ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal29f20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK112051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 363 4e-97
2dbj|AK099388.1| Oryza sativa (japonica cultivar-group) cDNA clon... 363 4e-97
3gb|AY104951.1| Zea mays PCO082478 mRNA sequence 303 3e-79
4dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 285 8e-74
5dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 285 8e-74
6dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic D... 285 8e-74
7gb|AY104915.1| Zea mays PCO082477 mRNA sequence 117 4e-23
8ref|NM_116283.2| Arabidopsis thaliana unknown protein AT4G00585 ... 50 0.008
9gb|AY091239.1| Arabidopsis thaliana unknown protein (At4g00585) ... 50 0.008
10gb|AY063842.1| Arabidopsis thaliana unknown protein (At4g00585) ... 50 0.008
11emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, c... 50 0.008
12emb|BX828090.1|CNS0A3SJ Arabidopsis thaliana Full-length cDNA Co... 50 0.008
13emb|BX827289.1|CNS0A3P8 Arabidopsis thaliana Full-length cDNA Co... 50 0.008
14gb|AY085811.1| Arabidopsis thaliana clone 18459 mRNA, complete s... 50 0.008
15dbj|AK118700.1| Arabidopsis thaliana mRNA for unknown protein, c... 50 0.008
16gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23 50 0.008
17gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 46 0.12
18gb|AC102680.10| Mus musculus chromosome 8, clone RP24-88L18, com... 46 0.12
19gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 1.9
20gb|AC104012.11| Homo sapiens chromosome 8, clone RP11-281N10, co... 42 1.9
21dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.9
22gb|AF165147.1|AF165147 Homo sapiens chromosome 21q22.1, PAC I228... 42 1.9
23dbj|BS000165.1| Pan troglodytes chromosome 22 clone:PTB-057B23, ... 42 1.9
24emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047 42 1.9
25emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in... 42 1.9
26gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.9
27gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 1.9
28emb|AL663011.2|OSJN00215 Oryza sativa genomic DNA, chromosome 4,... 42 1.9
29ref|NM_193237.1| Oryza sativa (japonica cultivar-group), predic... 40 7.6
30gb|BT019290.1| Zea mays clone Contig963.F mRNA sequence 40 7.6
31gb|AC149783.2| Bos taurus BAC CH240-3K17 (Children's Hospital O... 40 7.6
32gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromo... 40 7.6
33gb|AY813451.1| Schistosoma japonicum SJCHGC08298 protein mRNA, c... 40 7.6
34gb|AC159321.3| Mus musculus BAC clone RP23-18G14 from chromosome... 40 7.6
35gb|AC103934.10| Mus musculus chromosome 6, clone RP23-287O14, co... 40 7.6
36gb|AF457781.1| Schizothorax progastus haplotype SPR332-5f2 mitoc... 40 7.6
37gb|AF457780.1| Schizothorax progastus haplotype SPR332-3f2 mitoc... 40 7.6
38gb|AF457779.1| Schizothorax progastus haplotype SPR332-2f2 mitoc... 40 7.6
39gb|AF457778.1| Schizothorax progastus haplotype SPR332-1f2 mitoc... 40 7.6
40gb|AF457777.1| Schizothorax richardsonii haplotype SRI330-2f2 mi... 40 7.6
41gb|AF457776.1| Schizothorax richardsonii haplotype SRI330-1f2 mi... 40 7.6
42gb|AF457775.1| Schizothorax richardsonii haplotype SRI324-3f2 mi... 40 7.6
43gb|AF457774.1| Schizothorax richardsonii haplotype SRI324-2f2 mi... 40 7.6
44gb|AF457772.1| Schizothorax macrophthalmus haplotype SMA326-9f2 ... 40 7.6
45gb|AF457771.1| Schizothorax macrophthalmus haplotype SMA326-8f2 ... 40 7.6
46gb|AF457770.1| Schizothorax macrophthalmus haplotype SMA326-7f2 ... 40 7.6
47gb|AF457769.1| Schizothorax macrophthalmus haplotype SMA326-5f2 ... 40 7.6
48gb|AF457768.1| Schizothorax nepalensis haplotype SNE327-9f2 mito... 40 7.6
49gb|AF457767.1| Schizothorax nepalensis haplotype SNE327-8f2 mito... 40 7.6
50gb|AF457766.1| Schizothorax nepalensis haplotype SNE327-7f2 mito... 40 7.6
51gb|AF457765.1| Schizothorax nepalensis haplotype SNE327-6f2 mito... 40 7.6
52gb|AF457764.1| Schizothorax nepalensis haplotype SNE327-5f2 mito... 40 7.6
53gb|AF457763.1| Schizothorax nepalensis haplotype SNE327-4f2 mito... 40 7.6
54gb|AF457762.1| Schizothorax nepalensis haplotype SNE327-3f2 mito... 40 7.6
55gb|AF457761.1| Schizothorax nepalensis haplotype SNE327-1f2 mito... 40 7.6
56gb|AF457760.1| Schizothorax raraensis haplotype SrA325-8f2 mitoc... 40 7.6
57gb|AF457759.1| Schizothorax raraensis haplotype SRA325-7f2 mitoc... 40 7.6
58gb|AF457757.1| Schizothorax raraensis haplotype SRA325-4f2 mitoc... 40 7.6
59gb|AF457756.1| Schizothorax raraensis haplotype SRA325-3f2 mitoc... 40 7.6
60gb|AF457754.1| Schizothorax raraensis haplotype SRA326-13f2 mito... 40 7.6
61gb|AF457753.1| Schizothorax raraensis haplotype SRA326-12f2 mito... 40 7.6
62emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 i... 40 7.6
63gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete... 40 7.6
64emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment ... 40 7.6
65gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 7.6
66gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 40 7.6
67gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 7.6
68gb|AF087022.1|AF087022 Streptomyces venezuelae cytochrome P450 m... 40 7.6
69gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromo... 40 7.6
70gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 7.6
71dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
72dbj|AP003449.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
73gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 7.6
74gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Canc... 40 7.6
75dbj|AP005572.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
76gb|AY110731.1| Zea mays CL6588_1 mRNA sequence 40 7.6
77emb|AL136298.5|CNS01DW2 Human chromosome 14 DNA sequence BAC R-1... 40 7.6
78gb|AE015927.1| Clostridium tetani E88, complete genome 40 7.6
79gb|AF079139.1|AF079139 Streptomyces venezuelae pikCD operon, com... 40 7.6
80dbj|AP003972.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 7.6

>dbj|AK112051.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-E03, full
           insert sequence
          Length = 636

 Score =  363 bits (183), Expect = 4e-97
 Identities = 246/267 (92%)
 Strand = Plus / Plus

                                                                       
Query: 99  cggcggcggagatgggcggcgaccatggcggccacggcccgagcggcggcgacttccggc 158
           ||||||||| ||||||||||||||||||||| |||||||   | ||||||||||||||||
Sbjct: 52  cggcggcggcgatgggcggcgaccatggcgggcacggccacggaggcggcgacttccggc 111

                                                                       
Query: 159 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 218
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 112 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 171

                                                                       
Query: 219 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 278
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 172 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 231

                                                                       
Query: 279 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 338
           |||||||||||||||| || ||||| |||||||| |||||||| || ||||||||||| |
Sbjct: 232 agctcgagcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaa 291

                                      
Query: 339 actttggcaagaaggaatactgaagga 365
           ||||||||||||| || || |||||||
Sbjct: 292 actttggcaagaaagagtattgaagga 318



to top

>dbj|AK099388.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076P14, full
           insert sequence
          Length = 473

 Score =  363 bits (183), Expect = 4e-97
 Identities = 246/267 (92%)
 Strand = Plus / Plus

                                                                       
Query: 99  cggcggcggagatgggcggcgaccatggcggccacggcccgagcggcggcgacttccggc 158
           ||||||||| ||||||||||||||||||||| |||||||   | ||||||||||||||||
Sbjct: 41  cggcggcggcgatgggcggcgaccatggcgggcacggccacggaggcggcgacttccggc 100

                                                                       
Query: 159 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 218
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 101 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 160

                                                                       
Query: 219 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 278
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 161 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 220

                                                                       
Query: 279 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 338
           |||||||||||||||| || ||||| |||||||| |||||||| || ||||||||||| |
Sbjct: 221 agctcgagcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaa 280

                                      
Query: 339 actttggcaagaaggaatactgaagga 365
           ||||||||||||| || || |||||||
Sbjct: 281 actttggcaagaaagagtattgaagga 307



to top

>gb|AY104951.1| Zea mays PCO082478 mRNA sequence
          Length = 673

 Score =  303 bits (153), Expect = 3e-79
 Identities = 207/225 (92%)
 Strand = Plus / Plus

                                                                       
Query: 142 cggcggcgacttccggcagaaggtgtggagcatgacgggcgggccctactgccggcccgt 201
           ||||||||||||||| |||||||| ||||||||||||||||| || |||||||| |||||
Sbjct: 156 cggcggcgacttccgccagaaggtatggagcatgacgggcggcccgtactgccgccccgt 215

                                                                       
Query: 202 ccactggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccat 261
           |||||||||||| |||||||||||||||||| ||||| |||||||| |||||||||||||
Sbjct: 216 ccactggcgccgtaacaccgccatcgccatgttcggcgtcttcctcatctgcatccccat 275

                                                                       
Query: 262 cgccatgaaatccgccgagctcgagcaacgcccgcaccacccagtccggccaatcccatc 321
           ||| ||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 276 cgctatgaagtccgcagagctcgagcaacgcccgcatcacccagtccggccaatcccatc 335

                                                        
Query: 322 ccagctttggtgcaagaactttggcaagaaggaatactgaaggac 366
            || || |||||||| |||||||| ||||||||||||||||||||
Sbjct: 336 tcaactgtggtgcaaaaactttggtaagaaggaatactgaaggac 380



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  285 bits (144), Expect = 8e-74
 Identities = 177/188 (94%)
 Strand = Plus / Minus

                                                                            
Query: 99       cggcggcggagatgggcggcgaccatggcggccacggcccgagcggcggcgacttccggc 158
                ||||||||| ||||||||||||||||||||| |||||||   | ||||||||||||||||
Sbjct: 21962929 cggcggcggcgatgggcggcgaccatggcgggcacggccacggaggcggcgacttccggc 21962870

                                                                            
Query: 159      agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 218
                ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 21962869 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 21962810

                                                                            
Query: 219      ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 278
                |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 21962809 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 21962750

                        
Query: 279      agctcgag 286
                ||||||||
Sbjct: 21962749 agctcgag 21962742



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                            
Query: 285      agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 344
                |||||||||| || ||||| |||||||| |||||||| || ||||||||||| |||||||
Sbjct: 21961212 agcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaaactttg 21961153

                                     
Query: 345      gcaagaaggaatactgaagga 365
                ||||||| || || |||||||
Sbjct: 21961152 gcaagaaagagtattgaagga 21961132



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 132      acggcccgagcggcggcgac 151
                ||||||||||||||||||||
Sbjct: 11786254 acggcccgagcggcggcgac 11786273



to top

>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0635G10
          Length = 146728

 Score =  285 bits (144), Expect = 8e-74
 Identities = 177/188 (94%)
 Strand = Plus / Minus

                                                                        
Query: 99   cggcggcggagatgggcggcgaccatggcggccacggcccgagcggcggcgacttccggc 158
            ||||||||| ||||||||||||||||||||| |||||||   | ||||||||||||||||
Sbjct: 4993 cggcggcggcgatgggcggcgaccatggcgggcacggccacggaggcggcgacttccggc 4934

                                                                        
Query: 159  agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 218
            ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 4933 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 4874

                                                                        
Query: 219  ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 278
            |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 4873 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 4814

                    
Query: 279  agctcgag 286
            ||||||||
Sbjct: 4813 agctcgag 4806



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                        
Query: 285  agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 344
            |||||||||| || ||||| |||||||| |||||||| || ||||||||||| |||||||
Sbjct: 3276 agcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaaactttg 3217

                                 
Query: 345  gcaagaaggaatactgaagga 365
            ||||||| || || |||||||
Sbjct: 3216 gcaagaaagagtattgaagga 3196



to top

>dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1065_E04
          Length = 115865

 Score =  285 bits (144), Expect = 8e-74
 Identities = 177/188 (94%)
 Strand = Plus / Minus

                                                                         
Query: 99    cggcggcggagatgggcggcgaccatggcggccacggcccgagcggcggcgacttccggc 158
             ||||||||| ||||||||||||||||||||| |||||||   | ||||||||||||||||
Sbjct: 93646 cggcggcggcgatgggcggcgaccatggcgggcacggccacggaggcggcgacttccggc 93587

                                                                         
Query: 159   agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 218
             ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 93586 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 93527

                                                                         
Query: 219   ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 278
             |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 93526 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 93467

                     
Query: 279   agctcgag 286
             ||||||||
Sbjct: 93466 agctcgag 93459



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 285   agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 344
             |||||||||| || ||||| |||||||| |||||||| || ||||||||||| |||||||
Sbjct: 91929 agcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaaactttg 91870

                                  
Query: 345   gcaagaaggaatactgaagga 365
             ||||||| || || |||||||
Sbjct: 91869 gcaagaaagagtattgaagga 91849



to top

>gb|AY104915.1| Zea mays PCO082477 mRNA sequence
          Length = 1855

 Score =  117 bits (59), Expect = 4e-23
 Identities = 77/83 (92%)
 Strand = Plus / Plus

                                                                        
Query: 284  gagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaacttt 343
            |||||||||||||| ||||||||||||||||||||||| || || |||||||| ||||||
Sbjct: 1616 gagcaacgcccgcatcacccagtccggccaatcccatctcaactgtggtgcaaaaacttt 1675

                                   
Query: 344  ggcaagaaggaatactgaaggac 366
            || ||||||||||||||||||||
Sbjct: 1676 ggtaagaaggaatactgaaggac 1698



to top

>ref|NM_116283.2| Arabidopsis thaliana unknown protein AT4G00585 mRNA, complete cds
          Length = 558

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 186 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 245

            
Query: 266 a 266
           |
Sbjct: 246 a 246



to top

>gb|AY091239.1| Arabidopsis thaliana unknown protein (At4g00585) mRNA, complete cds
          Length = 298

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 97  tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 156

            
Query: 266 a 266
           |
Sbjct: 157 a 157



to top

>gb|AY063842.1| Arabidopsis thaliana unknown protein (At4g00585) mRNA, complete cds
          Length = 565

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 184 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 243

            
Query: 266 a 266
           |
Sbjct: 244 a 244



to top

>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2
          Length = 197975

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                         
Query: 206   tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
             ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 58875 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 58816

              
Query: 266   a 266
             |
Sbjct: 58815 a 58815



to top

>emb|BX828090.1|CNS0A3SJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1370

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 189 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 248

            
Query: 266 a 266
           |
Sbjct: 249 a 249



to top

>emb|BX827289.1|CNS0A3P8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS34ZC07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1365

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 173 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 232

            
Query: 266 a 266
           |
Sbjct: 233 a 233



to top

>gb|AY085811.1| Arabidopsis thaliana clone 18459 mRNA, complete sequence
          Length = 550

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 184 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 243

            
Query: 266 a 266
           |
Sbjct: 244 a 244



to top

>dbj|AK118700.1| Arabidopsis thaliana mRNA for unknown protein, complete cds, clone:
           RAFL19-96-J18
          Length = 552

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 186 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 245

            
Query: 266 a 266
           |
Sbjct: 246 a 246



to top

>gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23
          Length = 91849

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                         
Query: 206   tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 265
             ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 40001 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 39942

              
Query: 266   a 266
             |
Sbjct: 39941 a 39941



to top

>gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-22c10, complete
             sequence
          Length = 123020

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 212   cgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatc 262
             ||||||||||||||||| ||| |||| ||| ||||||| || || ||||||
Sbjct: 50191 cgcaacaccgccatcgctatgttcggtatcgtcctcgtttgtattcccatc 50141



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                         
Query: 285   agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 344
             ||||||| || || ||||| || || |||||||| |||||  | ||||||||||||||||
Sbjct: 46621 agcaacgaccacatcacccggttcgtccaatcccttcccaaatgtggtgcaagaactttg 46562

              
Query: 345   g 345
             |
Sbjct: 46561 g 46561



to top

>gb|AC102680.10| Mus musculus chromosome 8, clone RP24-88L18, complete sequence
          Length = 201260

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 378   ttcacaaagaaaatcctgttttt 400
             |||||||||||||||||||||||
Sbjct: 89603 ttcacaaagaaaatcctgttttt 89625



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 221     gccatcgccatggtcggcatc 241
               |||||||||||||||||||||
Sbjct: 1169646 gccatcgccatggtcggcatc 1169626



to top

>gb|AC104012.11| Homo sapiens chromosome 8, clone RP11-281N10, complete sequence
          Length = 170668

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 373   agactttcacaaagaaaatcc 393
             |||||||||||||||||||||
Sbjct: 95610 agactttcacaaagaaaatcc 95590



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 97      accggcggcggagatgggcggcgac 121
               ||||||||||||||| |||||||||
Sbjct: 1951624 accggcggcggagatcggcggcgac 1951648



to top

>gb|AF165147.1|AF165147 Homo sapiens chromosome 21q22.1, PAC I2280, complete sequence
          Length = 146735

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 380   cacaaagaaaatcctgttttt 400
             |||||||||||||||||||||
Sbjct: 46044 cacaaagaaaatcctgttttt 46064



to top

>dbj|BS000165.1| Pan troglodytes chromosome 22 clone:PTB-057B23, map 22, complete
             sequences
          Length = 142215

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 380   cacaaagaaaatcctgttttt 400
             |||||||||||||||||||||
Sbjct: 97301 cacaaagaaaatcctgttttt 97321



to top

>emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 380    cacaaagaaaatcctgttttt 400
              |||||||||||||||||||||
Sbjct: 164522 cacaaagaaaatcctgttttt 164542



to top

>emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in linkage group 20,
             complete sequence
          Length = 57535

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   actttcacaaagaaaatcctgtttt 399
             ||||||||||| |||||||||||||
Sbjct: 50876 actttcacaaaaaaaatcctgtttt 50852



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 282     tcgagcaacgcccgcaccacc 302
               |||||||||||||||||||||
Sbjct: 1505347 tcgagcaacgcccgcaccacc 1505327



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 114     gcggcgaccatggcggccacggccc 138
               ||||||||||||||||| |||||||
Sbjct: 4010629 gcggcgaccatggcggcgacggccc 4010605



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 10     cagcagcggcgcggcccgcc 29
              ||||||||||||||||||||
Sbjct: 196015 cagcagcggcgcggcccgcc 195996



to top

>emb|AL663011.2|OSJN00215 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0080H08,
             complete sequence
          Length = 138127

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    accggcggcggagatgggcggcgac 121
             ||||||||||||||| |||||||||
Sbjct: 94861 accggcggcggagatcggcggcgac 94885



to top

>ref|NM_193237.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 112 gggcggcgaccatggcggcc 131
           ||||||||||||||||||||
Sbjct: 316 gggcggcgaccatggcggcc 297



to top

>gb|BT019290.1| Zea mays clone Contig963.F mRNA sequence
          Length = 760

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 314 atcccatcccagctttggtgcaag 337
           ||||||||||| ||||||||||||
Sbjct: 187 atcccatcccatctttggtgcaag 164



to top

>gb|AC149783.2| Bos taurus  BAC CH240-3K17 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 205084

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 408   tgccttcttttgtcataacc 427
             ||||||||||||||||||||
Sbjct: 24505 tgccttcttttgtcataacc 24486



to top

>gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromosome 7, complete
              sequence
          Length = 217746

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 386    gaaaatcctgtttttacctttgtg 409
              |||||||||||||||| |||||||
Sbjct: 120963 gaaaatcctgtttttatctttgtg 120986



to top

>gb|AY813451.1| Schistosoma japonicum SJCHGC08298 protein mRNA, complete cds
          Length = 844

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 379 tcacaaagaaaatcctgttt 398
           ||||||||||||||||||||
Sbjct: 119 tcacaaagaaaatcctgttt 138



to top

>gb|AC159321.3| Mus musculus BAC clone RP23-18G14 from chromosome 6, complete sequence
          Length = 202584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 382    caaagaaaatcctgtttttacctt 405
              |||||||||||||||| |||||||
Sbjct: 150985 caaagaaaatcctgttcttacctt 150962



to top

>gb|AC103934.10| Mus musculus chromosome 6, clone RP23-287O14, complete sequence
          Length = 208817

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 382   caaagaaaatcctgtttttacctt 405
             |||||||||||||||| |||||||
Sbjct: 73953 caaagaaaatcctgttcttacctt 73976



to top

>gb|AF457781.1| Schizothorax progastus haplotype SPR332-5f2 mitochondrial control
           region, partial sequence
          Length = 583

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 199 tttattatcacatacaagga 180



to top

>gb|AF457780.1| Schizothorax progastus haplotype SPR332-3f2 mitochondrial control
           region, partial sequence
          Length = 585

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 199 tttattatcacatacaagga 180



to top

>gb|AF457779.1| Schizothorax progastus haplotype SPR332-2f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457778.1| Schizothorax progastus haplotype SPR332-1f2 mitochondrial control
           region, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457777.1| Schizothorax richardsonii haplotype SRI330-2f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457776.1| Schizothorax richardsonii haplotype SRI330-1f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457775.1| Schizothorax richardsonii haplotype SRI324-3f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457774.1| Schizothorax richardsonii haplotype SRI324-2f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457772.1| Schizothorax macrophthalmus haplotype SMA326-9f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457771.1| Schizothorax macrophthalmus haplotype SMA326-8f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457770.1| Schizothorax macrophthalmus haplotype SMA326-7f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457769.1| Schizothorax macrophthalmus haplotype SMA326-5f2 mitochondrial
           control region, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457768.1| Schizothorax nepalensis haplotype SNE327-9f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457767.1| Schizothorax nepalensis haplotype SNE327-8f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457766.1| Schizothorax nepalensis haplotype SNE327-7f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457765.1| Schizothorax nepalensis haplotype SNE327-6f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457764.1| Schizothorax nepalensis haplotype SNE327-5f2 mitochondrial control
           region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457763.1| Schizothorax nepalensis haplotype SNE327-4f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457762.1| Schizothorax nepalensis haplotype SNE327-3f2 mitochondrial control
           region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457761.1| Schizothorax nepalensis haplotype SNE327-1f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457760.1| Schizothorax raraensis haplotype SrA325-8f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457759.1| Schizothorax raraensis haplotype SRA325-7f2 mitochondrial control
           region, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457757.1| Schizothorax raraensis haplotype SRA325-4f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457756.1| Schizothorax raraensis haplotype SRA325-3f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457754.1| Schizothorax raraensis haplotype SRA326-13f2 mitochondrial control
           region, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>gb|AF457753.1| Schizothorax raraensis haplotype SRA326-12f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tttattatcacatacaagga 510
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181



to top

>emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 in linkage group 12,
              complete sequence
          Length = 212974

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 384    aagaaaatcctgtttttacctttg 407
              ||||||||| ||||||||||||||
Sbjct: 113029 aagaaaatcttgtttttacctttg 113052



to top

>gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete sequence
          Length = 125590

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 386   gaaaatcctgtttttacctttgtg 409
             |||||||||||||||| |||||||
Sbjct: 29814 gaaaatcctgtttttatctttgtg 29791



to top

>emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment 6/24
          Length = 321950

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 303   cagtccggccaatcccatcc 322
             ||||||||||||||||||||
Sbjct: 33863 cagtccggccaatcccatcc 33882



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 127     cggccacggcccgagcggcg 146
               ||||||||||||||||||||
Sbjct: 1553144 cggccacggcccgagcggcg 1553163



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 508     ggagtgcctgtttgtttgcgattc 531
               ||||||||||||||| ||||||||
Sbjct: 1795696 ggagtgcctgtttgtctgcgattc 1795673



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 225     tcgccatggtcggcatcttc 244
               ||||||||||||||||||||
Sbjct: 2428516 tcgccatggtcggcatcttc 2428497



to top

>gb|AF087022.1|AF087022 Streptomyces venezuelae cytochrome P450 monooxygenase (picK) gene,
           complete cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 24  cccgcccaggcccagaccgc 43
           ||||||||||||||||||||
Sbjct: 671 cccgcccaggcccagaccgc 690



to top

>gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromosome 7, complete
              sequence
          Length = 193048

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 386    gaaaatcctgtttttacctttgtg 409
              |||||||||||||||| |||||||
Sbjct: 187992 gaaaatcctgtttttatctttgtg 188015



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 109     gatgggcggcgaccatggcggcca 132
               ||||||||||||||| ||||||||
Sbjct: 3664609 gatgggcggcgaccagggcggcca 3664632



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 112      gggcggcgaccatggcggcc 131
                ||||||||||||||||||||
Sbjct: 19434487 gggcggcgaccatggcggcc 19434506



to top

>dbj|AP003449.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0086A10
          Length = 151071

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   gggcggcgaccatggcggcc 131
             ||||||||||||||||||||
Sbjct: 43303 gggcggcgaccatggcggcc 43322



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 141    gcggcggcgacttccggcag 160
              ||||||||||||||||||||
Sbjct: 350878 gcggcggcgacttccggcag 350897



to top

>gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109972

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 396   tttttacctttgtgccttcttttg 419
             |||||||||||||||||| |||||
Sbjct: 47521 tttttacctttgtgcctttttttg 47544



to top

>dbj|AP005572.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1506_A04
          Length = 114998

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   acggcccgagcggcggcgac 151
             ||||||||||||||||||||
Sbjct: 29072 acggcccgagcggcggcgac 29091



to top

>gb|AY110731.1| Zea mays CL6588_1 mRNA sequence
          Length = 874

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 314 atcccatcccagctttggtgcaag 337
           ||||||||||| ||||||||||||
Sbjct: 252 atcccatcccatctttggtgcaag 229



to top

>emb|AL136298.5|CNS01DW2 Human chromosome 14 DNA sequence BAC R-134E15 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181532

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 398    tttacctttgtgccttcttttgtcataa 425
              |||||||| ||||||||||||| |||||
Sbjct: 115196 tttaccttggtgccttcttttgccataa 115169



to top

>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 338     aactttggcaagaaggaata 357
               ||||||||||||||||||||
Sbjct: 1517226 aactttggcaagaaggaata 1517245



to top

>gb|AF079139.1|AF079139 Streptomyces venezuelae pikCD operon, complete sequence
          Length = 4342

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 24  cccgcccaggcccagaccgc 43
           ||||||||||||||||||||
Sbjct: 671 cccgcccaggcccagaccgc 690



to top

>dbj|AP003972.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-861E23, complete
             sequence
          Length = 181946

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   gtctgcatccccatcgccat 267
             ||||||||||||||||||||
Sbjct: 62029 gtctgcatccccatcgccat 62048


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,320,718
Number of Sequences: 3902068
Number of extensions: 4320718
Number of successful extensions: 93622
Number of sequences better than 10.0: 80
Number of HSP's better than 10.0 without gapping: 81
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92463
Number of HSP's gapped (non-prelim): 1159
length of query: 558
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 535
effective length of database: 17,143,297,704
effective search space: 9171664271640
effective search space used: 9171664271640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top