct 87



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 100 ctgcttctgcttctgcttct 81



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 94 ctgcttctgcttctgcttct 75

to top

>gb|AC140373.2| Mus musculus BAC clone RP23-197O10 from chromosome 15, complete sequence
          Length = 215314

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 131699 ctgcttctgcttctgcttct 131718



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 131693 ctgcttctgcttctgcttct 131712

to top

>gb|AC132608.2| Mus musculus BAC clone RP23-451E12 from chromosome 18, complete sequence
          Length = 201478

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 172559 ctgcttctgcttctgcttct 172578



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 172553 ctgcttctgcttctgcttct 172572

to top

>gb|AC123830.5| Mus musculus BAC clone RP24-125B17 from chromosome 7, complete sequence
          Length = 186045

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 11239 ctgcttctgcttctgcttct 11220



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 11233 ctgcttctgcttctgcttct 11214



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 11227 ctgcttctgcttctgcttct 11208

to top

>ref|XM_715231.1| Candida albicans SC5314 hypothetical protein (CCW14) partial mRNA
          Length = 705

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 491 ctgcttctgcttctgcttct 510



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 485 ctgcttctgcttctgcttct 504

to top

>ref|XM_756180.1| Ustilago maydis 521 hypothetical protein (UM05126.1) partial mRNA
          Length = 3471

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1372 ctgcttctgcttctgcttct 1353

to top

>ref|XM_756235.1| Ustilago maydis 521 hypothetical protein (UM05181.1) partial mRNA
          Length = 279

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 220 ctgcttctgcttctgcttct 201



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 214 ctgcttctgcttctgcttct 195



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 208 ctgcttctgcttctgcttct 189



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 202 ctgcttctgcttctgcttct 183



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 196 ctgcttctgcttctgcttct 177



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 190 ctgcttctgcttctgcttct 171



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 184 ctgcttctgcttctgcttct 165



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 178 ctgcttctgcttctgcttct 159



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 172 ctgcttctgcttctgcttct 153



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 166 ctgcttctgcttctgcttct 147



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 160 ctgcttctgcttctgcttct 141



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 154 ctgcttctgcttctgcttct 135



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 148 ctgcttctgcttctgcttct 129



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 142 ctgcttctgcttctgcttct 123



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 136 ctgcttctgcttctgcttct 117



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 130 ctgcttctgcttctgcttct 111



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 124 ctgcttctgcttctgcttct 105



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 118 ctgcttctgcttctgcttct 99

to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 159     tgcgcggctgcttgcgcggc 178
               ||||||||||||||||||||
Sbjct: 2758122 tgcgcggctgcttgcgcggc 2758103

to top

>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete
             sequence
          Length = 233365

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13053 ctgcttctgcttctgcttct 13034



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13047 ctgcttctgcttctgcttct 13028



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13041 ctgcttctgcttctgcttct 13022



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13035 ctgcttctgcttctgcttct 13016



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13029 ctgcttctgcttctgcttct 13010



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13023 ctgcttctgcttctgcttct 13004



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 13017 ctgcttctgcttctgcttct 12998

to top

>ref|XM_389958.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09782.1)
           partial mRNA
          Length = 3183

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 314 ctgcttctgcttctgcttct 333

to top

>ref|XM_386348.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein
          (FG06172.1) partial mRNA
          Length = 2481

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 69 ctgcttctgcttctgcttct 50



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 63 ctgcttctgcttctgcttct 44



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 ctgcttctgcttctgcttct 53
          ||||||||||||||||||||
Sbjct: 57 ctgcttctgcttctgcttct 38

to top

>ref|XM_386337.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06161.1)
           partial mRNA
          Length = 1482

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 381 ctgcttctgcttctgcttct 362

to top

>gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, complete sequence
          Length = 213423

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 105922 ctgcttctgcttctgcttct 105941



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 105916 ctgcttctgcttctgcttct 105935



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 105910 ctgcttctgcttctgcttct 105929

to top

>gb|AC113470.14| Mus musculus chromosome 9, clone RP23-262N17, complete sequence
          Length = 202838

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 6930 ctgcttctgcttctgcttct 6949



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 6924 ctgcttctgcttctgcttct 6943



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 6918 ctgcttctgcttctgcttct 6937

to top

>ref|XM_568987.1| Cryptococcus neoformans var. neoformans JEC21 potassium channel
            (CNB04950) partial mRNA
          Length = 2622

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1634 ctgcttctgcttctgcttct 1615

to top

>ref|XM_568988.1| Cryptococcus neoformans var. neoformans JEC21 potassium channel
            (CNB04950) partial mRNA
          Length = 2684

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 1634 ctgcttctgcttctgcttct 1615

to top

>gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, complete sequence
          Length = 162417

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132378 ctgcttctgcttctgcttct 132397



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132372 ctgcttctgcttctgcttct 132391



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132366 ctgcttctgcttctgcttct 132385



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132360 ctgcttctgcttctgcttct 132379



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132354 ctgcttctgcttctgcttct 132373



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132348 ctgcttctgcttctgcttct 132367



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132342 ctgcttctgcttctgcttct 132361



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132315 ctgcttctgcttctgcttct 132334



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132309 ctgcttctgcttctgcttct 132328



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132303 ctgcttctgcttctgcttct 132322



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132297 ctgcttctgcttctgcttct 132316



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132291 ctgcttctgcttctgcttct 132310



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132285 ctgcttctgcttctgcttct 132304



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 132279 ctgcttctgcttctgcttct 132298

to top

>gb|AC135633.3| Mus musculus BAC clone RP24-84O13 from chromosome 19, complete sequence
          Length = 185138

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85163 ctgcttctgcttctgcttct 85182



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85157 ctgcttctgcttctgcttct 85176



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 85151 ctgcttctgcttctgcttct 85170

to top

>gb|AC142110.4| Mus musculus BAC clone RP24-104I11 from chromosome 7, complete
            sequence
          Length = 177085

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7925 ctgcttctgcttctgcttct 7944



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7919 ctgcttctgcttctgcttct 7938



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 7913 ctgcttctgcttctgcttct 7932

to top

>gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosome 9, complete sequence
          Length = 169614

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 140002 ctgcttctgcttctgcttct 140021



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 139996 ctgcttctgcttctgcttct 140015



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ctgcttctgcttctgcttct 53
              ||||||||||||||||||||
Sbjct: 139966 ctgcttctgcttctgcttct 139985

to top

>gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosome 5, complete
            sequence
          Length = 168528

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 6425 ctgcttctgcttctgcttct 6444

to top

>gb|AC130209.3| Mus musculus BAC clone RP24-369J19 from chromosome 6, complete
            sequence
          Length = 154867

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8705 ctgcttctgcttctgcttct 8724



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8699 ctgcttctgcttctgcttct 8718



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8693 ctgcttctgcttctgcttct 8712



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8687 ctgcttctgcttctgcttct 8706



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8681 ctgcttctgcttctgcttct 8700



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8675 ctgcttctgcttctgcttct 8694



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8669 ctgcttctgcttctgcttct 8688



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 8663 ctgcttctgcttctgcttct 8682

to top

>gb|AC130549.4| Mus musculus BAC clone RP24-456I3 from chromosome 7, complete sequence
          Length = 160449

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43190 ctgcttctgcttctgcttct 43171



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43184 ctgcttctgcttctgcttct 43165



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43178 ctgcttctgcttctgcttct 43159



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43172 ctgcttctgcttctgcttct 43153



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43166 ctgcttctgcttctgcttct 43147



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43160 ctgcttctgcttctgcttct 43141



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43154 ctgcttctgcttctgcttct 43135

to top

>ref|XM_799864.1| Trypanosoma cruzi strain CL Brener protein kinase
            (Tc00.1047053503627.20) partial mRNA
          Length = 4782

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ctgcttctgcttctgcttct 53
            ||||||||||||||||||||
Sbjct: 3257 ctgcttctgcttctgcttct 3276

to top

>gb|AC127353.3| Mus musculus BAC clone RP23-81P21 from chromosome 18, complete sequence
          Length = 225658

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94625 ctgcttctgcttctgcttct 94644



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94619 ctgcttctgcttctgcttct 94638



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94613 ctgcttctgcttctgcttct 94632



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94607 ctgcttctgcttctgcttct 94626



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94601 ctgcttctgcttctgcttct 94620



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94595 ctgcttctgcttctgcttct 94614



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94589 ctgcttctgcttctgcttct 94608



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94583 ctgcttctgcttctgcttct 94602



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94577 ctgcttctgcttctgcttct 94596



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94571 ctgcttctgcttctgcttct 94590



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94565 ctgcttctgcttctgcttct 94584



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 94559 ctgcttctgcttctgcttct 94578



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43490 ctgcttctgcttctgcttct 43509



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43484 ctgcttctgcttctgcttct 43503



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43478 ctgcttctgcttctgcttct 43497



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43472 ctgcttctgcttctgcttct 43491



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43466 ctgcttctgcttctgcttct 43485



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43400 ctgcttctgcttctgcttct 43419



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43394 ctgcttctgcttctgcttct 43413



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43388 ctgcttctgcttctgcttct 43407



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43382 ctgcttctgcttctgcttct 43401



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43376 ctgcttctgcttctgcttct 43395



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43370 ctgcttctgcttctgcttct 43389



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43364 ctgcttctgcttctgcttct 43383



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43358 ctgcttctgcttctgcttct 43377



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43352 ctgcttctgcttctgcttct 43371



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43346 ctgcttctgcttctgcttct 43365



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43340 ctgcttctgcttctgcttct 43359



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43298 ctgcttctgcttctgcttct 43317



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43292 ctgcttctgcttctgcttct 43311



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43286 ctgcttctgcttctgcttct 43305



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 43280 ctgcttctgcttctgcttct 43299

to top

>gb|AC132685.3| Mus musculus BAC clone RP23-278G24 from chromosome 7, complete sequence
          Length = 188989

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    ggaagagtaagaagagcaag 276
              ||||||||||||||||||||
Sbjct: 184985 ggaagagtaagaagagcaag 184966

to top

>gb|AC125321.4| Mus musculus BAC clone RP23-371B13 from chromosome 9, complete sequence
          Length = 196150

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 256    gggaagagtaagaagagcaaggtc 279
              ||||||||| ||||||||||||||
Sbjct: 105749 gggaagagttagaagagcaaggtc 105772

to top

>gb|AC130204.4| Mus musculus BAC clone RP24-427M16 from chromosome 18, complete
             sequence
          Length = 167394

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15237 ctgcttctgcttctgcttct 15218



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15231 ctgcttctgcttctgcttct 15212



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15225 ctgcttctgcttctgcttct 15206



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15219 ctgcttctgcttctgcttct 15200



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15177 ctgcttctgcttctgcttct 15158



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15171 ctgcttctgcttctgcttct 15152



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15165 ctgcttctgcttctgcttct 15146



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15159 ctgcttctgcttctgcttct 15140



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15153 ctgcttctgcttctgcttct 15134



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15147 ctgcttctgcttctgcttct 15128



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15141 ctgcttctgcttctgcttct 15122



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15135 ctgcttctgcttctgcttct 15116



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15129 ctgcttctgcttctgcttct 15110



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15123 ctgcttctgcttctgcttct 15104



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15117 ctgcttctgcttctgcttct 15098



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15051 ctgcttctgcttctgcttct 15032



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15045 ctgcttctgcttctgcttct 15026



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15039 ctgcttctgcttctgcttct 15020



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15033 ctgcttctgcttctgcttct 15014



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ctgcttctgcttctgcttct 53
             ||||||||||||||||||||
Sbjct: 15027 ctgcttctgcttctgcttct 15008

to top

>ref|XM_812058.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053511487.170) partial mRNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ctgcttctgcttctgcttct 53
           ||||||||||||||||||||
Sbjct: 541 ctgcttctgcttctgcttct 522

to top

>gb|AC124366.4| Mus musculus BAC clone RP24-541E9 from chromosome 1, complete sequence
          Length = 166555

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     cctgcttctgcttctgcttc 52
              ||||||||||||||||||||
Sbjct: 128761 cctgcttctgcttctgcttc 128780


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,956,124
Number of Sequences: 3902068
Number of extensions: 3956124
Number of successful extensions: 96754
Number of sequences better than 10.0: 565
Number of HSP's better than 10.0 without gapping: 573
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90977
Number of HSP's gapped (non-prelim): 5439
length of query: 578
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 555
effective length of database: 17,143,297,704
effective search space: 9514530225720
effective search space used: 9514530225720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result