>gb|AC108334.10| Rattus norvegicus 4 BAC CH230-151B7 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 187811

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 145    gctacccttgttctttgtgtctt 167
              |||||||||||||||||||||||
Sbjct: 112648 gctacccttgttctttgtgtctt 112626

>gb|AC149367.2| Phakopsora pachyrhizi clone JGIAFNA-53G15, complete sequence
          Length = 37899

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 185   ataatttctgggtaacttttg 205
             |||||||||||||||||||||
Sbjct: 30600 ataatttctgggtaacttttg 30620

>emb|AL138823.14| Human DNA sequence from clone RP11-64J21 on chromosome 13 Contains part
             of a novel gene similar to tumour-associated hydroquinone
             (NADH) oxidase TNOX, a ribosomal protein L36 (RPL36)
             pseudogene and a CpG island, complete sequence
          Length = 175112

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 169   cagaccaaataatcttataatttct 193
             ||||||| |||||||||||||||||
Sbjct: 13346 cagaccacataatcttataatttct 13322

>gb|AC005075.2|AC005075 Homo sapiens BAC clone CTA-219E16 from 7, complete sequence
          Length = 118334

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 68     tgtagcttctttgtacctata 88
              |||||||||||||||||||||
Sbjct: 118078 tgtagcttctttgtacctata 118058

>gb|AC132405.3| Mus musculus BAC clone RP23-332I1 from chromosome 3, complete sequence
          Length = 207726

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    cttgttctttgtgtctttca 170
              ||||||||||||||||||||
Sbjct: 207490 cttgttctttgtgtctttca 207471

>gb|AC121825.3| Mus musculus BAC clone RP23-469H5 from chromosome 3, complete sequence
          Length = 174974

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    cttgttctttgtgtctttca 170
              ||||||||||||||||||||
Sbjct: 155421 cttgttctttgtgtctttca 155440

>emb|AJ289861.1|STH289861 Streptococcus thermophilus eps locus
          Length = 21562

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 166   tttcagaccaaataatcttataatttct 193
             ||||||||||| |||| |||||||||||
Sbjct: 16194 tttcagaccaattaatattataatttct 16167

>emb|CT573421.5| M.truncatula DNA sequence from clone MTH2-27B10 on chromosome 3,
             complete sequence
          Length = 123669

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 150   ccttgttctttgtgtctttc 169
             ||||||||||||||||||||
Sbjct: 74704 ccttgttctttgtgtctttc 74685

>emb|AL845290.7| Mouse DNA sequence from clone RP23-201A19 on chromosome 2, complete
             sequence
          Length = 146005

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   aatttctgggtaacttttgg 206
             ||||||||||||||||||||
Sbjct: 54544 aatttctgggtaacttttgg 54525

>gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete genome
          Length = 1796846

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 166    tttcagaccaaataatcttataatttct 193
              ||||||||||| |||| |||||||||||
Sbjct: 967926 tttcagaccaattaatattataatttct 967953


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,857,395
Number of Sequences: 3902068
Number of extensions: 1857395
Number of successful extensions: 133595
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 133556
Number of HSP's gapped (non-prelim): 39
length of query: 219
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 197
effective length of database: 17,147,199,772
effective search space: 3377998355084
effective search space used: 3377998355084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)